For those using RCurl on Windows and Mac OS X, I just updated RCurl in the BioC 2.4 and 2.5 extra repositories. You can now download RCurl 0.97-3 in source, Windows, and Mac OS X 10.5 (Leopard) forms via biocLite. If you are on a Mac OS X 10.4 (Tiger) machine, I had trouble building the latest RCurl and so the BioC extra repos is at older version RCurl 0.95-1. If there is community demand for sorting out the Mac OS X 10.4 (Tiger) issue, I'll look into finding out what the issue is on that platform. Patrick Florian Hahne wrote: > Hi Paul, > the issue is fixed in the latest RCurl which you can install by > source("http://www.bioconductor.org/biocLite.R") > biocLite("RCurl") > > For some reason this didn't pick up the dependency on bitops on my my > machine, so to be safe you might want to do > biocLite(c("bitops", "RCurl")) > > Please check if the fixes the problem on your end, if not we need the > reproducible example Tony was suggesting before. > > Florian > > > On 28.05.2009, at 21:56, Paul Leo wrote: > >> I (and I assume most) have no problem with the "standard" config below. >> Worth depreciating ? >> >>> sessionInfo() >> R version 2.9.0 (2009-04-17) >> x86_64-pc-linux-gnu >> >> locale: >> LC_CTYPE=en_AU.UTF-8;LC_NUMERIC=C;LC_TIME=en_AU.UTF-8;LC_COLLATE=en _AU.UTF-8;LC_MONETARY=C;LC_MESSAGES=en_AU.UTF-8;LC_PAPER=en_AU.UTF-8;L C_NAME=C;LC_ADDRESS=C;LC_TELEPHONE=C;LC_MEASUREMENT=en_AU.UTF-8;LC_IDE NTIFICATION=C >> >> >> attached base packages: >> [1] stats graphics grDevices utils datasets methods base >> >> other attached packages: >> [1] biomaRt_2.0.0 >> >> loaded via a namespace (and not attached): >> [1] RCurl_0.94-1 XML_1.95-3 >>> >> >> >> -----Original Message----- >> From: James Bullard <bullard at="" berkeley.edu=""> >> To: whuber at embl.de >> Cc: Bioconductor <bioconductor at="" stat.math.ethz.ch=""> >> Subject: Re: [BioC] biomaRt - current devel version of biomaRt+RCurl >> don't work >> Date: Thu, 28 May 2009 14:00:04 -0700 >> >> Hi, I am having problems with biomaRt and based on Wolfgang's post it >> looks like I shouldn't be (or am I being completely naive?): >> >> Thanks, jim >> >>> library("biomaRt") >>> mart = useMart("ensembl") >>> ensembl = useDataset("hsapiens_gene_ensembl", >> + mart=mart) >> Checking attributes ... ok >> Checking filters ... ok >>> EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102") >>> utr = getSequence(id=EGsub, seqType="3utr", >> + mart=ensembl, type="entrezgene") >> CA ..... I cut out a lot of the sequence ... >> GTGCCCTGCCTTGCACCTCCGCCTTATTTTCTGC 87 >> V1 >> 1 HTTP/1.1 200 OK >> 2 Date: Thu, 28 May 2009 20:56:08 GMT >> 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0 >> 4 Connection: close >> 5 Transfer-Encoding: chunked >> 6 Content-Type: text/plain >> Error in getBM(c(seqType, type), filters = type, values = id, mart = >> mart, : >> The query to the BioMart webservice returned an invalid result: the >> number of columns in the result table does not equal the number of >> attributes in the query. Please report this to the mailing list. >>> sessionInfo() >> R version 2.9.0 Patched (2009-05-28 r48678) >> x86_64-unknown-linux-gnu >> >> locale: >> LC_CTYPE >> = >> en_US >> .UTF >> -8 >> ;LC_NUMERIC >> = >> C >> ;LC_TIME >> = >> en_US >> .UTF >> -8 >> ;LC_COLLATE >> = >> en_US >> .UTF >> -8 >> ;LC_MONETARY >> = >> C >> ;LC_MESSAGES >> = >> en_US >> .UTF >> -8 >> ;LC_PAPER >> = >> en_US >> .UTF >> -8 >> ;LC_NAME >> = >> C >> ;LC_ADDRESS >> =C;LC_TELEPHONE=C;LC_MEASUREMENT=en_US.UTF-8;LC_IDENTIFICATION=C >> >> attached base packages: >> [1] stats graphics grDevices utils datasets methods base >> >> other attached packages: >> [1] biomaRt_2.0.0 >> >> loaded via a namespace (and not attached): >> [1] RCurl_0.95-1 tools_2.9.0 XML_2.3-0 >> >> >> On May 28, 2009, at 5:01 AM, Wolfgang Huber wrote: >> >>> Hi >>> >>> just to warn all users of the development version of biomaRt, please >>> wait a few days before updating your RCurl, the current devel >>> versions of these two packages do not work together. We are sorting >>> it out. >>> >>> An example for the error that is produced, with RCurl_0.97-2 and >>> biomaRt_2.1.0, is shown below. With a previous version of RCurl, the >>> problem should not arise. >>> >>> >>> library("biomaRt") >>> mart = useMart("ensembl") >>> ensembl = useDataset("hsapiens_gene_ensembl", >>> mart=mart) >>> EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102") >>> utr = getSequence(id=EGsub, seqType="3utr", >>> mart=ensembl, type="entrezgene") >>> >>> CAGCAGTCAGGGGTCAGGTGTCAGGCCCGTCGGAGCT... 25 >>> CTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAA... 102 >>> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG... 87 >>> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG... 87 >>> V1 >>> 1 HTTP/1.1 200 OK >>> 2 Date: Thu, 28 May 2009 11:57:58 GMT >>> 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0 >>> 4 Connection: close >>> 5 Transfer-Encoding: chunked >>> 6 Content-Type: text/plain >>> >>> Errore in getBM(c(seqType, type), filters = type, values = id, mart >>> = mart, : >>> The query to the BioMart webservice returned an invalid result: the >>> number of columns in the result table does not equal the number of >>> attributes in the query. Please report this to the mailing list. >>> >>> >>>> sessionInfo() >>> R version 2.10.0 Under development (unstable) (2009-05-28 r48665) >>> x86_64-unknown-linux-gnu >>> >>> locale: >>> [1] LC_CTYPE=C LC_NUMERIC=C LC_TIME=C >>> [4] LC_COLLATE=C LC_MONETARY=C LC_MESSAGES=it_IT.UTF-8 >>> [7] LC_PAPER=C LC_NAME=C LC_ADDRESS=C >>> [10] LC_TELEPHONE=C LC_MEASUREMENT=C >>> LC_IDENTIFICATION=C >>> >>> attached base packages: >>> [1] stats graphics grDevices datasets utils methods base >>> >>> other attached packages: >>> [1] biomaRt_2.1.0 fortunes_1.3-6 >>> >>> loaded via a namespace (and not attached): >>> [1] RCurl_0.97-2 XML_2.3-0 >>>> >>> >>> >>> -- >>> >>> Best wishes >>> Wolfgang >>> >>> ------------------------------------------------ >>> Wolfgang Huber, EMBL, http://www.ebi.ac.uk/huber >>> >>> _______________________________________________ >>> Bioconductor mailing list >>> Bioconductor at stat.math.ethz.ch >>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>> Search the archives: >>> http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor