Question: SGSeq error on getBamInfo
gravatar for oolongoni
17 months ago by
oolongoni10 wrote:


I am running into some trouble using SGSeq::getBamInfo.

> getBamInfo(df)

Warning message:
Custom tag 'XS' not found in BAM file:

Spliced alignments must include a custom tag 'XS'.
Compatible BAM files can be obtained with an alignment
program for RNA-seq data (e.g. GSNAP, HISAT, STAR, TopHat). 


This is strange because I used STAR aligner and can see from samtools view output that the BAM files do in fact have the `Custom tag 'XS'` What could be the problem?

$ samtools view ~/scratch/NeoGeo/BAM/CD19/CD19_KTP-33_S14_L00.bam | head -10

NB501378:127:HL3WTAFXX:2:21104:15141:15869    163    chr16    28931963    255    75M    =    28932344    445    CCTGCGCGAAGCTGGGTGCCCCGGAGAGTCTGACCACCATGCCCCCTACTCGCCACCACTTCTTCCTCCGCTTCC    AAAAA6EEA/EAE6E6EEEEAEEEEEE/EEEA//E/AEE//EE/6EE/</E/<A/A//EEEAE<EA////EEA<E    NH:i:1    HI:i:1    AS:i:123    NM:i:5    MD:Z:43A3C6T2T11T5





NB501378:127:HL3WTAFXX:3:21412:2893:17606    163    chr16    28931984    255    76M    =    28932075    424    CGGAGAGTCTGACCACCATGCCACCTCCTCGCCTCCACTACTTCCTCCTCTTCCTCACCCCCAAGGAAGACACGCC    AA/AAEA/EEEEE/E/EEA/EEE<EEEEEEEA</EE////E6EAA<<//E/<EE/EEEAAEEA/<EEE//AE/EEE    NH:i:1    HI:i:1    AS:i:140    NM:i:5    MD:Z:36T2T23T5T2G3    XS:A:+




rnaseq sgseq getbaminfo • 336 views
ADD COMMENTlink modified 17 months ago by Leonard Goldstein80 • written 17 months ago by oolongoni10
Answer: SGSeq error on getBamInfo
gravatar for Leonard Goldstein
17 months ago by
United States
Leonard Goldstein80 wrote:

The error message should list the problematic files but it returns an empty string. Looks like something went wrong that was not caught by the internal checks (probably unrelated to the XS tag). Are your BAM file paths correct and are index files present? You can try running the following and see if you get a more informative error message

SGSeq:::getBamInfoPerSample(df$file_bam[1], NULL, df$sample_name[1])


ADD COMMENTlink written 17 months ago by Leonard Goldstein80
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 454 users visited in the last hour