Question: avereps function
0
gravatar for Erika Melissari
10.4 years ago by
Erika Melissari240 wrote:
Dear list, I used averep function after normalization and before lmFit to average spot copies on microarrays. I noted that since a lot of spots have been averaged (the total number of spots have been reduced to 41000 from 43000), other spots do not have. See this example: Block Column Row ID Name Sequence ProbeUID GeneName logFC adj.P.Val B 1 85 183 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.266302 0.048228 0.181434 1 20 393 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB -0.20687 0.068295 -0.6233 1 56 294 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.110065 0.382405 -4.54642 1 22 299 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.085017 0.405978 -4.66767 1 53 457 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.080708 0.483304 -5.0517 1 17 39 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.063279 0.710629 -5.73913 1 45 199 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.051584 0.778778 -5.87993 1 64 279 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB -0.04158 0.800246 -5.91735 1 16 358 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.024847 0.880504 -6.03386 1 21 435 A_23_P135769 NM_001101 TTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTT 2871 ACTB 0.000153 0.999438 -6.11393 1 4 111 A_23_P31323 NM_001101 ACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAA 8562 ACTB 0.283846 0.043577 0.472915 1 17 275 A_24_P226554 NM_001101 GCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGG 21338 ACTB 0.030637 0.848504 -5.9958 1 74 251 A_32_P137939 NM_001101 AGGCAGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCGCACCTT 19564 ACTB -0.20387 0.177982 -2.87144 Why the group of first 10 probes was not averaged by avereps? Any suggestion will be appreciated. Thank you so much Erika [[alternative HTML version deleted]]
normalization • 463 views
ADD COMMENTlink written 10.4 years ago by Erika Melissari240
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 224 users visited in the last hour