I am using the following code to retrieve the exon sequences of gene Tcfap2b with GeneID:21419. There are 8 exons for this gene. for (i in sequence(50)) { + x <- getSequence(id=21419,type="entrezgene",seqType="gene_exon",mart =ensembl) + if (is.null(x)) print('NULL result') + if (!is.null(x)) print("Correct result") + } This gives 44 NULL results and 6 correct results. 'correct' means getSequence() outputs the sequences of the exons. > sessionInfo() R version 2.8.1 (2008-12-22) x86_64-pc-linux-gnu locale: C attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] biomaRt_1.16.0 loaded via a namespace (and not attached): [1] RCurl_0.94-0 XML_1.99-0 tools_2.8.1 Thank you, Juerg Straubhaar, Umass Med School [[alternative HTML version deleted]]

Dear J?rg thank you for the feedback! Can you send us a reproducible example - this may better help us figuring what is going on. In the example you posted, what is the object "ensembl" and how did you generate it? I tried the following example, which is as similar to yours as I could think of. I could not reproduce your problem, i.e. I got consistent (i.e. non-random) results, as shown below: library("biomaRt") ensembl = useMart("ensembl",dataset="hsapiens_gene_ensembl") res = lapply(sequence(50), function(i) getSequence(id=21419,type="entrezgene", seqType="gene_exon",mart=ensembl)) R 2.8.1 ========== > res [[1]] NULL [[2]] NULL [[3]] NULL .... (46 more times NULL) [[50]] NULL > sessionInfo() R version 2.8.1 (2008-12-22) i386-pc-mingw32 locale: LC_COLLATE=English_United Kingdom.1252;LC_CTYPE=English_United Kingdom.1252;LC_MONETARY=English_United Kingdom.1252;LC_NUMERIC=C;LC_TIME=English_United Kingdom.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] biomaRt_1.16.0 loaded via a namespace (and not attached): [1] RCurl_0.92-0 XML_1.99-0 Today's R + bioC devel ====================== > res [[1]] [1] gene_exon entrezgene <0 rows> (or 0-length row.names) [[2]] [1] gene_exon entrezgene <0 rows> (or 0-length row.names) [[3]] [1] gene_exon entrezgene <0 rows> (or 0-length row.names) .... (46 times the same) [[50]] [1] gene_exon entrezgene <0 rows> (or 0-length row.names) Also, when using a different Entrez Gene ID, I get a non-trivial result, e.g. with > g= getSequence(id=1499,type="entrezgene",seqType="gene_exon",mart=ensembl ) > str(g) 'data.frame': 23 obs. of 2 variables: $ gene_exon : chr "GTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAAAAGGAAGCTTCCAGACACGCTATC ATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGTACCATGCAGAATACAAATGATG"| __truncated__ "GCCGGTGGCGGCAGGATACAGCGGCTTCTGCGCGACTTATAAGAGCTCCTTGTGCGGCGCCATTTTAAG CCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGGCCCCGGGAGCGGAGAGCGAGGGGAGG"| __truncated__ "GGTATTTGAAGTATACCATACAACTGTTTTGAAAATCCAGCGTGGACAATGGCTACTCAAG" "CTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAACTTGCTCAGGAC AAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTGACAGAGTTAC"| __truncated__ ... $ entrezgene: int 1499 1499 1499 1499 1499 1499 1499 1499 1499 1499 ... > sessionInfo() R version 2.10.0 Under development (unstable) (2009-04-12 r48319) x86_64-unknown-linux-gnu locale: LC_CTYPE=C;LC_NUMERIC=C;LC_TIME=C;LC_COLLATE=C;LC_MONETARY=C;LC_MESSAG ES=it_IT;LC_PAPER=C;LC_NAME=C;LC_ADDRESS=C;LC_TELEPHONE=C;LC_MEASUREME NT=C;LC_IDENTIFICATION=C attached base packages: [1] stats graphics grDevices datasets utils methods base other attached packages: [1] biomaRt_1.99.9 loaded via a namespace (and not attached): [1] RCurl_0.94-1 XML_2.3-0 tools_2.10.0 Straubhaar, Juerg wrote: > I am using the following code to retrieve the exon sequences of gene Tcfap2b with GeneID:21419. There are 8 exons for this gene. > > > for (i in sequence(50)) { > + x <- getSequence(id=21419,type="entrezgene",seqType="gene_exon",ma rt=ensembl) > + if (is.null(x)) print('NULL result') > + if (!is.null(x)) print("Correct result") > + } > > This gives 44 NULL results and 6 correct results. 'correct' means getSequence() outputs the sequences of the exons. > >> sessionInfo() > R version 2.8.1 (2008-12-22) > x86_64-pc-linux-gnu > > locale: > C > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] biomaRt_1.16.0 > > loaded via a namespace (and not attached): > [1] RCurl_0.94-0 XML_1.99-0 tools_2.8.1 > > Thank you, > > Juerg Straubhaar, Umass Med School > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- ---------------------------------------------------- Wolfgang Huber EMBL-EBI http://www.ebi.ac.uk/huber -------------- next part -------------- An embedded and charset-unspecified text was scrubbed... Name: biomaRt-Straubhaar.txt URL: <https: stat.ethz.ch="" pipermail="" bioconductor="" attachments="" 20090413="" 8db958c1="" attachment.txt="">