Search
Question: A unexpected error occurred when using CRISPRseek package
0
gravatar for prokaryote23
5 months ago by
prokaryote230 wrote:

I have a question in regard to running the CRISPRseek offTargetAnalysis function, although I do encounter an error, the output files seem to contain correct/usable information.

The content in my input FASTA file is as following. The first sequence is the example in the user's guide, the 2nd sequence is a snp version of the first sequence (snp is at the 4th nucleotide). 

>Hsap_GATA1_ex2
ccagtttgtggatcctgctctggtgtcctccacaccagaatcaggg
>Hsap_GATA1_ex2_mutated
ccaatttgtggatcctgctctggtgtcctccacaccagaatcaggg

Here are my codes:

#---load libraries---#
library(CRISPRseek)
library(BSgenome.Hsapiens.UCSC.hg19)
library(TxDb.Hsapiens.UCSC.hg19.knownGene)
library(org.Hs.eg.db)
#---load input file---#
inputFilePath <- "D:/Dropbox (Personal)/guide RNA design/crisprseek/input_v1.fa" # you will need to modify this line
#---CRISPRseek running---#
results <- offTargetAnalysis(inputFilePath, findgRNAsWithREcutOnly = F,
                             REpatternFile = REpatternFile, findPairedgRNAOnly = F,
                             BSgenomeName = Hsapiens, chromToSearch ="chrX", 
                             min.gap = 0, max.gap = 20,
                             txdb = TxDb.Hsapiens.UCSC.hg19.knownGene, orgAnn = org.Hs.egSYMBOL,
                             max.mismatch = 2,overlap.gRNA.positions = c(17, 18),
                             outputDir = outputDir,overwrite = TRUE)
 

Here is the error message:

Error in .normargStrand(strand, max0123) : 
  strand values must be in '+' '-' '*'

One thing I noted is that the error seems to be caused by the snp sequence I created (when perform search on ChrX). But if I run the offTargetAnalysis to other chrmosomes than chrX, both sequence can pass and no error occurs.

Anybody have suggestions on how to overcome this issue? Thank you.

Best regards,

Ming-Ru

SessionInfo()

R version 3.5.0 (2018-04-23)
Platform: i386-w64-mingw32/i386 (32-bit)
Running under: Windows >= 8 x64 (build 9200)

Matrix products: default

locale:
[1] LC_COLLATE=English_United States.1252  LC_CTYPE=English_United States.1252   
[3] LC_MONETARY=English_United States.1252 LC_NUMERIC=C                          
[5] LC_TIME=English_United States.1252    

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] org.Hs.eg.db_3.6.0                      TxDb.Hsapiens.UCSC.hg19.knownGene_3.2.2
 [3] GenomicFeatures_1.32.0                  AnnotationDbi_1.42.1                   
 [5] Biobase_2.40.0                          BSgenome.Hsapiens.UCSC.hg19_1.4.0      
 [7] BSgenome_1.48.0                         rtracklayer_1.40.3                     
 [9] GenomicRanges_1.32.3                    GenomeInfoDb_1.16.0                    
[11] CRISPRseek_1.20.0                       Biostrings_2.48.0                      
[13] XVector_0.20.0                          IRanges_2.14.10                        
[15] S4Vectors_0.18.3                        BiocGenerics_0.26.0                    

loaded via a namespace (and not attached):
 [1] hash_2.2.6                  DBI_1.0.0                   Rsamtools_1.32.0            zlibbioc_1.26.0            
 [5] bitops_1.0-6                SummarizedExperiment_1.10.1 bit_1.1-14                  lattice_0.20-35            
 [9] RSQLite_2.1.1               pkgconfig_2.0.1             DelayedArray_0.6.1          stringr_1.3.1              
[13] seqinr_3.4-5                blob_1.1.1                  compiler_3.5.0              prettyunits_1.0.2          
[17] GenomicAlignments_1.16.0    biomaRt_2.36.1              Rcpp_0.12.17                GenomeInfoDbData_1.1.0     
[21] httr_1.3.1                  progress_1.2.0              tools_3.5.0                 MASS_7.3-50                
[25] RCurl_1.95-4.10             BiocParallel_1.14.1         memoise_1.1.0               R6_2.2.2                   
[29] assertthat_0.2.0            digest_0.6.15               Matrix_1.2-14               stringi_1.1.7              
[33] rstudioapi_0.7              hms_0.4.2                   bit64_0.9-7                 grid_3.5.0                 
[37] XML_3.98-1.11               data.table_1.11.4           rlang_0.2.1                 magrittr_1.5               
[41] ade4_1.7-11                 crayon_1.3.4                matrixStats_0.53.1  

 

ADD COMMENTlink modified 5 months ago by Julie Zhu3.9k • written 5 months ago by prokaryote230
1
gravatar for Julie Zhu
5 months ago by
Julie Zhu3.9k
United States
Julie Zhu3.9k wrote:
Ming-Ru, Thanks for the detailed description of the problem and the session information! What happened is that the mutated gRNA does not have a perfect matched target site on chromosome X. The error occurred because you were trying to search for RE sites on the flanking regions of a non-extent genomic location. I just added the exception handling to the devel version of CRISPRseek (1.21.1). If you prefer the released version over the devel version, you can set outputUniqueREs = FALSE to skip the RE site search in the flanking region of the target site. results <- offTargetAnalysis(inputFilePath, findgRNAsWithREcutOnly = FALSE, findPairedgRNAOnly = FALSE, BSgenomeName = Hsapiens, chromToSearch ="chrX", outputUniqueREs = FALSE, txdb = TxDb.Hsapiens.UCSC.hg19.knownGene, orgAnn = org.Hs.egSYMBOL, max.mismatch = 2, outputDir = outputDir, overwrite = TRUE) Best regards, Julie
ADD COMMENTlink modified 5 months ago • written 5 months ago by Julie Zhu3.9k

Hi Julie,

Thank you very much. It worked smoothly now.

Best regards,

Ming-Ru

 
ADD REPLYlink written 5 months ago by prokaryote230
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 262 users visited in the last hour