Hi, that's exactly what I was looking for. Thanks. Gunther -----Urspr?ngliche Nachricht----- Von: Wolfgang Huber [mailto:huber at ebi.ac.uk] Gesendet: Donnerstag, 7. September 2006 07:50 An: Gunther H?ning Cc: bioconductor at stat.math.ethz.ch Betreff: Re: [BioC] Question on AffyBatch Gunther H?ning wrote: > Dear list, > > I'm trying to find out the following in an AffyBatch. > > To get the indices from a loction on a chip I use the function xy2i() > for the hgu133plus2 by Affymetrix. > But now I want to know the name of the probe located at this spot. How > can this be done? > And what about the locations used as QC? > > Gunther Hi Gunther, maybe this is what you want, it finds you the annotation of the probe at x-position 'mx' and y-position 'my', and its intensity data in the AffyBatch 'a': library("hgu133plus2probe") library("hgu133plus2cdf") mx = 600 my = 713 exprs(a)[xy2i(mx, my), ] r = with(hgu133plus2probe, x==mx & y==my) print.data.frame( hgu133plus2probe[r,] ) sequence x y Probe.Set.Name 249549 GTAGACTACAAGTGGTTGTTACCCA 600 713 213376_at Probe.Interrogation.Position Target.Strandedness 249549 870 Antisense The explicit call to 'print.data.frame' is necessary because the print method for 'probetable' objects is a bit dumb. Best wishes Wolfgang > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor