Question: Illumina chip probe sequences
0
gravatar for Peter Bazeley
8.7 years ago by
Peter Bazeley50 wrote:
Dear List, Is there a package that stores the probe sequences for Illumina's chips, sort of like the hgu133aprobe package? Thank you for any input, Pete [[alternative HTML version deleted]]
probe • 718 views
ADD COMMENTlink modified 8.7 years ago by Sean Davis21k • written 8.7 years ago by Peter Bazeley50
Answer: Illumina chip probe sequences
0
gravatar for Sean Davis
8.7 years ago by
Sean Davis21k
United States
Sean Davis21k wrote:
The annotation packages for Illumina data that contain nuIDs implicitly contain the probe sequences since the nuID is a lossless encoding of the sequence. See the lumi package for more details. Sean On Jul 27, 2010 11:55 PM, "Peter Bazeley" <peter.bazeley@gmail.com> wrote: Dear List, Is there a package that stores the probe sequences for Illumina's chips, sort of like the hgu133aprobe package? Thank you for any input, Pete [[alternative HTML version deleted]] _______________________________________________ Bioconductor mailing list Bioconductor@stat.math.ethz.ch https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor [[alternative HTML version deleted]]
ADD COMMENTlink written 8.7 years ago by Sean Davis21k
Answer: Illumina chip probe sequences
0
gravatar for Mike Smith
8.7 years ago by
Mike Smith40
Mike Smith40 wrote:
Hi Pete, I'm not sure if there are any packages which provide the probe sequences, but the annotation files provided by Mark Dunning are based on the files found here : http://www.compbio.group.cam.ac.uk/Resources/Annotation/index.html The files have rather a lot of information in them, but you can dig out the probe sequences for most of the human and mouse expression arrays. I hope that's some help, Mike Smith Peter Bazeley wrote: > Dear List, > > Is there a package that stores the probe sequences for Illumina's chips, > sort of like the hgu133aprobe package? > > > Thank you for any input, > Pete > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >
ADD COMMENTlink written 8.7 years ago by Mike Smith40
Hello all, No, probe libraries for Illumina are not available. They should not be because you can export the probe sequences in beadstudio. Exporting those is really helpful in properly analysing illumina arrays in the lumi package! Probe sequences can be found on the Illumina annotation files on their website: http://www.illumina.com/support/annotation_files.ilmn Note that the lumi function "addNuID2lumi" contains the option "annotationFile=" that should point to the proper annotation file as listed above. This way, it is possible to obtain NuIDs because the probe sequences are available. I hope that this information helps a bit. Regards, Dr. Philip de Groot Ph.D. Bioinformatics Researcher Wageningen University / TIFN Nutrigenomics Consortium Nutrition, Metabolism & Genomics Group Division of Human Nutrition PO Box 8129, 6700 EV Wageningen Visiting Address: Erfelijkheidsleer: De Valk, Building 304 Dreijenweg 2, 6703 HA Wageningen Room: 0052a T: +31-317-485786 F: +31-317-483342 E-mail: Philip.deGroot at wur.nl Internet: http://www.nutrigenomicsconsortium.nl http://humannutrition.wur.nl/ https://madmax.bioinformatics.nl/ ________________________________________ From: Mike Smith [grimbough@googlemail.com] Sent: 28 July 2010 11:24 To: Peter Bazeley Cc: bioconductor at stat.math.ethz.ch Subject: Re: [BioC] Illumina chip probe sequences Hi Pete, I'm not sure if there are any packages which provide the probe sequences, but the annotation files provided by Mark Dunning are based on the files found here : http://www.compbio.group.cam.ac.uk/Resources/Annotation/index.html The files have rather a lot of information in them, but you can dig out the probe sequences for most of the human and mouse expression arrays. I hope that's some help, Mike Smith Peter Bazeley wrote: > Dear List, > > Is there a package that stores the probe sequences for Illumina's chips, > sort of like the hgu133aprobe package? > > > Thank you for any input, > Pete > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >
ADD REPLYlink written 8.7 years ago by Groot, Philip de630
What about lumiHumanIDMapping? In conjunction with lumi, you can get probe sequences corresponding to any identifier for any of the listed human chip versions: > con = lumiHumanIDMapping_dbconn() > dbListTables(con) [1] "HumanHT12_V3_0_R1_11283641_A" "HumanHT12_V3_0_R2_11283641_A" [3] "HumanRef8_V2_0_R1_11223162_A" "HumanRef8_V2_0_R2_11223162_A" [5] "HumanRef8_V3_0_R0_11282963_A" "HumanRef8_V3_0_R1_11282963_A" [7] "HumanRef8_V3_0_R2_11282963_A" "HumanWG6_V1" [9] "HumanWG6_V2_0_R1_11223189_A" "HumanWG6_V2_0_R2_11223189_A" [11] "HumanWG6_V2_11223189_B" "HumanWG6_V3_0_R0_11282955_A" [13] "metadata" "nuID_MappingInfo" > dbGetQuery(con, "select * from HumanWG6_V1 limit 5") Search_key Target ProbeId Accession Symbol nuID 1 PLAC3 GI_23097300-A 0002360044 NM_021936.1 PLAC3 cn0dn1Sqdb0UHE4nEY 2 COG4 GI_21070955-A 0003940446 NM_015386.1 COG4 iklSlJ.eTo60t35XQE 3 GI_4505876-A GI_4505876-A 0006420736 NM_000445.1 PLEC1 NBHBeFupql_azWVUMA 4 PTPRD GI_18860893-A 0002630279 NM_130393.1 PTPRD KcSlfQzU6Ld94lMSpE 5 HS6ST2 GI_27597081-A 0003120162 NM_147174.2 HS6ST2 ZeMrPvoCSjgl4lLoAk > id2seq(.Last.value$nuID) cn0dn1Sqdb0UHE4nEY "GCTTCACTCGCTTCCCAGGGGCTCCGTTCACCAACTACATGAGCTACACG" iklSlJ.eTo60t35XQE "GCAGCCCAGGCCAGCTTTCTGCATGGATGGTCAGTCTCTTGCCCTCAAAC" NBHBeFupql_azWVUMA "AACACTAACCTGACCGTGGGCGGGGCCTTGCGGTATCCGCCCCCAATAAA" KcSlfQzU6Ld94lMSpE "CTACAGGCCCTTCAATATCCATGGAGTCTCTTCTGAGCCATACAGGGCAC" ZeMrPvoCSjgl4lLoAk "CTGATAGGTATTGTTGGAAAGCAGGATGAAGCCTGAGCCAGTGGAAAAGC" On Wed, Jul 28, 2010 at 3:30 AM, Groot, Philip de <philip.degroot@wur.nl>wrote: > Hello all, > > No, probe libraries for Illumina are not available. They should not be > because you can export the probe sequences in beadstudio. Exporting those is > really helpful in properly analysing illumina arrays in the lumi package! > > Probe sequences can be found on the Illumina annotation files on their > website: > http://www.illumina.com/support/annotation_files.ilmn > > Note that the lumi function "addNuID2lumi" contains the option > "annotationFile=" that should point to the proper annotation file as listed > above. This way, it is possible to obtain NuIDs because the probe sequences > are available. > > I hope that this information helps a bit. > > Regards, > > Dr. Philip de Groot Ph.D. > Bioinformatics Researcher > > Wageningen University / TIFN > Nutrigenomics Consortium > Nutrition, Metabolism & Genomics Group > Division of Human Nutrition > PO Box 8129, 6700 EV Wageningen > Visiting Address: Erfelijkheidsleer: De Valk, Building 304 > Dreijenweg 2, 6703 HA Wageningen > Room: 0052a > T: +31-317-485786 > F: +31-317-483342 > E-mail: Philip.deGroot@wur.nl > Internet: http://www.nutrigenomicsconsortium.nl > http://humannutrition.wur.nl/ > https://madmax.bioinformatics.nl/ > ________________________________________ > From: Mike Smith [grimbough@googlemail.com] > Sent: 28 July 2010 11:24 > To: Peter Bazeley > Cc: bioconductor@stat.math.ethz.ch > Subject: Re: [BioC] Illumina chip probe sequences > > Hi Pete, > > I'm not sure if there are any packages which provide the probe > sequences, but the annotation files provided by Mark Dunning are based > on the files found here : > http://www.compbio.group.cam.ac.uk/Resources/Annotation/index.html > > The files have rather a lot of information in them, but you can dig out > the probe sequences for most of the human and mouse expression arrays. > > I hope that's some help, > > Mike Smith > > Peter Bazeley wrote: > > Dear List, > > > > Is there a package that stores the probe sequences for Illumina's chips, > > sort of like the hgu133aprobe package? > > > > > > Thank you for any input, > > Pete > > > > [[alternative HTML version deleted]] > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor@stat.math.ethz.ch > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > [[alternative HTML version deleted]]
ADD REPLYlink written 8.7 years ago by Vincent J. Carey, Jr.6.3k
This works great. Thank you everyone for your input. Pete On Wed, Jul 28, 2010 at 7:55 AM, Vincent Carey <stvjc@channing.harvard.edu>wrote: > What about lumiHumanIDMapping? In conjunction with lumi, you can get probe > sequences corresponding to any identifier for any > of the listed human chip versions: > > > con = lumiHumanIDMapping_dbconn() > > dbListTables(con) > [1] "HumanHT12_V3_0_R1_11283641_A" "HumanHT12_V3_0_R2_11283641_A" > [3] "HumanRef8_V2_0_R1_11223162_A" "HumanRef8_V2_0_R2_11223162_A" > [5] "HumanRef8_V3_0_R0_11282963_A" "HumanRef8_V3_0_R1_11282963_A" > [7] "HumanRef8_V3_0_R2_11282963_A" "HumanWG6_V1" > [9] "HumanWG6_V2_0_R1_11223189_A" "HumanWG6_V2_0_R2_11223189_A" > [11] "HumanWG6_V2_11223189_B" "HumanWG6_V3_0_R0_11282955_A" > [13] "metadata" "nuID_MappingInfo" > > dbGetQuery(con, "select * from HumanWG6_V1 limit 5") > Search_key Target ProbeId Accession Symbol > nuID > 1 PLAC3 GI_23097300-A 0002360044 NM_021936.1 PLAC3 > cn0dn1Sqdb0UHE4nEY > 2 COG4 GI_21070955-A 0003940446 NM_015386.1 COG4 > iklSlJ.eTo60t35XQE > 3 GI_4505876-A GI_4505876-A 0006420736 NM_000445.1 PLEC1 > NBHBeFupql_azWVUMA > 4 PTPRD GI_18860893-A 0002630279 NM_130393.1 PTPRD > KcSlfQzU6Ld94lMSpE > 5 HS6ST2 GI_27597081-A 0003120162 NM_147174.2 HS6ST2 > ZeMrPvoCSjgl4lLoAk > > id2seq(.Last.value$nuID) > cn0dn1Sqdb0UHE4nEY > "GCTTCACTCGCTTCCCAGGGGCTCCGTTCACCAACTACATGAGCTACACG" > iklSlJ.eTo60t35XQE > "GCAGCCCAGGCCAGCTTTCTGCATGGATGGTCAGTCTCTTGCCCTCAAAC" > NBHBeFupql_azWVUMA > "AACACTAACCTGACCGTGGGCGGGGCCTTGCGGTATCCGCCCCCAATAAA" > KcSlfQzU6Ld94lMSpE > "CTACAGGCCCTTCAATATCCATGGAGTCTCTTCTGAGCCATACAGGGCAC" > ZeMrPvoCSjgl4lLoAk > "CTGATAGGTATTGTTGGAAAGCAGGATGAAGCCTGAGCCAGTGGAAAAGC" > > > On Wed, Jul 28, 2010 at 3:30 AM, Groot, Philip de <philip.degroot@wur.nl>wrote: > >> Hello all, >> >> No, probe libraries for Illumina are not available. They should not be >> because you can export the probe sequences in beadstudio. Exporting those is >> really helpful in properly analysing illumina arrays in the lumi package! >> >> Probe sequences can be found on the Illumina annotation files on their >> website: >> http://www.illumina.com/support/annotation_files.ilmn >> >> Note that the lumi function "addNuID2lumi" contains the option >> "annotationFile=" that should point to the proper annotation file as listed >> above. This way, it is possible to obtain NuIDs because the probe sequences >> are available. >> >> I hope that this information helps a bit. >> >> Regards, >> >> Dr. Philip de Groot Ph.D. >> Bioinformatics Researcher >> >> Wageningen University / TIFN >> Nutrigenomics Consortium >> Nutrition, Metabolism & Genomics Group >> Division of Human Nutrition >> PO Box 8129, 6700 EV Wageningen >> Visiting Address: Erfelijkheidsleer: De Valk, Building 304 >> Dreijenweg 2, 6703 HA Wageningen >> Room: 0052a >> T: +31-317-485786 >> F: +31-317-483342 >> E-mail: Philip.deGroot@wur.nl >> Internet: http://www.nutrigenomicsconsortium.nl >> http://humannutrition.wur.nl/ >> https://madmax.bioinformatics.nl/ >> ________________________________________ >> From: Mike Smith [grimbough@googlemail.com] >> Sent: 28 July 2010 11:24 >> To: Peter Bazeley >> Cc: bioconductor@stat.math.ethz.ch >> Subject: Re: [BioC] Illumina chip probe sequences >> >> Hi Pete, >> >> I'm not sure if there are any packages which provide the probe >> sequences, but the annotation files provided by Mark Dunning are based >> on the files found here : >> http://www.compbio.group.cam.ac.uk/Resources/Annotation/index.html >> >> The files have rather a lot of information in them, but you can dig out >> the probe sequences for most of the human and mouse expression arrays. >> >> I hope that's some help, >> >> Mike Smith >> >> Peter Bazeley wrote: >> > Dear List, >> > >> > Is there a package that stores the probe sequences for Illumina's chips, >> > sort of like the hgu133aprobe package? >> > >> > >> > Thank you for any input, >> > Pete >> > >> > [[alternative HTML version deleted]] >> > >> > _______________________________________________ >> > Bioconductor mailing list >> > Bioconductor@stat.math.ethz.ch >> > https://stat.ethz.ch/mailman/listinfo/bioconductor >> > Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor >> > >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor@stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor >> > > [[alternative HTML version deleted]]
ADD REPLYlink written 8.7 years ago by Peter Bazeley50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 154 users visited in the last hour