Question: edgeR: error in readDGE
0
gravatar for 村田 卓也
9.1 years ago by
村田 卓也10 wrote:
I am a beginner of everything of R and edgeR; just like "copy and paste of the command" of the manual. I tried to make DGEList object like descriptions on page 9. I could make object, "target", as follows. > targets files group description 1 GAT.txt MT FT9 2 ACA.txt WT FT9 3 ACT.txt MT FT10 4 ACG.txt WT FT10 On the next command, I failed. d <- readDGE(targets) (I deleted "skip = 5, comment.char = "#"" from original command, because on my understanding, there were no rows to be skipped, nor comments.) error colSums(x$counts) : 'x' must be numeric This error message might be inaccurate, because it is localized. GAT.txt, and other txt files were made as a tab-delimited, plain-text, as follows, for example. SEQUENCE COUNT AAACAGCAGAGAGAGAGAGAGAGAGAG 0 AAACAGCAGGTACAAGATCTACCCGGG 0 AAACAGCAGTGTTCTGAAGCCAAACTC 0 .... I use R for Mac OSX GUI 1.35 and newest edgeR. I am very happy, if you have any comments. Thank you. Takuya
gui edger • 2.5k views
ADD COMMENTlink modified 9.1 years ago by Wolfgang Huber13k • written 9.1 years ago by 村田 卓也10
Answer: edgeR: error in readDGE
1
gravatar for Wolfgang Huber
9.1 years ago by
EMBL European Molecular Biology Laboratory
Wolfgang Huber13k wrote:
?? ??, It looks like the second column ("COUNT") in your files is not always numeric. Can you send the output of the following: for (f in targets$files) str(read.delim(f, stringsAsFactors=FALSE)) Best wishes Wolfgang Il Nov/10/10 9:36 AM, ?? ?? ha scritto: > I am a beginner of everything of R and edgeR; just like "copy and paste of the command" of the manual. > > I tried to make DGEList object like descriptions on page 9. > I could make object, "target", as follows. >> targets > files group description > 1 GAT.txt MT FT9 > 2 ACA.txt WT FT9 > 3 ACT.txt MT FT10 > 4 ACG.txt WT FT10 > > On the next command, I failed. > d<- readDGE(targets) > > (I deleted "skip = 5, comment.char = "#"" from original command, because on my understanding, > there were no rows to be skipped, nor comments.) > > error colSums(x$counts) : 'x' must be numeric > > This error message might be inaccurate, because it is localized. > > GAT.txt, and other txt files were made as a tab-delimited, plain- text, as follows, for example. > SEQUENCE COUNT > AAACAGCAGAGAGAGAGAGAGAGAGAG 0 > AAACAGCAGGTACAAGATCTACCCGGG 0 > AAACAGCAGTGTTCTGAAGCCAAACTC 0 > .... > > I use R for Mac OSX GUI 1.35 and newest edgeR. > > I am very happy, if you have any comments. > Thank you. > > Takuya > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
ADD COMMENTlink written 9.1 years ago by Wolfgang Huber13k
Answer: edgeR: error in readDGE
0
gravatar for Wolfgang Huber
9.1 years ago by
EMBL European Molecular Biology Laboratory
Wolfgang Huber13k wrote:
Dear Takuya thanks, great. The third file had apparently contained non-numeric values in the 'COUNT' column, which you fixed subsequently. Wolfgang. Il Nov/11/10 2:47 AM, 村田 卓也 ha scritto: > Wolfgang, > > Thank you for your kind reply! > I tried to change format by EXCEL (I am just beginner of R since this week...) > Anyway it looks OK! > > > > BEFORE >> for (f in targets$files) > + str(read.delim(f, stringsAsFactors=FALSE)) > 'data.frame': 42131 obs. of 2 variables: > $ SEQUENCE: chr "AAACAGCAGAGAGAGAGAGAGAGAGAG" "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" ... > $ COUNT : int 0 0 0 0 0 0 0 0 0 0 ... > 'data.frame': 42130 obs. of 2 variables: > $ AAACAGCAGAGAGAGAGAGAGAGAGAG: chr "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" "AACAGCAGAACAAGCTGCTGTCTCTGT" ... > $ X0 : int 3 5 0 0 14 0 0 0 0 0 ... > 'data.frame': 42131 obs. of 2 variables: > $ SEQUENCE: chr "AAACAGCAGAGAGAGAGAGAGAGAGAG" "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" ... > $ COUNT : chr "0" "0" "0" "0" ... > 'data.frame': 42131 obs. of 2 variables: > $ SEQUENCE: chr "AAACAGCAGAGAGAGAGAGAGAGAGAG" "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" ... > $ COUNT : int 0 0 0 0 0 0 0 0 0 0 ... > > > AFTER > >> for (f in targets$files) > + str(read.delim(f, stringsAsFactors=FALSE)) > 'data.frame': 42131 obs. of 2 variables: > $ SEQUENCE: chr "AAACAGCAGAGAGAGAGAGAGAGAGAG" "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" ... > $ COUNT : num 0 0 0 0 0 0 0 0 0 0 ... > 'data.frame': 42131 obs. of 2 variables: > $ SEQUENCE: chr "AAACAGCAGAGAGAGAGAGAGAGAGAG" "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" ... > $ COUNT : num 0 3 5 0 0 14 0 0 0 0 ... > 'data.frame': 42131 obs. of 2 variables: > $ SEQUENCE: chr "AAACAGCAGAGAGAGAGAGAGAGAGAG" "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" ... > $ COUNT : num 0 0 0 0 0 0 0 0 0 0 ... > 'data.frame': 42131 obs. of 2 variables: > $ SEQUENCE: chr "AAACAGCAGAGAGAGAGAGAGAGAGAG" "AAACAGCAGGTACAAGATCTACCCGGG" "AAACAGCAGTGTTCTGAAGCCAAACTC" "AACAGCAGAAAAAGCTGCTGTCTCTGT" ... > $ COUNT : num 0 0 0 0 0 0 0 0 0 0 ... >> d<- readDGE(targets) >> d > An object of class "DGEList" > $samples > files group description lib.size norm.factors > 1 GAT.txt MT FT9 65895 1 > 2 ACA.txt WT FT9 67888 1 > 3 ACT.txt MT FT10 65144 1 > 4 ACG.txt WT FT10 23938 1 > > $counts > 1 2 3 4 > AAACAGCAGAGAGAGAGAGAGAGAGAG 0 0 0 0 > AAACAGCAGGTACAAGATCTACCCGGG 0 3 0 0 > AAACAGCAGTGTTCTGAAGCCAAACTC 0 5 0 0 > AACAGCAGAAAAAGCTGCTGTCTCTGT 0 0 0 0 > AACAGCAGAACAAGCTGCTGTCTCTGT 0 0 0 0 > 42126 more rows ... > > > Thank you again. > > Best, > > Takuya > > > On 2010/11/10, at 18:33, Wolfgang Huber wrote: > >> 村田 卓也, >> >> It looks like the second column ("COUNT") in your files is not always numeric. Can you send the output of the following: >> >> for (f in targets$files) >> str(read.delim(f, stringsAsFactors=FALSE)) >> >> >> Best wishes >> Wolfgang >> >> Il Nov/10/10 9:36 AM, 村田 卓也 ha scritto: >>> I am a beginner of everything of R and edgeR; just like "copy and paste of the command" of the manual. >>> >>> I tried to make DGEList object like descriptions on page 9. >>> I could make object, "target", as follows. >>>> targets >>> files group description >>> 1 GAT.txt MT FT9 >>> 2 ACA.txt WT FT9 >>> 3 ACT.txt MT FT10 >>> 4 ACG.txt WT FT10 >>> >>> On the next command, I failed. >>> d<- readDGE(targets) >>> >>> (I deleted "skip = 5, comment.char = "#"" from original command, because on my understanding, >>> there were no rows to be skipped, nor comments.) >>> >>> error colSums(x$counts) : 'x' must be numeric >>> >>> This error message might be inaccurate, because it is localized. >>> >>> GAT.txt, and other txt files were made as a tab-delimited, plain- text, as follows, for example. >>> SEQUENCE COUNT >>> AAACAGCAGAGAGAGAGAGAGAGAGAG 0 >>> AAACAGCAGGTACAAGATCTACCCGGG 0 >>> AAACAGCAGTGTTCTGAAGCCAAACTC 0 >>> .... >>> >>> I use R for Mac OSX GUI 1.35 and newest edgeR. >>> >>> I am very happy, if you have any comments. >>> Thank you. >>> >>> Takuya >>> >>> _______________________________________________ >>> Bioconductor mailing list >>> Bioconductor at stat.math.ethz.ch >>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >
ADD COMMENTlink written 9.1 years ago by Wolfgang Huber13k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 341 users visited in the last hour