report a problem
1
0
Entering edit mode
wang peter ★ 2.0k
@wang-peter-4647
Last seen 8.4 years ago
i found a wired problem, but i donot know if it is a bug triming from left is different from triming from right, please see those coding such two sequence have distance of 3 AAAAAAAAAAAAAAACGACACAAGCCCGATCGGAAGAGCACACGTCTGAACTCCA TCACATCACGATATCGTATGCCGTCTTCTGCTTG AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG subject<- DNAString("AAAAAAAAAAAAAAACGACACAAGCCCGATCGGAAGAGCACACGTCTGAACTCCATCAC ATCACGATATCGTATGCCGTCTTCTGCTTG") PCR2rc <- DNAString("AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCT GCTTG") trimLRPatterns(Rpattern = PCR2rc, subject = subject, max.Rmismatch=0.2,with.Rindels=T) or trimLRPatterns(Rpattern = PCR2rc, subject = subject, max.Rmismatch=3,with.Rindels=T) 25-letter "DNAString" instance seq: AAAAAAAAAAAAAAACGACACAAGC such two sequence are symitric of those above GATCGGAAGAGCACACGTCTGAACTCCA TCACATCACGATATCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACGACACAAGCCC AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG subject<- DNAString("GATCGGAAGAGCACACGTCTGAACTCCATCACATCACGATATCGTATGCCGTCTTCTGC TTGAAAAAAAAAAAAAAACGACACAAGCCC") PCR2rc <- DNAString("AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCT GCTTG") trimLRPatterns(Lpattern = PCR2rc, subject = subject, max.Lmismatch=0.2,with.Rindels=T) 88-letter "DNAString" instance seq: ATCGGAAGAGCACACGTCTGAACTCCATCACATCACGATATCGTATGCCGTCTTCTGCTTGAAAAAAAAA AAAAAACGACACAAGCCC [[alternative HTML version deleted]]
• 509 views
ADD COMMENT
0
Entering edit mode
@harris-a-jaffee-3972
Last seen 8.3 years ago
United States
The supposed counter-example (see below) suffers the same inherent defect as in your last query: using 'with.*R*indels=T' with an 'Lpattern'. Fixing that defect defeats the counter-example, unless I've missed something. On Oct 11, 2011, at 11:55 AM, wang peter wrote: > i found a wired problem, but i donot know if it is a bug > > triming from left is different from triming from right, please see > those > coding > > such two sequence have distance of 3 > AAAAAAAAAAAAAAACGACACAAGCCCGATCGGAAGAGCACACGTCTGAACTCCA > TCACATCACGATATCGTATGCCGTCTTCTGCTTG > > AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG > > subject<- > DNAString > ("AAAAAAAAAAAAAAACGACACAAGCCCGATCGGAAGAGCACACGTCTGAACTCCATCACATCACGATA > TCGTATGCCGTCTTCTGCTTG") > PCR2rc <- > DNAString > ("AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG") > trimLRPatterns(Rpattern = PCR2rc, subject = subject, > max.Rmismatch=0.2,with.Rindels=T) > or trimLRPatterns(Rpattern = PCR2rc, subject = subject, > max.Rmismatch=3,with.Rindels=T) > 25-letter "DNAString" instance > seq: AAAAAAAAAAAAAAACGACACAAGC > > such two sequence are symitric of those above > > GATCGGAAGAGCACACGTCTGAACTCCA > TCACATCACGATATCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACGACACAAGCCC > AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG > > subject<- > DNAString > ("GATCGGAAGAGCACACGTCTGAACTCCATCACATCACGATATCGTATGCCGTCTTCTGCTTGAAAAAA > AAAAAAAAACGACACAAGCCC") > PCR2rc <- > DNAString > ("AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG") > trimLRPatterns(Lpattern = PCR2rc, subject = subject, > max.Lmismatch=0.2,with.Rindels=T) > > 88-letter "DNAString" instance > seq: > ATCGGAAGAGCACACGTCTGAACTCCATCACATCACGATATCGTATGCCGTCTTCTGCTTGAAAAAAAAA > AAAAAACGACACAAGCCC But, > trimLRPatterns(Lpattern = PCR2rc, subject = subject, max.Lmismatch=0.2, with.Lindels=T) 25-letter "DNAString" instance seq: AAAAAAAAAAAAACGACACAAGCCC > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/ > gmane.science.biology.informatics.conductor
ADD COMMENT

Login before adding your answer.

Traffic: 357 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6