Multiple alignment solution for a character object of short fragments
0
0
Entering edit mode
r.tor • 0
@rtor-19887
Last seen 2.6 years ago

Hi there, thank you for taking the time to consider my threat. I have a character object consist of short reads of DNA sequences which looks like this:

> rnd1
  [1] "ATCCTTCTGCGGAACCAAATAT" "TTTGTTTGTTCACGATAACACC" "GACCGTTTACTAAGAATACTGG" "GCTCCTGATATCATATGGAACG" "CAGCAGTCTCAGAAGTATGCCA"
  [6] "GAGCGAATTCGGCGGTCGTTTA" "CCGCTCAGAAGCCCAACCGAGC" "TGACATCACACTGAGAACTACC" "AGAGACCCTCAAGGGTCCGCGG" "TGTTACACCATAATGAATTGAT"

I want to do a multiple alignment against human genome, BLASTn, through R packages. I need the result to contain some information about the number of matches. Any advice will be greatly appreciated.

r alignment • 268 views
ADD COMMENT

Login before adding your answer.

Traffic: 408 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6