Query with Biostrings pairwise alignment output positon
Entering edit mode
dhwani2410 • 0
Last seen 23 months ago
> query <- readDNAStringSet("ref.fasta")
> sub1 <- readDNAStringSet("seq1.fasta")
> sub2 <- readDNAStringSet("seq2.fasta")
> mat <- nucleotideSubstitutionMatrix(match = 5, mismatch = -4, baseOnly = TRUE)
> res1 <- pairwiseAlignment(pattern = query,subject = sub1,gapOpening = 10.5, gapExtension = .5,substitutionMatrix = mat)
> res2 <- pairwiseAlignment(pattern = query,subject = sub2,gapOpening = 10.5, gapExtension = .5,substitutionMatrix = mat)
> deletion(res1)
IRangesList of length 1
IRanges of length 1
    start end width
[1]   533 533     1

> insertion(res2);deletion(res2)
IRangesList of length 1
IRanges of length 1
    start end width
[1]   363 364     2

IRangesList of length 1
IRanges of length 3
    start end width
[1]   196 213    18
[2]   201 203     3
[3]   336 337     2

> writePairwiseAlignments(res1)
# Program: Biostrings (version 2.38.4), a Bioconductor package
# Rundate: Thu Dec 14 11:35:27 2017

# Aligned_sequences: 2
# 1: ref
# 2: seq1
# Matrix: NA
# Gap_penalty: 11.0
# Extend_penalty: 0.5
# Length: 1099
# Identity:    1098/1099 (99.9%)
# Similarity:    NA/1099 (NA%)
# Gaps:           1/1099 (0.1%)
# Score: 5479











                     |||||||||||||||||||||||||||||||| |||||||||||||||||


> writePairwiseAlignments(res2)
# Program: Biostrings (version 2.38.4), a Bioconductor package
# Rundate: Thu Dec 14 11:35:28 2017
# Aligned_sequences: 2
# 1: ref
# 2: seq2
# Matrix: NA
# Gap_penalty: 10.5
# Extend_penalty: 0.5
# Length: 1121
# Identity:     490/1121 (43.7%)
# Similarity:    NA/1121 (NA%)
# Gaps:         577/1121 (51.5%)
# Score: 1882.5

seq2               1 --------------------------------------------------      0

                                            |||||||||||||||||||||||  ||
seq2               1 -----------------------GCTCCCACTCCATGAGGTATTTCCACA     27

                     |  || ||||||||||||||||||||||||||||||||||| ||||||||

                     |||||||||||||||| ||||||| ||||||||||||||||| |||| |

                     || || ||||||||||||||| ||||||||||||||||||||||||||||

ref              251 GGGACCAGGAGACACGGA------------------ATATG---AAGGCC    279
                     |||||| |||||||| ||                  | ||    ||| ||

                      || |||||||| |||||| || |||| ||| ||||||||||||||||||

                     ||||||||||| ||| ||||||||| ||||||  ||||| ||||||||||

                     ||||||||||||||||| |||||||||||  || |  ||| |||||||||

                     |||||||||||||||||||||||||||||||||||||||| |||||||||

                     |||||||  || |||||||||||| |||||||||||||||||| || ||

                     ||||||||||   |||| |||||||||||||  |||||||||  ||||||

                     ||||||||||||||||||||||||| |||||| ||||| |||        

ref             1078 CTCACAGCTTGTAAAGTGTGA   1098
seq2             568 ---------------------    567


> sessionInfo()
R version 3.2.3 (2015-12-10)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 16.04.1 LTS

 [1] LC_CTYPE=en_IN.UTF-8      
 [2] LC_NUMERIC=C              
 [3] LC_TIME=en_IN.UTF-8       
 [4] LC_COLLATE=en_IN.UTF-8    
 [5] LC_MONETARY=en_IN.UTF-8   
 [6] LC_MESSAGES=en_IN.UTF-8   
 [7] LC_PAPER=en_IN.UTF-8      
 [8] LC_NAME=C                 
 [9] LC_ADDRESS=C              
[10] LC_TELEPHONE=C            

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices
[6] utils     datasets  methods   base     

other attached packages:
[1] Biostrings_2.38.4   XVector_0.10.0     
[3] IRanges_2.4.8       S4Vectors_0.8.11   
[5] BiocGenerics_0.16.1

loaded via a namespace (and not attached):
[1] zlibbioc_1.16.0      BiocInstaller_1.20.3
[3] tools_3.2.3


1) For seq1 Parameters are kept exactly same as in needle of emboss, still the gaps introduced is at different position.

2) For seq2 even after using the insertion() and deletion() , the reported bases overlap with each other

PS : I have deleted last section of the alignment that is printed because of the word limit for this post.


biostrings alignment pairwisealignment • 565 views
Entering edit mode
Last seen 3 days ago
Seattle, WA, United States

Hi Dhwani,

1) One possible explanation for the discrepancy with Emboss needle is that pairwiseAlignment() interprets gapOpening as the cost of opening the gap only. This differs from other alignment software where it's the cost of the first dash ("-") in the gap. Have a look at writePairwiseAlignments() man page (?writePairwiseAlignments) for a detailed explanation of the meaning of gapOpening and the relationship between gapOpening/gapExtension and Gap_penalty/Extend_penalty. Also example C in the Examples section is taken from the Emboss website. It illustrates this relationship and shows you how you need to adjust gapOpening in order to obtain the same results as with Emboss needle.

2) The ranges are reported with respect to the original (i.e. unaligned) pattern. As a consequence, they sometimes seem to overlap:

pa <- pairwiseAlignment("AAACCAAA", "AAATTTTCCTTTTAAA")

#  IRangesList of length 1
#  [[1]]
#  IRanges object with 0 ranges and 0 metadata columns:
#         start       end     width
#     <integer> <integer> <integer>

# IRangesList of length 1
# [[1]]
# IRanges object with 2 ranges and 0 metadata columns:
#          start       end     width
#      <integer> <integer> <integer>
#  [1]         4         7         4
#  [2]         6         9         4 

This is normal and expected. I think that what's confusing here is to think of the start/end/width triplet as representing a range. It makes more sense to interpret the start as the position where the insertion or deletion starts in the original pattern, and the width as its length. The end should be ignored since it has no meaning.  

> writePairwiseAlignments(pa)
# Program: Biostrings (version 2.47.0), a Bioconductor package
# Rundate: Wed Dec 13 08:25:18 2017
# Aligned_sequences: 2
# 1: P1
# 2: S1
# Matrix: NA
# Gap_penalty: 14.0
# Extend_penalty: 4.0
# Length: 16
# Identity:       8/16 (50.0%)
# Similarity:    NA/16 (NA%)
# Gaps:           8/16 (50.0%)
# Score: -39.46618

P1                 1 AAA----CC----AAA      8
                     |||    ||    |||
S1                 1 AAATTTTCCTTTTAAA     16


Hope this helps.



Entering edit mode

I am able to resolve the confusion for the second query with the help of your explanations. However i tried addressing the first problem based on the formula for gap opening and extension. The answer still remains same even after adding the changes. I have used Gap opening penalty as 10.5 (10 opening + .5 extension) and .5 as gap extension penalty. (While using needle of emboss the gap opening and extension penalty are 10 and .5 respectively. )

Entering edit mode

Did you consult ?writePairwiseAlignments as I suggested? It explains the relationship between Biostrings' gapOpening/gapExtension and Emboss needle's Gap_penalty/Extend_penalty, and gives the formula to go from the latter to the former:

    Gap_penalty = gapOpening + gapExtension
    Extend_penalty = gapExtension

So if you use a Gap_penalty and Extend_penalty of 10 and .5 with Emboss needle, you should use a gapOpening and gapExtension of 9.5 and 0.5 with Biostrings.

Entering edit mode

The man page for writePairwiseAlignments even contain the following example:

## --------------------------------------------------------------
##    http://emboss.sourceforge.net/docs/themes/alnformats/align.pair
## --------------------------------------------------------------
pattern <- unlist(AAStringSet(pattern))
subject <- unlist(AAStringSet(subject))
pattern  # original pattern
subject  # original subject
pa5 <- pairwiseAlignment(pattern, subject,
                         gapOpening=9.5, gapExtension=0.5)
writePairwiseAlignments(pa5, Matrix="BLOSUM62")

You can't say the information is not there ;-)


Login before adding your answer.

Traffic: 442 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6