Question: crlmm package: issue with Infinium CytoSNP-850K v1.2 BeadChip platform
0
gravatar for edoardo.missiaglia
7 weeks ago by
edoardo.missiaglia0 wrote:

I am trying to use the crlmm package to import and analyze idat data from the Infinium CytoSNP-850K v1.2 BeadChip platform. Since there is no annotation package for it, I am using the option 'nopackage' and importing the annotation from an adapted manifest file. However, it seems I have an issue in the "gender" verification step (most probably with the YIndex), which blocks the import of the data. Here is the commands I am using:

library(crlmm)
library(ff)


samplesheet = read.csv("samplesTest.csv", header=TRUE, as.is=TRUE)

anno<-data.frame(read.csv("Manifest.850K.csv", header=TRUE, as.is=TRUE))

arrayNames <- file.path(datadir, unique(samplesheet[, "SentrixPosition"]))

arrayInfo <- list(barcode=NULL, position="SentrixPosition")

batch <- rep("1", nrow(samplesheet))

cnSet <- crlmmIllumina(sampleSheet=samplesheet, gender=samplesheet$gender, arrayNames=arrayNames, arrayInfoColNames=arrayInfo, highDensity=TRUE, call.method='krlmm', cdfName="nopackage", batch=batch, anno=anno, genome="hg19", copynumber=TRUE, nopackage.norm="loess", verbose=TRUE)

Here is the head of the annotation file:

chromosome  position    featureNames    isSnp   IlmnID  IlmnStrand  SNP     AddressA_ID     AlleleA_ProbeSeq    AddressB_ID     AlleleB_ProbeSeq    GenomeBuild     chr     MapInfo     Ploidy  Species     Source  SourceVersion   SourceStrand
1   157255396   rs1000073   TRUE    rs1000073-131_T_R_1893958059    TOP     [A/G]   95804186    ACCTAGCACTATTTTCTAGTGCTCCATCTCTTAGCAGGGACTCTGTTCAG  

    37  1   157255396   diploid     Homo sapiens    dbSNP   131     BOT
1   114471189   rs1000528   TRUE    rs1000528-138_B_R_2276261971    BOT     [T/C]   89693853    AAAGCCAAATGACTTCCCTTAAAAGGTACTTCAGCGCATTTTACACAAAT  

    37  1   114471189   diploid     Homo sapiens    dbSNP   138     TOP
4   190223523   rs10006955  TRUE    rs10006955-131_B_F_1893959315   BOT     [T/C]   5731264     CCTGCCCCCCTCCACCCCGATCTTGGTCTAGTTTTAGCCATATCACTTGT  

    37  4   190223523   diploid     Homo sapiens    dbSNP   131     BOT
4   153765098   rs10007643  TRUE    rs10007643-138_B_F_2276262148   BOT     [T/C]   98627830    ACACGGGATTTGTGCCCTCCCCTGACTTGTGGCCAGGAGGCTTCTACCAC  

    37  4   153765098   diploid     Homo sapiens    dbSNP   138     BOT
4   182218143   rs10018479  TRUE    rs10018479-138_T_R_2276262914   TOP     [A/C]   64751192    ACTTCAGGCCAAAAAAGCACAGAGATACAAAAGACATGACAATATCCCTG  

    37  4   182218143   diploid     Homo sapiens    dbSNP   138     BOT
4   25119575    rs10018563  TRUE    rs10018563-138_B_F_2276262922   BOT     [T/C]   20725290    GTGGTCATGGGCCAGCAGTGTGGGCACGCCCTAGGGATTTGCTAGAGATG  

    37  4   25119575    diploid     Homo sapiens    dbSNP   138     BOT
4   182048302   rs10020564  TRUE    rs10020564-138_B_F_2276263071   BOT     [T/C]   95780854    GAGAGAATGCACCACAAGAACAAGCAAATTGAATGTAGTGACAAACAGAG  

    37  4   182048302   diploid     Homo sapiens    dbSNP   138     BOT
4   123095703   rs10021037  TRUE    rs10021037-138_T_R_2276263103   TOP     [A/G]   81660971    GAAAGAACAGAGAAAGAGAAGGAACCTGTTATAGGAAGGAAAAAACAGCA  

    37  4   123095703   diploid     Homo sapiens    dbSNP   138     BOT
4   85281687    rs10021127  TRUE    rs10021127-138_T_R_2276263109   TOP     [A/C]   33720106    GTTGGATATCTACTATGTGATTAAAAAAAACGCATATATAACCACAGGCA  

    37  4   85281687    diploid     Homo sapiens    dbSNP   138     BOT


and this is the output of the analysis if I include the gender information:


Instantiate CNSet container.
path arg not set.  Assuming files are in local directory, or that complete path is provided
Initializing container for genotyping and copy number estimation
Processing sample stratum 1 of 1
'path' arg not set.  Assuming files are in local directory, or that complete path is provided in 'arrayNames'
Finished preprocessing.
Begin genotyping...
Start computing log-ratios
 -- Processing segment 1 out of 3
 -- Processing segment 2 out of 3
 -- Processing segment 3 out of 3
Leaving out non-variant SNPs
Start calculating 3-cluster parameters
Done calculating 3-cluster parameters
Start calculating 2-cluster parameters
Done calculating 2-cluster parameters
Start calculating 1-cluster parameters
Done calculating 1-cluster parameters
Done calculating platform-specific coefficients to predict number of clusters
Start predicting number of clusters
Done predicting number of clusters
Start assigning calls
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done assigning calls
Start computing confidence scores
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done computing confidence scores
Start imputing gender
Start computing average log-intensities
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done computing average log-intensities
Error in apply(Sy, 1, function(x) { : dim(X) must have a positive length

or if I don't include the gender information:


.............as above

Start computing confidence scores
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done computing confidence scores
Start verifying SNPs on Chromosome Y
Error in callsChrY[, male] : incorrect number of dimensions

An idea of what am I doing wrong?

Many thanks for your help,

crlmm • 41 views
ADD COMMENTlink written 7 weeks ago by edoardo.missiaglia0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 358 users visited in the last hour