Question: Defining populations in a msaClustalOmega alignment
0
gravatar for cav3gh
18 months ago by
cav3gh0
cav3gh0 wrote:

I ran the following code:

mySequences <- readAAStringSet("batch_1.fa")
myFirstAlignment <- msaClustalOmega(mySequences)
msaPrettyPrint(myFirstAlignment, output=c("pdf", "tex", "dvi", "asis"))
msaPrettyPrint(myFirstAlignment, output="asis", alFile = "/Users//Desktop/alignment.fasta")

batch_1.fasta file looks like this:

>CLocus_1_Sample_243_Locus_1_Allele_0 [BC-B39.all]
TGCAGGGTAGACTCATGGATGATAGGCATCTTCTATCCCATTTTTGTTTTTTTTAGGCATCATTTATCTCTAAGC

The output fasta file alignment.fasta look like this:

>CLocus_2130_Sample_581_Locus_940_Allele_0 [BC_30_2.all]
---------------------------AA-------------TTCAGGTA----AA--------------------TTTT
TTA-----------G-A---A-----------------------------------------------------------
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
-------------------G----TGGTC---CCA---------------------------------------------
------------------AT-TCGTT---------------T--------------------------------------
--------------------------------------C-----------------------------------------
----------------------------------------AC-------A-ACAG-------------------------
------------------------------------------------AAATTA-----------ATCAA-----CCA--
----A--ATA---------------------------------------------TT-----------------------
------TT-T---------

I got out the alignment file in a fasta to run in RAxML.  The problem is the populations do not appear to be defined in the alignment file so that when RAxML goes to make a tree it uses  populations instead of every locus.

 

msa • 244 views
ADD COMMENTlink written 18 months ago by cav3gh0

Sorry, but I don't get the question. I don't know RAxML, but it seems this is not an 'msa' issue, but a matter of how RAxML expects information about populations. Once you have found that out, you can simply change the sequence names in the FASTA file containing the alignment (if that is what RAxML expects).

ADD REPLYlink written 18 months ago by UBodenhofer250
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 177 users visited in the last hour