branchpointer ERROR: Error in data.table::fread(paste0(workingDirectory, "/mutation_", uniqueId, :
0
0
Entering edit mode
noah.pieta • 0
@noahpieta-12714
Last seen 8 months ago
China/Shanghai/SIBS, CAS

Hello!

i have problems using branchpointer.

when i used command

"branchpointPredictionsIntron <- predictBranchpoints(queryIntronFromGTF,queryType='region',genome="/mypath/data/GRCh38.primary_assembly.genome.fa",bedtoolsLocation='mypath/bedtools')" in guidelines, it failed and report the error below:

Error in data.table::fread(paste0(workingDirectory, "/mutation_", uniqueId,  :
  Expected sep (':') but new line, EOF (or other non printing character) ends field 0 when detecting types from point 0: AAATTCGGCCTTAGCTGATAGGGACGTTATTGGAGCTGGGGTGGCTGAAGTTGGTTAGACCTGGGGGAGGGGATGTGTTCACAGGTGACGCATCTCTGAGCGTTCCCGCATGGGCTGTGGTGGCCAGTGTGGGCTTCCCCCAGCTTCCGCCCAGCGGGCTGACTCAGAGGTCTCCCCACATCTCTGCCCAGGGCTTGAGTCTACTGTGGACATTTGCCCTAAACACCTAAAGCCCCCAGTCTAGCCCCTTCCCCAGGAGAGGACTAATGACACCTACCGCCATGTCCACCCCAGGTTCGGGTCTGGCGGTACTTGAAGGGCAAAGACCTGGTGGCCCGGGAGAGCCTGCTGGACGGCGGCAACAAGGTGGTGATCAGCGGCTTTGGAGACCCCCTCATCTGTGACAACCAGGTGTCCACTGGGGACACCAGGATCTTCTTTGTGAACCCTGCACCCCCATACCTGTGGCCAGCCCACAAGAACGAGCTGATGCTCAACTCCAGCCTCATGCGGATCACCCTGCGGAAC

 

would you please to help me solve this problem? Thank you !

branchpointer • 588 views
ADD COMMENT

Login before adding your answer.

Traffic: 486 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6