Dear group, I know this issue has been discussed before, but I had a hard time figuring out how to associate the intensity of a probe in CEL file with the x, y coordinates of the probes in the chip. For example, in Affymetrix U133A chip, the first probe is: >probe:HG-U133A_2:1007_s_at:416:177; Interrogation_Position=3330; Antisense; CACCCAGCTGGTCCTGTGGATGGGA where 416 is x coordinate and 177 is y coordinate on the chip. But when I use the following command, >cel<-ReadAffy() # there is only one CELfile in the folder >pmindex(cel)[1] I got the location information of the probe set 1007_s_at : $"1007_s_at" [1] 129340 213420 396671 82246 430968 427082 432610 72465 432865 99501 [11] 504952 443862 341432 198778 463575 10989 But none of the following equations that mentioned in the list before can fit into these numbers >(Textual description of makecdfenv): j = x*nrow + y + 1 >(Textual description of affy, p.26): j = x*nrow y + 1 (sic!) j = Probe.Y * >nrow + Probe.X + 1 (for the perfect match) >jmm = Probe.Y * nrow + Probe.X + 2 (for the mismatch) Does nrow refer to the row number of the batch file? Here ncol(intensity(cel))=1, nrow(intensity(cel))=506944 Can anybody tell me how this works please? Thank you very much, Ashley _________________________________________________________________ Don’t just search. Find. Check out the new MSN Search!

Ashley Lin wrote: > Dear group, > > I know this issue has been discussed before, but I had a hard time > figuring out how to associate the intensity of a probe in CEL file with > the x, y coordinates of the probes in the chip. > > For example, in Affymetrix U133A chip, the first probe is: > >> probe:HG-U133A_2:1007_s_at:416:177; Interrogation_Position=3330; >> Antisense; > > CACCCAGCTGGTCCTGTGGATGGGA > > where 416 is x coordinate and 177 is y coordinate on the chip. > > But when I use the following command, > >> cel<-ReadAffy() # there is only one CELfile in the folder >> pmindex(cel)[1] > > > I got the location information of the probe set 1007_s_at : > > $"1007_s_at" > [1] 129340 213420 396671 82246 430968 427082 432610 72465 432865 99501 > [11] 504952 443862 341432 198778 463575 10989 The problem here is that you are looking at the hgu133a2probe package (designed for the HG-U133A version 2 chip), but comparing to data from the HG-U133A chip. If you look at data from the correct probe package you get: > as.data.frame(hgu133aprobe)[1,] sequence x y Probe.Set.Name Probe.Interrogation.Position 1 CACCCAGCTGGTCCTGTGGATGGGA 467 181 1007_s_at and using the correct xy2i function, I get > xy2i(467, 181) [1] 129340 Best, Jim > > But none of the following equations that mentioned in the list before > can fit into these numbers > >> (Textual description of makecdfenv): j = x*nrow + y + 1 >> (Textual description of affy, p.26): j = x*nrow y + 1 (sic!) j = >> Probe.Y * nrow + Probe.X + 1 (for the perfect match) >> jmm = Probe.Y * nrow + Probe.X + 2 (for the mismatch) > > > Does nrow refer to the row number of the batch file? Here > ncol(intensity(cel))=1, nrow(intensity(cel))=506944 > > Can anybody tell me how this works please? > > Thank you very much, > Ashley > > _________________________________________________________________ > Don?t just search. Find. Check out the new MSN Search! > > > -------------------------------------------------------------------- ---- > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor -- James W. MacDonald Affymetrix and cDNA Microarray Core University of Michigan Cancer Center 1500 E. Medical Center Drive 7410 CCGC Ann Arbor MI 48109 734-647-5623