Search
Question: blastn for selected database and/or organism
0
gravatar for aush
5 weeks ago by
aush10
United States
aush10 wrote:

Is there any way to blast my nucleotide sequence only against specific NCBI database, for example, refseq_rna?

Similarly, I'd like to limit my search to a specific organism/taxid.

https://screenshotscdn.firefoxusercontent.com/images/0d67820a-787a-4d5b-9eb0-1143113f4d20.png

 

As I understand, blastSequences() doesn't have these options now. Is there any other solution?

ADD COMMENTlink modified 4 weeks ago by James W. MacDonald46k • written 5 weeks ago by aush10
1
gravatar for James W. MacDonald
4 weeks ago by
United States
James W. MacDonald46k wrote:

Note that blastSequences is just doing a query to the NCBI blast API, as noted in the help page for the function. Because of that, you can only make the queries that are amenable to the API. You can for example query on a different database (again, as noted in the help page):

>  blastSequences(x = "GGCCTTCATTTACCCAAAATG", database = "reseq_rna")
estimated response time 45 seconds
list()

But there isn't any facility, so far as I can tell, to specify the organism.

ADD COMMENTlink written 4 weeks ago by James W. MacDonald46k

Thank you James! I have contacted NCBI support, and the solution turned out to be quite simple: besides QUERY, their API supports a field ENTREZ_QUERY. Unfortunately it is not included in annotate for now, but I simply added &ENTREZ_QUERY=human%5borgn%5d string to my QUERY, and this worked!

ADD REPLYlink modified 25 days ago • written 25 days ago by aush10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 196 users visited in the last hour