The funcion getOrfs, doesn`t works, package: GeneR
0
0
Entering edit mode
@coghlan-avril-3810
Last seen 6.9 years ago
Dear all, I am wondering does anybody know has there been any progress in fixing the problem with the getOrfs() function in the GeneR library, using R on a Windows computer? I have just tried this function on my Windows PC, and get the error described below. I would like to use this function to teach gene-finding for a bioinformatics practical class, so would be grateful if anybody could tell me if this problem with the function on Windows is likely to be fixed soon? Kind Regards, Avril Avril Coghlan University College Cork, Ireland I can confirm that on a mingw build for windows, these computations do not succeed as intended. This is a situation where the testing and error reporting of the software are not sufficient to allow our use of R CMD check to identify nonportable code. Somewhere in the package man pages or obligatory test code the result of a computation should be checked against its known value and an error thrown if a discrepancy occurs. Some of the computations in the examples seem solvable using Biostrings. Solution for you at this moment is to use another platform. I have shown that it works on MacOSX, and just tested a linux machine, and the intended results seem to come back. But it is important for all contributors to recognize that our multiplatform build/check system cannot identify nonportability if erroneous calculations do not raise error conditions in examples or tests. On Fri, Oct 9, 2009 at 4:46 AM, avargas <avargas at="" lcg.unam.mx="" <https:="" stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> > wrote: > I apreciate the quick response, here is my code: > >> library("GeneR") >> s<-"gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa" >> placeString(s) > [1] 0 >> >> getOrfs(phase = NULL,seqno=0) > NULL >> maxOrf() > [1] -1 >> >> #Problem with exact word > >> placeString("TTTTTTTTTTTT") > [1] 0 >> exactWord("TTT") > [[1]] > [1] -1 > >> sessionInfo() > R version 2.10.0 Under development (unstable) (2009-08-15 r49252) > i386-pc-mingw32 > > locale: > [1] LC_COLLATE=Spanish_Mexico.1252 LC_CTYPE=Spanish_Mexico.1252 > [3] LC_MONETARY=Spanish_Mexico.1252 LC_NUMERIC=C > [5] LC_TIME=Spanish_Mexico.1252 > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] GeneR_2.15.0 > > On Fri, 9 Oct 2009 04:21:58 -0400, Vincent Carey > <stvjc at="" channing.harvard.edu="" <https:="" stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> > wrote: >> Please give sessionInfo() result. Here are my results, installing >> GeneR from source a moment ago >> >>> s<-"gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa" >>> placeString(s) >> [1] 0 >>> s >> [1] "gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa" >>> ?placeString >>> getSeq(seqno=0) >> [1] "GTCATGCATGCTAGGTGACAGTTAAAATGCGTCTAGGTGACAGTCTAACAA" >>> getOrfs(phase = NULL,seqno=0) >> start stop >> [1,] 4 18 >> [2,] 8 25 >>> maxOrf() >> [1] 18 >>> ?maxOrf >>> ?getOrfs >>> getOrfs(phase = NULL,seqno=0) >> start stop >> [1,] 4 18 >> [2,] 8 25 >>> placeString("TTTTTTTTTTTT") >> [1] 0 >>> exactWord("TTT") >> [[1]] >> [1] 1 2 3 4 5 6 7 8 9 10 >> >>> sessionInfo() >> R version 2.10.0 Under development (unstable) (2009-09-09 r49642) >> i386-apple-darwin9.8.0 >> >> locale: >> [1] C >> >> attached base packages: >> [1] stats graphics grDevices datasets tools utils methods >> [8] base >> >> other attached packages: >> [1] GeneR_2.15.0 weaver_1.11.1 codetools_0.2-2 digest_0.3.1 >> >> >> >> On Fri, Oct 9, 2009 at 1:04 AM, avargas <avargas at="" lcg.unam.mx="" <https:="" stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> > wrote: >>> Dear list, i have some troubles with the GeneR package, it seems that >>> getOrfs is not working. I already try to use it with the example info of >>> the help: >>> >>> library("GeneR") >>> s<-"gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa" >>> placeString(s) >>> >>> getOrfs(phase = NULL,seqno=0) >>> maxOrf() >>> >>> But returns: >>>> getOrfs(phase = NULL,seqno=0) >>> NULL >>>> maxOrf() >>> [1] -1 >>> I have the version 2.10 of R and the Package GeneR version 2.15.0 >>> I mean, the examples of >>> http://rss.acs.unt.edu/Rdoc/library/GeneR/doc/GeneR.pdf at page 5 are >> not >>> reproducible, so, which is the problem? >>> In advance, thanks. >>> >>> Amhed Missael Vargas Velàzquez >>> avargas at lcg.unam.mx <https: stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> >>> LCG,UNAM >>> >>> Pd: I think that the problem is with another function named, exact word, >>> that does not work too. >>> i.e. >>> library("GeneR") >>> placeString("TTTTTTTTTTTT") >>> exactWord("TTT") >>> >>> _______________________________________________ >>> Bioconductor mailing list >>> Bioconductor at stat.math.ethz.ch <https: stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> >>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor > > [[alternative HTML version deleted]]
GeneR GeneR • 392 views
ADD COMMENT

Login before adding your answer.

Traffic: 795 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6