Hi,

I am testing how to use rsamtools to extract DNA sequences from a fasta file. The testing fasta (as test.fa) is very simple:

>scaffold_0
AAACGCGTTAGAGGCCTAACACGAGGCAGCTTCATGCTGCAGGTCACTCTAGAGGACCCAGCGATCTGCT

I used GRanges to create a GRanges object:

gr <- GRanges(seqnames = "scaffold_0", strand = c("+"), ranges = IRanges(start=4, end = 10))

and load/index the fasta and finally use getSeq to extract the sequence:

FA <- FaFile("~/Desktop/test_genome/test.fa")
indexFa(FA)
getSeq(FA,gr)

However, the getSeq function gives me an error: 

Error in value[[3L]](cond) :  record 1 (scaffold_0:4-10) failed
  file: /Users/myhome/Desktop/test_genome/test.fa

Any thoughts? Thanks!!!

> sessionInfo()

R version 3.4.3 (2017-11-30)

Platform: x86_64-apple-darwin15.6.0 (64-bit)
Running under: macOS High Sierra 10.13.4

Matrix products: default
BLAS: /System/Library/Frameworks/Accelerate.framework/Versions/A/Frameworks/vecLib.framework/Versions/A/libBLAS.dylib
LAPACK: /Library/Frameworks/R.framework/Versions/3.4/Resources/lib/libRlapack.dylib

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] parallel  stats4    stats     graphics  grDevices
[6] utils     datasets  methods   base     

other attached packages:
 [1] Rsamtools_1.30.0       Biostrings_2.46.0     
 [3] XVector_0.18.0         GenomicFeatures_1.30.3
 [5] AnnotationDbi_1.40.0   Biobase_2.38.0        
 [7] GenomicRanges_1.30.3   GenomeInfoDb_1.14.0   
 [9] IRanges_2.12.0         S4Vectors_0.16.0      
[11] BiocGenerics_0.24.0    biomaRt_2.34.2        

loaded via a namespace (and not attached):
 [1] httr_1.3.1                 RMySQL_0.10.14            
 [3] bit64_0.9-7                splines_3.4.3             
 [5] Formula_1.2-3              assertthat_0.2.0          
 [7] latticeExtra_0.6-28        blob_1.1.1                
 [9] GenomeInfoDbData_1.0.0     yaml_2.1.19               
[11] progress_1.1.2             pillar_1.2.2              
[13] RSQLite_2.1.1              backports_1.1.2           
[15] lattice_0.20-35            digest_0.6.15             
[17] RColorBrewer_1.1-2         checkmate_1.8.5           
[19] colorspace_1.3-2           htmltools_0.3.6           
[21] Matrix_1.2-14              plyr_1.8.4                
[23] DESeq2_1.18.1              XML_3.98-1.11             
[25] genefilter_1.60.0          zlibbioc_1.24.0           
[27] xtable_1.8-2               scales_0.5.0              
[29] BiocParallel_1.12.0        htmlTable_1.11.2          
[31] tibble_1.4.2               annotate_1.56.2           
[33] ggplot2_2.2.1              SummarizedExperiment_1.8.1
[35] nnet_7.3-12                lazyeval_0.2.1            
[37] survival_2.42-3            magrittr_1.5              
[39] memoise_1.1.0              foreign_0.8-70            
[41] tools_3.4.3                data.table_1.10.4-3       
[43] prettyunits_1.0.2          matrixStats_0.53.1        
[45] stringr_1.3.1              munsell_0.4.3             
[47] locfit_1.5-9.1             cluster_2.0.7-1           
[49] DelayedArray_0.4.1         compiler_3.4.3            
[51] rlang_0.2.0                grid_3.4.3                
[53] RCurl_1.95-4.10            rstudioapi_0.7            
[55] htmlwidgets_1.2            bitops_1.0-6              
[57] base64enc_0.1-3            gtable_0.2.0              
[59] DBI_1.0.0                  R6_2.2.2                  
[61] GenomicAlignments_1.14.2   gridExtra_2.3             
[63] rtracklayer_1.38.3         knitr_1.20                
[65] bit_1.1-13                 Hmisc_4.1-1               
[67] stringi_1.2.2              Rcpp_0.12.16              
[69] geneplotter_1.56.0         rpart_4.1-13              
[71] acepack_1.4.1   

Found the problem! The indexFA should take the file path (e.g. here as  indexFA("~/Desktop/test_genome/test.fa")).