Defining populations in a msaClustalOmega alignment
0
0
Entering edit mode
cav3gh • 0
@cav3gh-15680
Last seen 2.8 years ago

I ran the following code:

mySequences <- readAAStringSet("batch_1.fa")
myFirstAlignment <- msaClustalOmega(mySequences)
msaPrettyPrint(myFirstAlignment, output=c("pdf", "tex", "dvi", "asis"))
msaPrettyPrint(myFirstAlignment, output="asis", alFile = "/Users//Desktop/alignment.fasta")

batch_1.fasta file looks like this:

>CLocus_1_Sample_243_Locus_1_Allele_0 [BC-B39.all]
TGCAGGGTAGACTCATGGATGATAGGCATCTTCTATCCCATTTTTGTTTTTTTTAGGCATCATTTATCTCTAAGC

The output fasta file alignment.fasta look like this:

>CLocus_2130_Sample_581_Locus_940_Allele_0 [BC_30_2.all]
---------------------------AA-------------TTCAGGTA----AA--------------------TTTT
TTA-----------G-A---A-----------------------------------------------------------
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
-------------------G----TGGTC---CCA---------------------------------------------
------------------AT-TCGTT---------------T--------------------------------------
--------------------------------------C-----------------------------------------
----------------------------------------AC-------A-ACAG-------------------------
------------------------------------------------AAATTA-----------ATCAA-----CCA--
----A--ATA---------------------------------------------TT-----------------------
------TT-T---------

I got out the alignment file in a fasta to run in RAxML.  The problem is the populations do not appear to be defined in the alignment file so that when RAxML goes to make a tree it uses  populations instead of every locus.

 

msa • 425 views
ADD COMMENT
0
Entering edit mode

Sorry, but I don't get the question. I don't know RAxML, but it seems this is not an 'msa' issue, but a matter of how RAxML expects information about populations. Once you have found that out, you can simply change the sequence names in the FASTA file containing the alignment (if that is what RAxML expects).

ADD REPLY

Login before adding your answer.

Traffic: 336 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6