Hi there, thank you for taking the time to consider my threat. I have a character object consist of short reads of DNA sequences which looks like this:

> rnd1
  [1] "ATCCTTCTGCGGAACCAAATAT" "TTTGTTTGTTCACGATAACACC" "GACCGTTTACTAAGAATACTGG" "GCTCCTGATATCATATGGAACG" "CAGCAGTCTCAGAAGTATGCCA"
  [6] "GAGCGAATTCGGCGGTCGTTTA" "CCGCTCAGAAGCCCAACCGAGC" "TGACATCACACTGAGAACTACC" "AGAGACCCTCAAGGGTCCGCGG" "TGTTACACCATAATGAATTGAT"

I want to do a multiple alignment against human genome, BLASTn, through R packages. I need the result to contain some information about the number of matches. Any advice will be greatly appreciated.