Cannot return precursor info in package miRBaseConverter
0
0
Entering edit mode
@gzbyzyx2011-23847
Last seen 9 months ago
United States

Hi,

I am trying to use package miRBaseConverter to do some analysis for my project. When I input my code as followed

library(miRBaseConverter)
hsa_precursor <- getAllMiRNAs(version="v22", type="precursor", species="hsa")

I get no results back.

hsa_precursor [1] Accession Name Sequence <0 rows> (or 0-length row.names)

But if I use replace "precursor" with "mature", I got the info back successfully.

head(getAllMiRNAs(version="v22", type="mature", species="hsa"))
Accession            Name               Sequence
  

1 MIMAT0010195 hsa-let-7a-2-3p CUGUACAGCCUCCUAGCUUUCC 2 MIMAT0004481 hsa-let-7a-3p CUAUACAAUCUACUGUCUUUC 3 MIMAT0000062 hsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU 4 MIMAT0004482 hsa-let-7b-3p CUAUACAACCUACUGCCUUCCC 5 MIMAT0000063 hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU 6 MIMAT0026472 hsa-let-7c-3p CUGUACAACCUUCUAGCUUUCC

Any ideas or suggestions?

Thanks, Yixin

miRBaseConverter precursor getAllMiRNAs • 205 views
ADD COMMENT
0
Entering edit mode

There's a bug in getAllMiRNAs

debug: ind <- which(apply(MiRNAs, 1, function(x) allis.na(x))))
Browse[2]> MiRNAs[1:3,]
   Accession  Name Sequence
58        60 43728     1153
59        61 43729     1154
60        62 43732     1155
Browse[2]> 
debug: MiRNAs = MiRNAs[-ind, ]
Browse[2]> length(ind)
[1] 0
Browse[2]> 
debug: MiRNAs = unique(MiRNAs)
Browse[2]> dim(MiRNAs)
[1] 0 3

Please notify the author. If you use 'all' and 'mature' and take the difference you may get what you want

> dim(hsa_mat)
[1] 2656    3
> dim(hsa_all)
[1] 4573    3
> 4573-2656
[1] 1917
ADD REPLY

Login before adding your answer.

Traffic: 133 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6