> Thanks a lot! > > Maybe you can remind users that the matching is case-sensitive. For DNA sequences, people might tend to treat the lowercase and the uppercase the same. > I was looking at the library "altcdfenvs" to create an alternative CDF environment. I do not see a straightforward connection between > "altcdfenvs" and "Biostrings". Any suggestions? You raise a good point here. I would have liked to use something generic for DNA/RNA sequence but "Biostrings" was in its infancy when "altcdfenvs" was written... and now because of my current occupation further work on the package is unlikely to happen soon.. Low-energy approaches would be to either write a function that transforms a a list of 'BStringViews' to a list such as the one returned by 'matchprobes' and feed it to 'buildCdfEnv.matchprobes' (as the vignette and documentation for 'buildCdfEnv.matchprobes' indicate), or to modify 'buildCdfEnv.matchprobes' to accept a list of 'BStringViews' as input (and in that last case you will mostly only have to work on the following code: xy <- getxy.probeseq(probeseq=probe.tab, i.row=matches$match[[i]], x.colname = x.colname, y.colname = y.colname) ) Hoping this helps, Laurent > BTW, my previous reply was held because this email address was not subscribed to this list. Now it should work. > > Best, > Xinxia > > -----Original Message----- > From: Wolfgang Huber [mailto:huber at ebi.ac.uk] > Sent: Thursday, September 14, 2006 2:31 AM > To: Robert Gentleman > Cc: Xinxia Peng; Bioconductor > Subject: Re: [BioC] [biocpkgs] suggestions on package matchprobes > > Hi Xinxia, > > thanks! > 1. The problem with the cases was simple: the function 'matchprobes' calls C code to do the actual work, and it was: > > matchprobes <- function(query, records, probepos=FALSE) > .Call("MP_matchprobes", toupper(query), records, probepos, > PACKAGE="matchprobes") > > I removed the "toupper" in matchprobes_1.5.1, this should make you happier. There is no good reason why it should have been there, and that it was not documented was a bug. So now it is gone. > > 2. As Robert said, for generic sequence matching please use > "Biostrings", that is much better. "matchprobes" only still exists for backward compatibility. > > Best wishes > Wolfgang > > > Robert Gentleman wrote: >> Please ask these sorts of questions on the Bioconductor mailing list - > >> redirected there >> and for generic sequence matching Biostrings is a better tool - we will look into this, thanks Robert >> Xinxia Peng wrote: >>> =+=+=+=+=+=+=+=+=+ biocpkgs mailing list +=+=+=+=+=+=+=+=+= Dear Bioc > >>> Team, >>> It appears that the function 'matchprobes' will not work with > sequences in lower case. Also it might be nice not to match empty string. See the following example: >>>> test.seq >>> [1] > "atggcggcgcaaagtagtggtgggggtggaggttgtggtgaggaagataaagatgccaaatatatgt ttga taggatagggaaagaagtgcacgacgaag" >>> [2] > "atgaaaagggtaatgcaacaatttgtggatcgtacaacacaacgatttcacgaatatgatgaaagga tgaa aactacacgccaaaaatgtaaagaacgat" >>> [3] > "atgaaacttcactgctctaaaatattattatttttacttccattaaatatattagtaacatcattat caaa tgtgcataataataataaactatacaaca" >>> [4] > "atgaaagtccattatattaatatattattgtttgctcttccattaaatatattggaacataataaaa atga accacacaccacaccaaatcatacacaaa" >>> [5] > "atgtttacaacaaaaaaaaaaattaaatatattataattatatgtggcatctttcgaaaatatttca aatt cggaagaattattgaggttccaatgatgc" >>> [6] > "atgaaactgcactactctaatatattattatttttctttccattaaatatattagtaacatcatatc atgt atataataaaaataaaatatacatcacac" >>> [7] > "atgtgtgctattggagaattactatcatctacagataaggaatatactcttaatttctttggtttag ttaa agatggagcatcgattgatgaaatgaaag" >>> [8] > "atgattaagatgaaattccattatgtaggatattattctgaagaagaaaatatgaaaaatacactga aaat ttgttccgttagacaaatatttttaaatt" >>> [9] > "atgttattatttgctttattatttaatgcacttttattatcacaaaatgtaaattgccgaaacaaca atta taatataagattcactcaaacgataacac" >>> [10] > "atgatataccacagaaggattatagcttatctcataaatcatctaccattaggtatatcccttacag aagt ggtcgatataaatgaagaacatatattta" >>>> test.p >>> [1] "atggcggcgcaaagtagtggtgggg" >>>> matchprobes(test.seq, test.p) >>> $match >>> $match[[1]] >>> numeric(0) >>> $match[[2]] >>> numeric(0) >>> $match[[3]] >>> numeric(0) >>> $match[[4]] >>> numeric(0) >>> $match[[5]] >>> numeric(0) >>> $match[[6]] >>> numeric(0) >>> $match[[7]] >>> numeric(0) >>> $match[[8]] >>> numeric(0) >>> $match[[9]] >>> numeric(0) >>> $match[[10]] >>> numeric(0) >>>> matchprobes(toupper(test.seq), toupper(c(test.p, ""))) >>> $match >>> $match[[1]] >>> [1] 1 2 >>> $match[[2]] >>> [1] 2 >>> $match[[3]] >>> [1] 2 >>> $match[[4]] >>> [1] 2 >>> $match[[5]] >>> [1] 2 >>> $match[[6]] >>> [1] 2 >>> $match[[7]] >>> [1] 2 >>> $match[[8]] >>> [1] 2 >>> $match[[9]] >>> [1] 2 >>> $match[[10]] >>> [1] 2 >>> Thanks, >>> Xinxia Peng >>> Seattle Biomedical Research Institute >>> __________________________________________________________________ biocpkgs mailing list >>> To unsubscribe from this mailing list send a blank email to >>> biocpkgs-leave at lists.fhcrc.org You can also unsubscribe or change your personal options at >>> http://lists.fhcrc.org/mailman/listinfo/biocpkgs > > > -- > ------------------------------------------------------------------ Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor >