Question: FrozenRMA how to
0
gravatar for Alex Sanchez
7.2 years ago by
Alex Sanchez20
Alex Sanchez20 wrote:
Hello I have a doubt about how to use frma. I have 30 hgu133plus2 arrays where I would like to find the "unexpressed" genes. If I have understood it well the "barcode" function in the frma package can be used to find such genes, or, say provide a proposal. The arrays have been obtained in two different batches so frma seems even more approprite because ir claims to have the ability to process data from different batches. My question is then how should I proceed. My idea is - Process every batch (two in this case) separately - Combine the data inti a single object - Use barcode on this object to call the unexpressed genes. Can someone confurm me If this is the right approach? thanks for the help Alex Sanchez Statistics Department. Universitar de Barcelona & Statistics and Bioinformatics Unit. Vall d'Hebron Research Institute Enviado desde mi iPhone El 03/03/2012, a las 12:00, <bioconductor-request at="" r-project.org=""> escribi?: > Send Bioconductor mailing list submissions to > bioconductor at r-project.org > > To subscribe or unsubscribe via the World Wide Web, visit > https://stat.ethz.ch/mailman/listinfo/bioconductor > or, via email, send a message with subject or body 'help' to > bioconductor-request at r-project.org > > You can reach the person managing the list at > bioconductor-owner at r-project.org > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Bioconductor digest..." > > > Today's Topics: > > 1. Provide an Example for AnnotatedDataFrame (Deepak Datta) > 2. Re: Difficulty in AnnotatedDataFrame (James F. Reid) > 3. Re: easyRNASeq error (Nicolas Delhomme) > 4. Biobase typo in example of AnnotatedDataFrame man page > (James F. Reid) > 5. Re: Biobase typo in example of AnnotatedDataFrame man page > (Martin Morgan) > 6. Re: easyRNASeq error (Nicolas Delhomme) > 7. Re: A problem about trimLRPatterns (wang peter) > 8. Summarizing Single-channel Agilent data (David Westergaard) > 9. Gene-Metabolite correlation network (pankaj borah) > 10. Re: problem creating own org.Ss.eg.db (Hooiveld, Guido) > 11. Re: Summarizing Single-channel Agilent data > (axel.klenk at actelion.com) > 12. Re: Gene-Metabolite correlation network (Sean Davis) > 13. Re: Gene-Metabolite correlation network (pankaj borah) > 14. Re: A problem about trimLRPatterns (Harris A. Jaffee) > 15. KEGGSOAP (Ricardo Silva) > 16. GAGE heatmap pdf question... (Alan Derr) > 17. Re: Finding coding SNPs with predictCoding (Valerie Obenchain) > 18. Re: Finding coding SNPs with predictCoding (Thomas Girke) > 19. Re: KEGGSOAP (Martin Morgan) > 20. unable to readImage using EBImage package (diyanah [guest]) > 21. Re: unable to readImage using EBImage package (Dan Tenenbaum) > 22. beadarray vignette has broken code in R2.14.1? (Henriquez, Nick) > 23. Re: Gene-Metabolite correlation network (B Usadel) > 24. Re: Gene-Metabolite correlation network (B Usadel) > 25. Warning of function "ncbiTaxonomy" (???) > 26. Re: how edgeR control outliers? (Yuan Tian) > 27. Re: beadarray vignette has broken code in R2.14.1? (Dan Tenenbaum) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Fri, 2 Mar 2012 16:29:54 +0530 > From: Deepak Datta <deepaktheinvincible at="" gmail.com=""> > To: bioconductor at r-project.org > Subject: [BioC] Provide an Example for AnnotatedDataFrame > Message-ID: > <cahzx1smq_wujujhithkt8fhn9cq1wvfdjcuyfy9h9uyy4=shra at="" mail.gmail.com=""> > Content-Type: text/plain > > hii... this is Deepak.... > > i am working on analysis of microarray data using bioconductor and i am > rank amateur in R > > I tried using this code snippet > phenoData(spikein95) <- new("phenoData", pData = pd, varLabels = vl) > > but it said that phenoData is now defunct and we need to use > AnnotatedDataFrame. And i am not able to proceed because of the following > error > > AnnotatedDataFrame(x1)<-new("AnnotatedDataFrame",pData=pd, varLabels=v1) > Error in .nextMethod(.Object, ...) : > invalid names for slots of class ?AnnotatedDataFrame?: pData, varLabels > > > i am basically trying to segregate the samples into 3 parts containing > normal, HSIL and SCC data and this is the code that i have used till now... > > setwd("E:\\Project\\CEL files\\Old\\GSE7803-3") >> f1=list.celfiles(path="E:\\Project\\CEL files\\Old\\GSE7803-3") >> x1<-ReadAffy(filenames=f1) >> pd <- data.frame(population = c(1,1,1,1,1,1,1,1,1,1,2, 2, > + 2,2,2,2,2,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3), > + replicate= c(1,2,3,4,5,6,7,8,9,10,1,2,3,4,5,6,7, > + 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21)) >> rownames(pd) <- sampleNames(x1) >> v1 <- list(population = "1 is normal, 2 is HSIL, 3 is SCC", > replicate="arbitary numbering") > > > i further wish to perform rma and then generate a MA plot. > > kindly help me rectify this error and please explain with an *example* so > that i could proceed further. > > [[alternative HTML version deleted]] > > > > ------------------------------ > > Message: 2 > Date: Fri, 02 Mar 2012 11:03:37 +0000 > From: "James F. Reid" <james.reid at="" ifom-ieo-campus.it=""> > To: Deepak Datta <deepaktheinvincible at="" gmail.com=""> > Cc: bioconductor at r-project.org > Subject: Re: [BioC] Difficulty in AnnotatedDataFrame > Message-ID: <4F50A909.1020602 at ifom-ieo-campus.it> > Content-Type: text/plain; charset=windows-1252; format=flowed > > Hi Deepak, > > please keep the thread on the list for other users. > > On 02/03/12 10:28, Deepak Datta wrote: >> hey James, i have read the help page and i did not find it helpful. i >> would really appreciate if you could please explain me with an example >> giving details on creating a metaData > > > something like this should work: > > new("AnnotatedDataFrame", > data=pd, > varMetadata=data.frame(labelDescription=unlist(v1))) > > since your v1 is a list (it needen't be). > > Best. > J. > >> >> >> On Fri, Mar 2, 2012 at 3:49 PM, James F. Reid >> <james.reid at="" ifom-ieo-campus.it="" <mailto:james.reid="" at="" ifom-ieo-="" campus.it="">> >> wrote: >> >> Hi Deepak, >> >> you need to construct an AnnotatedDataFrame in the following way: >> AnnotatedDataFrame(data=df, varMetaData=metaData) >> Look-up the help page which is well documented: >> help("AnnotatedDataFrame") >> >> HTH. >> J. >> >> >> On 02/03/12 10:11, Deepak Datta wrote: >> >> hii... this is Deepak.... >> >> i am working on analysis of microarray data. >> >> We tried using this code snippet >> phenoData(spikein95)<- new("phenoData", pData = pd, varLabels = vl) >> >> but it said that phenoData is now defunct and we need to use >> AnnotatedDataFrame. And i am not able to proceed because of the >> following >> error >> >> AnnotatedDataFrame(x1)<-new("__AnnotatedDataFrame",pData=pd, >> varLabels=v1) >> Error in .nextMethod(.Object, ...) : >> invalid names for slots of class ?AnnotatedDataFrame?: pData, >> varLabels >> >> >> i am basically trying to segregate the samples into 3 parts >> containing >> normal, HSIL and SCC data and this is the code that i have used >> till now... >> >> setwd("E:\\Project\\CEL files\\Old\\GSE7803-3") >> >> f1=list.celfiles(path="E:\\__Project\\CEL >> files\\Old\\GSE7803-3") >> x1<-ReadAffy(filenames=f1) >> pd<- data.frame(population = c(1,1,1,1,1,1,1,1,1,1,2, 2, >> >> + 2,2,2,2,2,3,3,3,3,3,3,3,3,3,3,__3,3,3,3,3,3,3,3,3,3,3), >> + replicate= c(1,2,3,4,5,6,7,8,9,10,1,2,3,__4,5,6,7, >> + 1,2,3,4,5,6,7,8,9,10,11,12,13,__14,15,16,17,18,19,20,21)) >> >> rownames(pd)<- sampleNames(x1) >> v1<- list(population = "1 is normal, 2 is HSIL, 3 is SCC", >> >> replicate="arbitary numbering") >> >> >> i further wish to perform rma and then generate a MA plot. >> >> kindly help me rectify this error and if possible explain with >> an example >> so that i could proceed further. >> >> [[alternative HTML version deleted]] >> >> >> >> >> _________________________________________________ >> Bioconductor mailing list >> Bioconductor at r-project.org <mailto:bioconductor at="" r-project.org=""> >> https://stat.ethz.ch/mailman/__listinfo/bioconductor >> <https: stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> >> Search the archives: >> http://news.gmane.org/gmane.__science.biology.informatics.__conductor >> <http: news.gmane.org="" gmane.science.biology.informatics.conductor=""> >> >> > > > > ------------------------------ > > Message: 3 > Date: Fri, 2 Mar 2012 12:20:36 +0100 > From: Nicolas Delhomme <delhomme at="" embl.de=""> > To: "Davis, Wade" <davisjwa at="" health.missouri.edu=""> > Cc: Bioconductor mailing list <bioconductor at="" r-project.org=""> > Subject: Re: [BioC] easyRNASeq error > Message-ID: <8395D3FF-9D14-49E1-855F-E578A39E3089 at embl.de> > Content-Type: text/plain; charset=us-ascii > > Hi Wade, > > I'll send you the package off-list. And discuss how we can do for the data as it's still interesting for me to enhance my chromosome name validity checks. > > Cheers, > > Nico > > --------------------------------------------------------------- > Nicolas Delhomme > > Genome Biology Computational Support > > European Molecular Biology Laboratory > > Tel: +49 6221 387 8310 > Email: nicolas.delhomme at embl.de > Meyerhofstrasse 1 - Postfach 10.2209 > 69102 Heidelberg, Germany > --------------------------------------------------------------- > > > > On 1 Mar 2012, at 23:14, Davis, Wade wrote: > >> Hi Nico, >> If you could send me a windows zip that I could try out the changes now instead of waiting for them to get pushed through in a few days. But I don't mind waiting, whatever is easiest for you. >> >> I've been in a workshop all days, so I haven't gotten a chance to try out the suggestions for the second problem, but I will do so and get back to do. >> >> Also, you asked for a sample file to help with the second problem. I'm not sure if you still want or need that, but below is the first 60 lines or so. I can send you an entire file (compressed which is about 455MB) if you think that would be helpful. >> >> Thanks! >> >> Wade >> >> HWI-ST538 160 7 1101 1635 1954 ACAGTG 1 GAT ATCTNNNNNNGAAGAAAACGAGGGAGATTCCAAGGCCGAGCAGCTACACCNGGTACAGAAGCAGTCTGCC ACTTTGCCCTCGCCCATCACCCACTCC >> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 1661 1972 ACAGTG 1 GGA TAGCATNNNAAATGTAAATGAGGAAAATACCTAATAAAAAATATTAAAAAAAAAAAAGACACCGCCAGGA ACTTGTGAGAAATCCAAATTCTACATT >> [[[______BBBQQX_^^^^_^___^]^_^^^^[^^^^^^]^^^^^^^^^^^^^^^^BBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 1949 1944 ACAGTG 1 AGG GGTTNNNNNNTTCAAGACCTCTCCCCTGNNGAGAAAGAAACCCAAGCAGNNGCCTGTGGGAGGGAACACG GACCTGACACCTCTGCCTCAGACTCCT >> [[XZY_^BBBBBBQQ[\Z\]_[[Z^^]^^[^BBOL[\X^^PY]ZX\^BBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 1820 1948 ACAGTG 1 GTC AGCTNNNNNNAGGGTCCGATCGTATTGGANGAGGATATCTTTGATCTCCNNCTTGGAGGCTTCATCCACA TATTTTTGGTAATAAGCTACCAGGGCC >> [[[^___BBBBBBRS]_]^__^__^^^^^^^^BO[\^^^^^^^^^\^^^^^]BBLW\\^]_^X^^]\ ]]]]^^]]]]]^\[VZZ\\\\Y[\\\[\[[Y[[ QC N >> HWI-ST538 160 7 1101 1773 1957 ACAGTG 1 CTT TGGTTNNNNNGACCTCGCTTGTAGCCAGCAAAAATGGCCTTGCACCACAGCCTTCCAGACATACTTGCTG TTAGAAGTCCTGAGATCGGAAGAGCAC >> WZZ_[\]_BBBBBRQY_^^\Z^__^^^^^^]^]^]^^^^^^]^^^]]X]]]^^^^^^^___[^^]]^ ^^]^^W\\]]]\]V\\\][[[\\[[Z[Y[[WZW QC N >> HWI-ST538 160 7 1101 1971 1962 ACAGTG 1 CTT TGTTTNNNNTCTGGTCACAATAGTTGGGGGCAGAAAAGACAGTGACACAGCGGCCACCATGGGCCACCTC GTAGCCCTCGGCTTTGACTTCATGGCT >> [[[_____BBBBRR_____^__^________^^^^^^^^^^^^^^^^^^^^^^[^^\\[[^[[[\[[ [[[[[[[W[[[\\[[WY[[U[YT[[\[YZSYW[ QC N >> HWI-ST538 160 7 1101 1878 1976 ACAGTG 1 CCG CTGTCTTNCTCAGGAAGCACGCATTTCCACAGGCCATAGGGCTTTCCTACCACAGTTTGCCACAATCTCA ATGTCCCATCTTCAGAACCGCTGGCAT >> ^W^\cc\`^`BQQ``JY[YRb`^_dUccaSccaIYHOWOXRacQaaQabd\bbcbbcc\^bccc]Z^ c_]R_````UZZ]`Y\ZT]]`BBBBBBBBBBBB RM N >> HWI-ST538 160 7 1101 1934 1999 ACAGTG 1 CTC CACTGAAGTACTTCAGGTAGTAGTCCATGACGCCCTTGTCGTCGGTTCGCGACTCCTCATCACTGTCCCC GGCCCGGCCCACCGATGACATCATCTG >> bbbeeeeegggeghiiiiiigghgfiiiiihihiihiihiihhfghdgZeefhadeecdbdb`bccb b`bb`aQX[acX[[acO[aOEHOGYRY`]Y`R] chr10.fa 80607676 R 100 500 Y >> HWI-ST538 160 7 1101 2013 1948 ACAGTG 1 CAC ATCTNNNNNNCCATGGAGCAGATTGAAGANGAAATCAAAGGTTGTTTGGNNTTTCTTCGCACAGTATATA GTGTCTTTGGATTTTCATTTAAATTGA >> [[[___^BBBBBBRSX_____^_^_^_^__^^BP[^^^^^^^^^\^^^^^^[BBLW\^^__]^^^^^ Z\]]]]^\Z\]]^^][[\\\\\\\\\\\\[\Y[ QC N >> HWI-ST538 160 7 1101 2064 1957 ACAGTG 1 AGA AAGTTNNNNNATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGA ATGTTGATGATAGTAGTAGAGCTTCTA >> [[[[^[\_BBBBBQQ\[\^]__^[_]_^^^_^^__^[^^[[W^^[^^\^^\^^^]^^^___[^[XW] Z]^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 2129 1991 ACAGTG 1 GTA ATATTCATTTAGCCTTCTGAGCTTTCTGGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTC CACAGCTTTGATGACACCCACAGCAAC >> ___ce`cce`ggfdhfhfgbfbefdghggfd`ff]eZegg]eIYYYceg^cedfce^ebgfce_ccf hdfdZbdbV`db]Za^ZaZ]__bbaa_PTGT^` RM Y >> HWI-ST538 160 7 1101 2267 1959 ACAGTG 1 CAG CACAGNNNNGATGGCTACGTACATGGCTGGGGTGTTGAAGGTCTCAAACATGATCTGGGTCATCTTTTCA CGGTTGGCCTTAGGGTTCAGGGGGGCC >> [[[__^^^BBBBQQ_\^[^]^^^^^[^_^[^^^^^\Z\^RU\]]UY]WXZ^]Z^]Z]^_^^]ZZV^B BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 2466 1999 ACAGTG 1 CGT ACTTCTCCCACTCGCTTGTGCTCTGTCACTAGAAGGTTATTCTTGAAAGGTTCTGTGCCTTTTTCTTCAG GCTTCATCTGTCATACCTCTACTTGAT >> bbaeeeeegggggiiifiiiihiiiiihhhiiihighiiafgfhiiifaehghXcghhhhbghiiii fhhfdghhgfedgeddcbeeccbddd`c_b`cc chr7.fa 54159980 R 100 504 Y >> HWI-ST538 160 7 1101 2566 1981 ACAGTG 1 ATT GAACTCANCTCCTTTTAGGTTGCCCTACTAACTGGACATTGTGGACACTAAATCATATTGGGGTGATGAA TAATCAAATTTTCAATATCAAACAATG >> abaceeeeggBQ`eghhiifhhiiigihifhihfhhihhiifhffdgffhifhihfhhhiihdgfgZ d^bd^ade^abddc]`bc__bcdc_c_bb`abb chr10.fa 66474748 R 10G89 497 Y >> HWI-ST538 160 7 1101 2943 1957 ACAGTG 1 TCC GAATANNNNNCGGTCAAAATAAAAGCTCAAGATGACATCAGTCCCATTTGTCCTAAGTCCTGGTGTTGTA TGGATGGTAAGCAGCAGCCAATTATGG >> [[[^^^^_BBBBBQQ_\_^___^_^_^^^^^^^^^^^^^^^^^^\^^^^^^^^^^^^^__\]^]^_] ^^^^^_^_^^^^^W\]Z]]][[^[[[[W[\\\[ QC N >> HWI-ST538 160 7 1101 2883 1967 ACAGTG 1 ATC AGACTCNNNCTGCACGTTCACACCATAAGTCTCATCAATGTTGTCATCCATATTCTGTATCTCCTTGTCG CCACCGTAGTCTGTGATCTTCTTGCCC >> [[[__^^^^BBBR[T]]^^][]]^^[X][]]W^]^^^^X[Y\[YRY^[^^^^[]^^^^]^\Y]\Z^^ [[ZU\\^BBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 3133 1960 ACAGTG 1 CTC TCAAANNNNCTACAGAGCCCAGGAAGATTTCAGGATGAAGAGCTTCCTCCTCTTCCTCACTATCATTCTT CTGGTTGTGATTCAGATACAAACAGGA >> [[[^Z]_]BBBBSQ\_Z^_^_^^_^^^]_^^^^\^^^[Z]^^^^^^]^^^^^^]^]^^_]^ZZY^^_ \]^\]^[]Z\^^Z\\]\\\\\\\]]]]\[[VQV QC N >> HWI-ST538 160 7 1101 3023 1964 ACAGTG 1 GGC CACTCTNNNTTGTGCCTTCCACACCTTTTGGTGCAGATTGTTCAGTGGGGAGCTGCCTCATATTCTCTGA CTGGCCAGAAAGGCTCTCGCTGGGGTT >> [[[__^^^^BBBRQ_\_^^___^^^^_^^__^]^^^^^^^^^^^]\^^]^^^^^^^^^T]^^ZZ^\^ ]^^^]\\]]^BBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 3219 1966 ACAGTG 1 CAG ATGTGTNNNAATGCTAGGTGTGGTTGGTTTATTCCTAGCGTCACTATTATCAGGCCTAGTTGGCTTGATG TAGAGAAGGCAATGATTTTTTTGATGT >> [[[^_____BBBS[]___^__[_]_^\__^Z]^^^^^^^^^^^^^^^^^^^^^^]^^^^_[^^^^__ _^[^^]]]\\]\]]^^[[\\\\\\\\YXTW[\\ QC N >> HWI-ST538 160 7 1101 3047 1993 ACAGTG 1 CTC TTGTGTCCGTTTTCTTGCTGTAGCGTTTTCTCCGTACCACTCACTGATACCTGTCTATCGACTACGTGGG ATGGCAGAGGCACTGCCAGGCTCCACA >> bbbeeedegggfghiiiihhiihifhiieggihffh[affgcgfebb]eefdfh[bgbcdfe_fW^\ ]aaZa`abZ^``a_GWWW^```^bS^`W^^BBB chr1.fa 154218045 F 100 36 Y >> HWI-ST538 160 7 1101 3462 1958 ACAGTG 1 CCA CTCGTNNNNCTTGCGATCATTGTGCTTAGGGTCTTCTGATACATCTGGGGGAACATCTGTTTTATCTGAA CAAGGTCAATCTCACTTCGAGTGACCA >> [[[^^^_\BBBBQQ[ZZ^_[Y_[_]_\W^^^^[^M[]]]]\]]^^^^]\^^^FZF\\]Z^^^X\^^^ ]]^]\Z\]ZOZXZZ[\\\\TZU\[ZTTW[\[\\ QC N >> HWI-ST538 160 7 1101 3261 1972 ACAGTG 1 CCT GGATGTNNNCGTGGATCGGGTCTTGAACGTGGACTTGCCGCACCTTGTATCTCAAGCCCAGCGCCACACC CTTGCTGACTTTCTGAACACTACTGTC >> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 3390 1979 ACAGTG 1 TGC AGTTCTTNCCCGTGGCTCCTGAGCCAGCAATGTCGTCTGGGAAGCCATCATCAGCTCATTCAGCTGAGAC GTGCTAGAGGTCTCCTCAGCTTGGAGC >> bbbeeeeeggBRbfgfhihiiihhhhiiiiiehhichhgggfghbgedgdffhffdefff`bd]bdf edceecdZZ`_`bb_aL[bcc`b]`b]`b_`[` chr1.fa 187111962 F 10T89 497 Y >> HWI-ST538 160 7 1101 3666 1959 ACAGTG 1 CCG AACACNNNNCCCGGATCTCATCTCACAGAATCGTGGGTACGTCTGAACCAGCTGGTTGCCCCCAAAAATT ACCTGTTTCACGCCCCTGGTGCAGCCC >> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB QC N >> HWI-ST538 160 7 1101 3667 1975 ACAGTG 1 AGA ACACCGANGTCCACCTTCAAGTTAGGGGAAATGGCATATTCTTCGATCGGCTTGCTGATTTGGGAAATTT TATCCTTGACTGCTTCTGGAGCAGGAC >> PZZTTP_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB chr4.fa 99634649 R 10G3T10C4C19T1T13A10AG3T17 77 N >> HWI-ST538 160 7 1101 3986 1969 ACAGTG 1 ATT AAATCTNNNCATGCTCTGAAAAAGGCTTTAGGTCACTCCAAGCTTGGCAGTTAACATTTGGCATGGACAC TGGTAAAACCACAATAGAGAAAGAAGT >> [[[^_____BBBRY__^^^__^^^^^_^^__^^^^^^^^^]^^^^^^^]^^^^\^^^^____]^___ _[^^[^^^^Z^Z\\\\^[^^^]]\[\\\\[[[R QC N >> HWI-ST538 160 7 1101 4230 1977 ACAGTG 1 CGCCTCCGGGNCGTGGCACTCTGGGGCTCTGCCGTCGACATGGGCGCCGCC
ADD COMMENTlink modified 7.2 years ago by Matthew McCall830 • written 7.2 years ago by Alex Sanchez20
Answer: FrozenRMA how to
0
gravatar for Matthew McCall
7.2 years ago by
United States
Matthew McCall830 wrote:
Alex, What you propose is technically correct. A few words of caution: 1. The barcode distributions were estimated based on arrays preprocessed with the default frma summarization (not random_effect summarization). While the default summarization does not attempt to estimate and correct for a batch-specific probe effect in your data, it does down-weight probes that are "batchy". Most of the time, the two methods yield very similar results. 2. The barcode function is designed to be fairly conservative in calling genes expressed, so I imagine you will get a very large number of unexpressed genes. You can easily change this behavior by altering the threshold in the barcode function, or perhaps even better, have the barcode function return a z-score, which you can use to determine expressed / unexpressed. Best, Matt 2012/3/3 Alejandro S?nchez Pla <sanplaale at="" gmail.com="">: > Hello > I have a doubt about how to use frma. > I have 30 hgu133plus2 arrays where I would like to find the > "unexpressed" genes. If I have understood it well the "barcode" > function in the frma package can be used to find such genes, or, say > provide a proposal. > The arrays have been obtained in two different batches so frma seems > even more approprite because ir claims to have the ability to process > data from different batches. > My question is then how should I proceed. > My idea is > - Process every batch (two in this case) ?separately > - Combine the data inti a single object > - Use barcode on this object to call the unexpressed genes. > > Can someone confurm me If this is the right approach? > > thanks for the help > > Alex Sanchez > Statistics Department. Universitar de Barcelona & > Statistics and Bioinformatics Unit. Vall d'Hebron Research Institute > > > > Enviado desde mi iPhone > > El 03/03/2012, a las 12:00, <bioconductor-request at="" r-project.org=""> escribi?: > >> Send Bioconductor mailing list submissions to >> ? ?bioconductor at r-project.org >> >> To subscribe or unsubscribe via the World Wide Web, visit >> ? ?https://stat.ethz.ch/mailman/listinfo/bioconductor >> or, via email, send a message with subject or body 'help' to >> ? ?bioconductor-request at r-project.org >> >> You can reach the person managing the list at >> ? ?bioconductor-owner at r-project.org >> >> When replying, please edit your Subject line so it is more specific >> than "Re: Contents of Bioconductor digest..." >> >> >> Today's Topics: >> >> ? 1. Provide an Example for AnnotatedDataFrame (Deepak Datta) >> ? 2. Re: Difficulty in AnnotatedDataFrame (James F. Reid) >> ? 3. Re: easyRNASeq error (Nicolas Delhomme) >> ? 4. Biobase typo in example of AnnotatedDataFrame man page >> ? ? ?(James F. Reid) >> ? 5. Re: Biobase typo in example of AnnotatedDataFrame man page >> ? ? ?(Martin Morgan) >> ? 6. Re: easyRNASeq error (Nicolas Delhomme) >> ? 7. Re: A problem about trimLRPatterns (wang peter) >> ? 8. ?Summarizing Single-channel Agilent data (David Westergaard) >> ? 9. Gene-Metabolite correlation network (pankaj borah) >> ?10. Re: problem creating own org.Ss.eg.db (Hooiveld, Guido) >> ?11. Re: Summarizing Single-channel Agilent data >> ? ? ?(axel.klenk at actelion.com) >> ?12. Re: Gene-Metabolite correlation network (Sean Davis) >> ?13. Re: Gene-Metabolite correlation network (pankaj borah) >> ?14. Re: A problem about trimLRPatterns (Harris A. Jaffee) >> ?15. KEGGSOAP (Ricardo Silva) >> ?16. ?GAGE heatmap pdf question... (Alan Derr) >> ?17. Re: Finding coding SNPs with predictCoding (Valerie Obenchain) >> ?18. Re: Finding coding SNPs with predictCoding (Thomas Girke) >> ?19. Re: KEGGSOAP (Martin Morgan) >> ?20. unable to readImage using EBImage package (diyanah [guest]) >> ?21. Re: unable to readImage using EBImage package (Dan Tenenbaum) >> ?22. beadarray vignette has broken code in R2.14.1? (Henriquez, Nick) >> ?23. Re: Gene-Metabolite correlation network (B Usadel) >> ?24. Re: Gene-Metabolite correlation network (B Usadel) >> ?25. Warning of function "ncbiTaxonomy" (???) >> ?26. Re: how edgeR control outliers? (Yuan Tian) >> ?27. Re: beadarray vignette has broken code in R2.14.1? (Dan Tenenbaum) >> >> >> ---------------------------------------------------------------------- >> >> Message: 1 >> Date: Fri, 2 Mar 2012 16:29:54 +0530 >> From: Deepak Datta <deepaktheinvincible at="" gmail.com=""> >> To: bioconductor at r-project.org >> Subject: [BioC] Provide an Example for AnnotatedDataFrame >> Message-ID: >> ? ?<cahzx1smq_wujujhithkt8fhn9cq1wvfdjcuyfy9h9uyy4=shra at="" mail.gmail.com=""> >> Content-Type: text/plain >> >> hii... this is Deepak.... >> >> i am working on analysis of microarray data using bioconductor and i am >> rank amateur in R >> >> I tried using this code snippet >> phenoData(spikein95) <- new("phenoData", pData = pd, varLabels = vl) >> >> but it said that phenoData is now defunct and we need to use >> AnnotatedDataFrame. And i am not able to proceed because of the following >> error >> >> AnnotatedDataFrame(x1)<-new("AnnotatedDataFrame",pData=pd, varLabels=v1) >> Error in .nextMethod(.Object, ...) : >> ?invalid names for slots of class ?AnnotatedDataFrame?: pData, varLabels >> >> >> i am basically trying to segregate the samples into 3 parts containing >> normal, HSIL and SCC data and this is the code that i have used till now... >> >> setwd("E:\\Project\\CEL files\\Old\\GSE7803-3") >>> f1=list.celfiles(path="E:\\Project\\CEL files\\Old\\GSE7803-3") >>> x1<-ReadAffy(filenames=f1) >>> pd <- data.frame(population = c(1,1,1,1,1,1,1,1,1,1,2, 2, >> + ?2,2,2,2,2,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3), >> + ?replicate= c(1,2,3,4,5,6,7,8,9,10,1,2,3,4,5,6,7, >> + ?1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21)) >>> rownames(pd) <- sampleNames(x1) >>> v1 <- list(population = "1 is normal, 2 is HSIL, 3 is SCC", >> replicate="arbitary numbering") >> >> >> i further wish to perform rma and then generate a MA plot. >> >> kindly help me rectify this error and please explain with an *example* so >> that i could proceed further. >> >> ? ?[[alternative HTML version deleted]] >> >> >> >> ------------------------------ >> >> Message: 2 >> Date: Fri, 02 Mar 2012 11:03:37 +0000 >> From: "James F. Reid" <james.reid at="" ifom-ieo-campus.it=""> >> To: Deepak Datta <deepaktheinvincible at="" gmail.com=""> >> Cc: bioconductor at r-project.org >> Subject: Re: [BioC] Difficulty in AnnotatedDataFrame >> Message-ID: <4F50A909.1020602 at ifom-ieo-campus.it> >> Content-Type: text/plain; charset=windows-1252; format=flowed >> >> Hi Deepak, >> >> please keep the thread on the list for other users. >> >> On 02/03/12 10:28, Deepak Datta wrote: >>> hey James, i have read the help page and i did not find it helpful. i >>> would really appreciate if you could please explain me with an example >>> giving details on creating a metaData >> >> >> something like this should work: >> >> new("AnnotatedDataFrame", >> ? ? data=pd, >> ? ? varMetadata=data.frame(labelDescription=unlist(v1))) >> >> since your v1 is a list (it needen't be). >> >> Best. >> J. >> >>> >>> >>> On Fri, Mar 2, 2012 at 3:49 PM, James F. Reid >>> <james.reid at="" ifom-ieo-campus.it="" <mailto:james.reid="" at="" ifom-ieo-="" campus.it="">> >>> wrote: >>> >>> ? ?Hi Deepak, >>> >>> ? ?you need to construct an AnnotatedDataFrame in the following way: >>> ? ?AnnotatedDataFrame(data=df, varMetaData=metaData) >>> ? ?Look-up the help page which is well documented: >>> ? ?help("AnnotatedDataFrame") >>> >>> ? ?HTH. >>> ? ?J. >>> >>> >>> ? ?On 02/03/12 10:11, Deepak Datta wrote: >>> >>> ? ? ? ?hii... this is Deepak.... >>> >>> ? ? ? ?i am working on analysis of microarray data. >>> >>> ? ? ? ?We tried using this code snippet >>> ? ? ? ?phenoData(spikein95)<- new("phenoData", pData = pd, varLabels = vl) >>> >>> ? ? ? ?but it said that phenoData is now defunct and we need to use >>> ? ? ? ?AnnotatedDataFrame. And i am not able to proceed because of the >>> ? ? ? ?following >>> ? ? ? ?error >>> >>> ? ? ? ?AnnotatedDataFrame(x1)<-new("__AnnotatedDataFrame",pData=pd, >>> ? ? ? ?varLabels=v1) >>> ? ? ? ?Error in .nextMethod(.Object, ...) : >>> ? ? ? ? ? invalid names for slots of class ?AnnotatedDataFrame?: pData, >>> ? ? ? ?varLabels >>> >>> >>> ? ? ? ?i am basically trying to segregate the samples into 3 parts >>> ? ? ? ?containing >>> ? ? ? ?normal, HSIL and SCC data and this is the code that i have used >>> ? ? ? ?till now... >>> >>> ? ? ? ?setwd("E:\\Project\\CEL files\\Old\\GSE7803-3") >>> >>> ? ? ? ? ? ?f1=list.celfiles(path="E:\\__Project\\CEL >>> ? ? ? ? ? ?files\\Old\\GSE7803-3") >>> ? ? ? ? ? ?x1<-ReadAffy(filenames=f1) >>> ? ? ? ? ? ? ?pd<- data.frame(population = c(1,1,1,1,1,1,1,1,1,1,2, 2, >>> >>> ? ? ? ?+ ?2,2,2,2,2,3,3,3,3,3,3,3,3,3,3,__3,3,3,3,3,3,3,3,3,3,3), >>> ? ? ? ?+ ?replicate= c(1,2,3,4,5,6,7,8,9,10,1,2,3,__4,5,6,7, >>> ? ? ? ?+ ?1,2,3,4,5,6,7,8,9,10,11,12,13,__14,15,16,17,18,19,20,21)) >>> >>> ? ? ? ? ? ?rownames(pd)<- sampleNames(x1) >>> ? ? ? ? ? ?v1<- list(population = "1 is normal, 2 is HSIL, 3 is SCC", >>> >>> ? ? ? ?replicate="arbitary numbering") >>> >>> >>> ? ? ? ?i further wish to perform rma and then generate a MA plot. >>> >>> ? ? ? ?kindly help me rectify this error and if possible explain with >>> ? ? ? ?an example >>> ? ? ? ?so that i could proceed further. >>> >>> ? ? ? ? ? ? ? ?[[alternative HTML version deleted]] >>> >>> >>> >>> >>> ? ? ? ?_________________________________________________ >>> ? ? ? ?Bioconductor mailing list >>> ? ? ? ?Bioconductor at r-project.org <mailto:bioconductor at="" r-project.org=""> >>> ? ? ? ?https://stat.ethz.ch/mailman/__listinfo/bioconductor >>> ? ? ? ?<https: stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> >>> ? ? ? ?Search the archives: >>> ? ? ? ?http://news.gmane.org/gmane.__science.biology.informatics.__conductor >>> ? ? ? ?<http: news.gmane.org="" gmane.science.biology.informatics.conductor=""> >>> >>> >> >> >> >> ------------------------------ >> >> Message: 3 >> Date: Fri, 2 Mar 2012 12:20:36 +0100 >> From: Nicolas Delhomme <delhomme at="" embl.de=""> >> To: "Davis, Wade" <davisjwa at="" health.missouri.edu=""> >> Cc: Bioconductor mailing list <bioconductor at="" r-project.org=""> >> Subject: Re: [BioC] easyRNASeq error >> Message-ID: <8395D3FF-9D14-49E1-855F-E578A39E3089 at embl.de> >> Content-Type: text/plain; charset=us-ascii >> >> Hi Wade, >> >> I'll send you the package off-list. And discuss how we can do for the data as it's still interesting for me to enhance my chromosome name validity checks. >> >> Cheers, >> >> Nico >> >> --------------------------------------------------------------- >> Nicolas Delhomme >> >> Genome Biology Computational Support >> >> European Molecular Biology Laboratory >> >> Tel: +49 6221 387 8310 >> Email: nicolas.delhomme at embl.de >> Meyerhofstrasse 1 - Postfach 10.2209 >> 69102 Heidelberg, Germany >> --------------------------------------------------------------- >> >> >> >> On 1 Mar 2012, at 23:14, Davis, Wade wrote: >> >>> Hi Nico, >>> If you could send me a windows zip that I could try out the changes now instead of waiting for them to get pushed through in a few days. But I don't mind waiting, whatever is easiest for you. >>> >>> I've been in a workshop all days, so I haven't gotten a chance to try out the suggestions for the second problem, but I will do so and get back to do. >>> >>> Also, you asked for a sample file to help with the second problem. I'm not sure if you still want or need that, but below is the first 60 lines or so. I can send you an entire file (compressed which is about 455MB) if you think that would be helpful. >>> >>> Thanks! >>> >>> Wade >>> >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1635 ? ?1954 ? ?ACAGTG ? ?1 ? ?GA TATCTNNNNNNGAAGAAAACGAGGGAGATTCCAAGGCCGAGCAGCTACACCNGGTACAGAAGCAGTCTGC CACTTTGCCCTCGCCCATCACCCACTCC >>> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1661 ? ?1972 ? ?ACAGTG ? ?1 ? ?GG ATAGCATNNNAAATGTAAATGAGGAAAATACCTAATAAAAAATATTAAAAAAAAAAAAGACACCGCCAGG AACTTGTGAGAAATCCAAATTCTACATT >>> [[[______BBBQQX_^^^^_^___^]^_^^^^[^^^^^^]^^^^^^^^^^^^^^^^BBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1949 ? ?1944 ? ?ACAGTG ? ?1 ? ?AG GGGTTNNNNNNTTCAAGACCTCTCCCCTGNNGAGAAAGAAACCCAAGCAGNNGCCTGTGGGAGGGAACAC GGACCTGACACCTCTGCCTCAGACTCCT >>> [[XZY_^BBBBBBQQ[\Z\]_[[Z^^]^^[^BBOL[\X^^PY]ZX\^BBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1820 ? ?1948 ? ?ACAGTG ? ?1 ? ?GT CAGCTNNNNNNAGGGTCCGATCGTATTGGANGAGGATATCTTTGATCTCCNNCTTGGAGGCTTCATCCAC ATATTTTTGGTAATAAGCTACCAGGGCC >>> [[[^___BBBBBBRS]_]^__^__^^^^^^^^BO[\^^^^^^^^^\^^^^^]BBLW\\^]_^X^^] \]]]]^^]]]]]^\[VZZ\\\\Y[\\\[\[[Y[[ ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1773 ? ?1957 ? ?ACAGTG ? ?1 ? ?CT TTGGTTNNNNNGACCTCGCTTGTAGCCAGCAAAAATGGCCTTGCACCACAGCCTTCCAGACATACTTGCT GTTAGAAGTCCTGAGATCGGAAGAGCAC >>> WZZ_[\]_BBBBBRQY_^^\Z^__^^^^^^]^]^]^^^^^^]^^^]]X]]]^^^^^^^___[^^]] ^^^]^^W\\]]]\]V\\\][[[\\[[Z[Y[[WZW ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1971 ? ?1962 ? ?ACAGTG ? ?1 ? ?CT TTGTTTNNNNTCTGGTCACAATAGTTGGGGGCAGAAAAGACAGTGACACAGCGGCCACCATGGGCCACCT CGTAGCCCTCGGCTTTGACTTCATGGCT >>> [[[_____BBBBRR_____^__^________^^^^^^^^^^^^^^^^^^^^^^[^^\\[[^[[[\[ [[[[[[[[W[[[\\[[WY[[U[YT[[\[YZSYW[ ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1878 ? ?1976 ? ?ACAGTG ? ?1 ? ?CC GCTGTCTTNCTCAGGAAGCACGCATTTCCACAGGCCATAGGGCTTTCCTACCACAGTTTGCCACAATCTC AATGTCCCATCTTCAGAACCGCTGGCAT >>> ^W^\cc\`^`BQQ``JY[YRb`^_dUccaSccaIYHOWOXRacQaaQabd\bbcbbcc\^bccc]Z ^c_]R_````UZZ]`Y\ZT]]`BBBBBBBBBBBB ? ?RM ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?1934 ? ?1999 ? ?ACAGTG ? ?1 ? ?CT CCACTGAAGTACTTCAGGTAGTAGTCCATGACGCCCTTGTCGTCGGTTCGCGACTCCTCATCACTGTCCC CGGCCCGGCCCACCGATGACATCATCTG >>> bbbeeeeegggeghiiiiiigghgfiiiiihihiihiihiihhfghdgZeefhadeecdbdb`bcc bb`bb`aQX[acX[[acO[aOEHOGYRY`]Y`R] ? ?chr10.fa ? ? ? ?80607676 ? ?R ? ?100 ? ?500 ? ? ? ? ? ? ? ? ? ? ? ?Y >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2013 ? ?1948 ? ?ACAGTG ? ?1 ? ?CA CATCTNNNNNNCCATGGAGCAGATTGAAGANGAAATCAAAGGTTGTTTGGNNTTTCTTCGCACAGTATAT AGTGTCTTTGGATTTTCATTTAAATTGA >>> [[[___^BBBBBBRSX_____^_^_^_^__^^BP[^^^^^^^^^\^^^^^^[BBLW\^^__]^^^^ ^Z\]]]]^\Z\]]^^][[\\\\\\\\\\\\[\Y[ ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2064 ? ?1957 ? ?ACAGTG ? ?1 ? ?AG AAAGTTNNNNNATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGG AATGTTGATGATAGTAGTAGAGCTTCTA >>> [[[[^[\_BBBBBQQ\[\^]__^[_]_^^^_^^__^[^^[[W^^[^^\^^\^^^]^^^___[^[XW ]Z]^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2129 ? ?1991 ? ?ACAGTG ? ?1 ? ?GT AATATTCATTTAGCCTTCTGAGCTTTCTGGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGT CCACAGCTTTGATGACACCCACAGCAAC >>> ___ce`cce`ggfdhfhfgbfbefdghggfd`ff]eZegg]eIYYYceg^cedfce^ebgfce_cc fhdfdZbdbV`db]Za^ZaZ]__bbaa_PTGT^` ? ?RM ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?Y >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2267 ? ?1959 ? ?ACAGTG ? ?1 ? ?CA GCACAGNNNNGATGGCTACGTACATGGCTGGGGTGTTGAAGGTCTCAAACATGATCTGGGTCATCTTTTC ACGGTTGGCCTTAGGGTTCAGGGGGGCC >>> [[[__^^^BBBBQQ_\^[^]^^^^^[^_^[^^^^^\Z\^RU\]]UY]WXZ^]Z^]Z]^_^^]ZZV^ BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2466 ? ?1999 ? ?ACAGTG ? ?1 ? ?CG TACTTCTCCCACTCGCTTGTGCTCTGTCACTAGAAGGTTATTCTTGAAAGGTTCTGTGCCTTTTTCTTCA GGCTTCATCTGTCATACCTCTACTTGAT >>> bbaeeeeegggggiiifiiiihiiiiihhhiiihighiiafgfhiiifaehghXcghhhhbghiii ifhhfdghhgfedgeddcbeeccbddd`c_b`cc ? ?chr7.fa ? ? ? ?54159980 ? ?R ? ?100 ? ?504 ? ? ? ? ? ? ? ? ? ? ? ?Y >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2566 ? ?1981 ? ?ACAGTG ? ?1 ? ?AT TGAACTCANCTCCTTTTAGGTTGCCCTACTAACTGGACATTGTGGACACTAAATCATATTGGGGTGATGA ATAATCAAATTTTCAATATCAAACAATG >>> abaceeeeggBQ`eghhiifhhiiigihifhihfhhihhiifhffdgffhifhihfhhhiihdgfg Zd^bd^ade^abddc]`bc__bcdc_c_bb`abb ? ?chr10.fa ? ? ? ?66474748 ? ?R ? ?10G89 ? ?497 ? ? ? ? ? ? ? ? ? ? ? ?Y >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2943 ? ?1957 ? ?ACAGTG ? ?1 ? ?TC CGAATANNNNNCGGTCAAAATAAAAGCTCAAGATGACATCAGTCCCATTTGTCCTAAGTCCTGGTGTTGT ATGGATGGTAAGCAGCAGCCAATTATGG >>> [[[^^^^_BBBBBQQ_\_^___^_^_^^^^^^^^^^^^^^^^^^\^^^^^^^^^^^^^__\]^]^_ ]^^^^^_^_^^^^^W\]Z]]][[^[[[[W[\\\[ ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?2883 ? ?1967 ? ?ACAGTG ? ?1 ? ?AT CAGACTCNNNCTGCACGTTCACACCATAAGTCTCATCAATGTTGTCATCCATATTCTGTATCTCCTTGTC GCCACCGTAGTCTGTGATCTTCTTGCCC >>> [[[__^^^^BBBR[T]]^^][]]^^[X][]]W^]^^^^X[Y\[YRY^[^^^^[]^^^^]^\Y]\Z^ ^[[ZU\\^BBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3133 ? ?1960 ? ?ACAGTG ? ?1 ? ?CT CTCAAANNNNCTACAGAGCCCAGGAAGATTTCAGGATGAAGAGCTTCCTCCTCTTCCTCACTATCATTCT TCTGGTTGTGATTCAGATACAAACAGGA >>> [[[^Z]_]BBBBSQ\_Z^_^_^^_^^^]_^^^^\^^^[Z]^^^^^^]^^^^^^]^]^^_]^ZZY^^ _\]^\]^[]Z\^^Z\\]\\\\\\\]]]]\[[VQV ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3023 ? ?1964 ? ?ACAGTG ? ?1 ? ?GG CCACTCTNNNTTGTGCCTTCCACACCTTTTGGTGCAGATTGTTCAGTGGGGAGCTGCCTCATATTCTCTG ACTGGCCAGAAAGGCTCTCGCTGGGGTT >>> [[[__^^^^BBBRQ_\_^^___^^^^_^^__^]^^^^^^^^^^^]\^^]^^^^^^^^^T]^^ZZ^\ ^]^^^]\\]]^BBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3219 ? ?1966 ? ?ACAGTG ? ?1 ? ?CA GATGTGTNNNAATGCTAGGTGTGGTTGGTTTATTCCTAGCGTCACTATTATCAGGCCTAGTTGGCTTGAT GTAGAGAAGGCAATGATTTTTTTGATGT >>> [[[^_____BBBS[]___^__[_]_^\__^Z]^^^^^^^^^^^^^^^^^^^^^^]^^^^_[^^^^_ __^[^^]]]\\]\]]^^[[\\\\\\\\YXTW[\\ ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3047 ? ?1993 ? ?ACAGTG ? ?1 ? ?CT CTTGTGTCCGTTTTCTTGCTGTAGCGTTTTCTCCGTACCACTCACTGATACCTGTCTATCGACTACGTGG GATGGCAGAGGCACTGCCAGGCTCCACA >>> bbbeeedegggfghiiiihhiihifhiieggihffh[affgcgfebb]eefdfh[bgbcdfe_fW^ \]aaZa`abZ^``a_GWWW^```^bS^`W^^BBB ? ?chr1.fa ? ? ? ?154218045 ? ?F ? ?100 ? ?36 ? ? ? ? ? ? ? ? ? ? ? ?Y >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3462 ? ?1958 ? ?ACAGTG ? ?1 ? ?CC ACTCGTNNNNCTTGCGATCATTGTGCTTAGGGTCTTCTGATACATCTGGGGGAACATCTGTTTTATCTGA ACAAGGTCAATCTCACTTCGAGTGACCA >>> [[[^^^_\BBBBQQ[ZZ^_[Y_[_]_\W^^^^[^M[]]]]\]]^^^^]\^^^FZF\\]Z^^^X\^^ ^]]^]\Z\]ZOZXZZ[\\\\TZU\[ZTTW[\[\\ ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3261 ? ?1972 ? ?ACAGTG ? ?1 ? ?CC TGGATGTNNNCGTGGATCGGGTCTTGAACGTGGACTTGCCGCACCTTGTATCTCAAGCCCAGCGCCACAC CCTTGCTGACTTTCTGAACACTACTGTC >>> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3390 ? ?1979 ? ?ACAGTG ? ?1 ? ?TG CAGTTCTTNCCCGTGGCTCCTGAGCCAGCAATGTCGTCTGGGAAGCCATCATCAGCTCATTCAGCTGAGA CGTGCTAGAGGTCTCCTCAGCTTGGAGC >>> bbbeeeeeggBRbfgfhihiiihhhhiiiiiehhichhgggfghbgedgdffhffdefff`bd]bd fedceecdZZ`_`bb_aL[bcc`b]`b]`b_`[` ? ?chr1.fa ? ? ? ?187111962 ? ?F ? ?10T89 ? ?497 ? ? ? ? ? ? ? ? ? ? ? ?Y >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3666 ? ?1959 ? ?ACAGTG ? ?1 ? ?CC GAACACNNNNCCCGGATCTCATCTCACAGAATCGTGGGTACGTCTGAACCAGCTGGTTGCCCCCAAAAAT TACCTGTTTCACGCCCCTGGTGCAGCCC >>> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3667 ? ?1975 ? ?ACAGTG ? ?1 ? ?AG AACACCGANGTCCACCTTCAAGTTAGGGGAAATGGCATATTCTTCGATCGGCTTGCTGATTTGGGAAATT TTATCCTTGACTGCTTCTGGAGCAGGAC >>> PZZTTP_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB ? ?chr4.fa ? ? ? ?99634649 ? ?R ? ?10G3T10C4C19T1T13A10AG3T17 ? ?77 ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?3986 ? ?1969 ? ?ACAGTG ? ?1 ? ?AT TAAATCTNNNCATGCTCTGAAAAAGGCTTTAGGTCACTCCAAGCTTGGCAGTTAACATTTGGCATGGACA CTGGTAAAACCACAATAGAGAAAGAAGT >>> [[[^_____BBBRY__^^^__^^^^^_^^__^^^^^^^^^]^^^^^^^]^^^^\^^^^____]^__ __[^^[^^^^Z^Z\\\\^[^^^]]\[\\\\[[[R ? ?QC ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?N >>> HWI-ST538 ? ?160 ? ?7 ? ?1101 ? ?4230 ? ?1977 ? ?ACAGTG ? ?1 ? ?CGCCTCCGGGNCGTGGCACTCTGGGGCTCTGCCGTCGACATGGGCGCCGCC > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- Matthew N McCall, PhD 112 Arvine Heights Rochester, NY 14611 Cell: 202-222-5880
ADD COMMENTlink written 7.2 years ago by Matthew McCall830
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 108 users visited in the last hour