Using the exclude argument seems to break BSgenome::vmatchPattern:

# vmatchPattern on full BSgenome works fine:

    pattern <- 'GTAACGGCAGACTTCTCCAC'
    bs <- BSgenome.Hsapiens.UCSC.hg38::BSgenome.Hsapiens.UCSC.hg38
    results <- BSgenome::vmatchPattern(
                   pattern, bs, min.mismatch=0, max.mismatch=3)
    results[GenomicRanges::seqnames(results)=='chr11']


    GRanges object with 8 ranges and 0 metadata columns:
      seqnames              ranges strand
         <Rle>           <IRanges>  <Rle>
      [1]    chr11     5226984-5227003      +
      [2]    chr11     5269853-5269872      +
      [3]    chr11   59369899-59369918      +
      [4]    chr11   72402607-72402626      +
      [5]    chr11   91170709-91170728      +
      [6]    chr11 108624292-108624311      +
      [7]    chr11 132892225-132892244      +
      [8]    chr11   87142523-87142542      -
      -------
      seqinfo: 455 sequences from an unspecified genome


# But using the `exlude` argument seems to break it:

    require(magrittr)
    excl <- sprintf('chr%s', c(as.character(1:22), 'X', 'Y', 'M')) %>% setdiff('chr11')
    results <- BSgenome::vmatchPattern(
                   pattern, bs, min.mismatch=0, max.mismatch=3, exclude=excl)


    GRanges object with 0 ranges and 0 metadata columns:
       seqnames    ranges strand
         <Rle> <IRanges>  <Rle>
       -------
       seqinfo: 455 sequences from an unspecified genome

Seems to want a regex rather than a match, so you need to be careful.

> exc <- paste0("^chr", c(1:10,12:22, "X","Y","M"), "$")
> exc
 [1] "^chr1$"  "^chr2$"  "^chr3$"  "^chr4$"  "^chr5$"  "^chr6$"  "^chr7$"
 [8] "^chr8$"  "^chr9$"  "^chr10$" "^chr12$" "^chr13$" "^chr14$" "^chr15$"
[15] "^chr16$" "^chr17$" "^chr18$" "^chr19$" "^chr20$" "^chr21$" "^chr22$"
[22] "^chrX$"  "^chrY$"  "^chrM$"
> results2 <- vmatchPattern(pattern, Hsapiens, min.mismatch = 0, max.mismatch = 3, exclude = exc)
> results2[seqnames(results2) == "chr11"]
GRanges object with 8 ranges and 0 metadata columns:
      seqnames              ranges strand
         <Rle>           <IRanges>  <Rle>
  [1]    chr11     5226984-5227003      +
  [2]    chr11     5269853-5269872      +
  [3]    chr11   59369899-59369918      +
  [4]    chr11   72402607-72402626      +
  [5]    chr11   91170709-91170728      +
  [6]    chr11 108624292-108624311      +
  [7]    chr11 132892225-132892244      +
  [8]    chr11   87142523-87142542      -
  -------
  seqinfo: 455 sequences from an unspecified genome