Search
Question: Problems in retrieving 3'UTR sequences of ALL human genes using biomaRt
0
gravatar for Karthik K N
6.2 years ago by
Karthik K N200
Karthik K N200 wrote:
Dear Members, I am trying to download the 3'UTR sequences of all human genes from Ensembl Biomart using the package biomaRt. Ideally, after retrieving I want to save these in FASTA format. When I am using the code given below to get 3'UTRs of genes in chromosome 1, 2 and 3 (not sure if this is the best way to achieve what I want), I am getting an error: "Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = "chromosome_name", : Query ERROR: caught BioMart::Exception::Database: Could not connect to mysql database ensembl_mart_67a: DBI connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca;port=3306', 'bm_web',...) failed: Too many connections at /srv/biomart_server/ biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98" Code is given below: > library(biomaRt) > ensembl=useMart("ensembl") > ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) > chrom=c(1,2,3) > getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", values = chrom, mart = ensembl) Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = "chromosome_name", : Query ERROR: caught BioMart::Exception::Database: Could not connect to mysql database ensembl_mart_67a: DBI connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca;port=3306', 'bm_web',...) failed: Too many connections at /srv/biomart_server/ biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98 *SessionInfo is given below:* * * > sessionInfo() R version 2.15.0 (2012-03-30) Platform: i386-pc-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=English_India.1252 LC_CTYPE=English_India.1252 LC_MONETARY=English_India.1252 LC_NUMERIC=C [5] LC_TIME=English_India.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] biomaRt_2.12.0 loaded via a namespace (and not attached): [1] RCurl_1.91-1.1 XML_3.9-1.1 Can somebody please tell me where I am going wrong? Thanks a lot, Regards, Kart [[alternative HTML version deleted]]
ADD COMMENTlink modified 6.2 years ago by Tim Smith1.0k • written 6.2 years ago by Karthik K N200
0
gravatar for Tim Smith
6.2 years ago by
Tim Smith1.0k
Tim Smith1.0k wrote:
Seems to work with: chrom <- '1' xx <- getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name",         values = chrom, mart = ensembl) ________________________________ From: Karthik K N <karthikuttan@gmail.com> To: bioconductor@r-project.org Sent: Monday, July 23, 2012 5:02 AM Subject: [BioC] Problems in retrieving 3'UTR sequences of ALL human genes using biomaRt Dear Members, I am trying to download the 3'UTR sequences of all human genes from Ensembl Biomart using the package biomaRt. Ideally, after retrieving I want to save these in FASTA format. When I am using the code given below to get 3'UTRs of genes in chromosome 1, 2 and 3 (not sure if this is the best way to achieve what I want), I am getting an error: "Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = "chromosome_name",  :   Query ERROR: caught BioMart::Exception::Database: Could not connect to mysql database ensembl_mart_67a: DBI connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca;port=3306', 'bm_web',...) failed: Too many connections at /srv/biomart_server/ biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98" Code is given below: > library(biomaRt) > ensembl=useMart("ensembl") > ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) > chrom=c(1,2,3) > getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", values = chrom, mart = ensembl) Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = "chromosome_name",  :   Query ERROR: caught BioMart::Exception::Database: Could not connect to mysql database ensembl_mart_67a: DBI connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca;port=3306', 'bm_web',...) failed: Too many connections at /srv/biomart_server/ biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98 *SessionInfo is given below:* * * > sessionInfo() R version 2.15.0 (2012-03-30) Platform: i386-pc-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=English_India.1252  LC_CTYPE=English_India.1252 LC_MONETARY=English_India.1252 LC_NUMERIC=C [5] LC_TIME=English_India.1252 attached base packages: [1] stats    graphics  grDevices utils    datasets  methods  base other attached packages: [1] biomaRt_2.12.0 loaded via a namespace (and not attached): [1] RCurl_1.91-1.1 XML_3.9-1.1 Can somebody please tell me where I am going wrong? Thanks a lot, Regards, Kart     [[alternative HTML version deleted]] _______________________________________________ Bioconductor mailing list Bioconductor@r-project.org https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor [[alternative HTML version deleted]]
ADD COMMENTlink written 6.2 years ago by Tim Smith1.0k
Hello Tim, Thanks for the reply. I think this will give the 3'UTRs of all the genes in chromosome 1. How can I get this for ALL the genes in ALL the chromosome instead of repeating the step by changing the chromosome number? Thanks a lot once again. On Mon, Jul 23, 2012 at 5:04 PM, Tim Smith <tim_smith_666@yahoo.com> wrote: > Seems to work with: > > chrom <- '1' > xx <- getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", > > values = chrom, mart = ensembl) > > ------------------------------ > *From:* Karthik K N <karthikuttan@gmail.com> > *To:* bioconductor@r-project.org > *Sent:* Monday, July 23, 2012 5:02 AM > *Subject:* [BioC] Problems in retrieving 3'UTR sequences of ALL human > genes using biomaRt > > Dear Members, > > I am trying to download the 3'UTR sequences of all human genes from Ensembl > Biomart using the package biomaRt. Ideally, after retrieving I want to save > these in FASTA format. When I am using the code given below to get 3'UTRs > of genes in chromosome 1, 2 and 3 (not sure if this is the best way to > achieve what I want), I am getting an error: > > "Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = > "chromosome_name", : > Query ERROR: caught BioMart::Exception::Database: Could not connect to > mysql database ensembl_mart_67a: DBI > connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca > ;port=3306','bm_web',...) > failed: Too many connections at /srv/biomart_server/ > biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98" > > Code is given below: > > > library(biomaRt) > > ensembl=useMart("ensembl") > > ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) > > chrom=c(1,2,3) > > getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", > values = chrom, mart = ensembl) > Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = > "chromosome_name", : > Query ERROR: caught BioMart::Exception::Database: Could not connect to > mysql database ensembl_mart_67a: DBI > connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca > ;port=3306','bm_web',...) > failed: Too many connections at /srv/biomart_server/ > biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98 > > *SessionInfo is given below:* > * > > * > > sessionInfo() > R version 2.15.0 (2012-03-30) > Platform: i386-pc-mingw32/i386 (32-bit) > > locale: > [1] LC_COLLATE=English_India.1252 LC_CTYPE=English_India.1252 > LC_MONETARY=English_India.1252 LC_NUMERIC=C > [5] LC_TIME=English_India.1252 > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] biomaRt_2.12.0 > > loaded via a namespace (and not attached): > [1] RCurl_1.91-1.1 XML_3.9-1.1 > > > Can somebody please tell me where I am going wrong? > > Thanks a lot, > > Regards, > > Kart > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > - [[alternative HTML version deleted]]
ADD REPLYlink written 6.2 years ago by Karthik K N200
Try: chrom <- c(1:22,'X','Y') ________________________________ From: Karthik K N <karthikuttan@gmail.com> Cc: "bioconductor@r-project.org" <bioconductor@r-project.org> Sent: Monday, July 23, 2012 7:46 AM Subject: Re: [BioC] Problems in retrieving 3'UTR sequences of ALL human genes using biomaRt �Hello Tim, Thanks for the reply. I think this will give the 3'UTRs of all the genes in chromosome 1. How can I get this for ALL the genes in ALL the chromosome instead of repeating the step by changing the chromosome number? Thanks a lot once again. Seems to work with: > > >chrom <- '1' >xx <- getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", > >��� ��� values = chrom, mart = ensembl) > > > >________________________________ > From: Karthik K N <karthikuttan@gmail.com> >To: bioconductor@r-project.org >Sent: Monday, July 23, 2012 5:02 AM >Subject: [BioC] Problems in retrieving 3'UTR sequences of ALL human genes using biomaRt > > >Dear Members, > >I am trying to download the 3'UTR sequences of all human genes from Ensembl >Biomart using the package biomaRt. Ideally, after retrieving I want to save >these in FASTA format. When I am using the code given below to get 3'UTRs >of genes in chromosome 1, 2 and 3 (not sure if this is the best way to >achieve what I want), I am getting an error: > >"Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = >"chromosome_name",� : >� Query ERROR: caught BioMart::Exception::Database: Could not connect to >mysql database ensembl_mart_67a: DBI >connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca;port=3306' ,'bm_web',...) >failed: Too many connections at /srv/biomart_server/ >biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98" > >Code is given below: > >> library(biomaRt) >> ensembl=useMart("ensembl") >> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) >> chrom=c(1,2,3) >> getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", >values = chrom, mart = ensembl) >Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = >"chromosome_name",� : >� Query ERROR: caught BioMart::Exception::Database: Could not connect to >mysql database ensembl_mart_67a: DBI >connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca;port=3306' ,'bm_web',...) >failed: Too many connections at /srv/biomart_server/ >biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98 > >*SessionInfo is given below:* >* > >* >> sessionInfo() >R version 2.15.0 (2012-03-30) >Platform: i386-pc-mingw32/i386 (32-bit) > >locale: >[1] LC_COLLATE=English_India.1252� LC_CTYPE=English_India.1252 >LC_MONETARY=English_India.1252 LC_NUMERIC=C >[5] LC_TIME=English_India.1252 > >attached base packages: >[1] stats� � graphics� grDevices utils� � datasets� methods� base > >other attached packages: >[1] biomaRt_2.12.0 > >loaded via a namespace (and not attached): >[1] RCurl_1.91-1.1 XML_3.9-1.1 > > >Can somebody please tell me where I am going wrong? > >Thanks a lot, > >Regards, > >Kart > >��� [[alternative HTML version deleted]] > >_______________________________________________ >Bioconductor mailing list >Bioconductor@r-project.org >https://stat.ethz.ch/mailman/listinfo/bioconductor >Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor > > > - [[alternative HTML version deleted]]
ADD REPLYlink written 6.2 years ago by Tim Smith1.0k
Dear members, I'm using ggbio to get some coverage plot for bam files and I did: > autoplot(bamfile, which=genesymbol["IFIH1"],method = "raw") reading in as Bamfile Error in .local(data, ...) : method 'raw' require which argument It seems the "which" argument doesn't work and I checked the "genesymbol["IFIH1"]" as follows: > genesymbol["IFIH1"] GRanges with 1 range and 2 elementMetadata cols: seqnames ranges strand | symbol ensembl_id <rle> <iranges> <rle> |<character> <character> IFIH1 chr2 [163123590, 163175039] - | IFIH1 ENSG00000115267 --- seqlengths: chr1 chr10 ... chrY NA NA ... NA > class(genesymbol["IFIH1"]) [1] "GRanges" attr(,"package") [1] "GenomicRanges" Does anyone have a solution? Many thanks, Xin
ADD REPLYlink written 6.2 years ago by Xin Yang30
Hi Xin, Could you please sent me your sessionInfo(). btw: You can try to install the dev-version of ggbio(by running 'useDevel(TRUE)' in R 2.15 and update ggbio), to see if your problem has been fixed or not. Thanks a lot. Tengfei On Mon, Jul 23, 2012 at 6:35 AM, Xin Yang <xin.yang@cimr.cam.ac.uk> wrote: > Dear members, > > I'm using ggbio to get some coverage plot for bam files and I did: > > autoplot(bamfile, which=genesymbol["IFIH1"],**method = "raw") >> > > reading in as Bamfile > > Error in .local(data, ...) : method 'raw' require which argument > > > It seems the "which" argument doesn't work and I checked the > "genesymbol["IFIH1"]" as follows: > > genesymbol["IFIH1"] >> > > GRanges with 1 range and 2 elementMetadata cols: > > seqnames ranges strand | symbol > ensembl_id > > <rle> <iranges> <rle> |<character> > <character> > > IFIH1 chr2 [163123590, 163175039] - | IFIH1 > ENSG00000115267 > > --- > > seqlengths: > > chr1 chr10 ... chrY > > NA NA ... NA > > class(genesymbol["IFIH1"]) >> > > [1] "GRanges" > > attr(,"package") > > [1] "GenomicRanges" > > > Does anyone have a solution? > Many thanks, > > Xin > > ______________________________**_________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/**listinfo/bioconductor<https: stat.et="" hz.ch="" mailman="" listinfo="" bioconductor=""> > Search the archives: http://news.gmane.org/gmane.** > science.biology.informatics.**conductor<http: news.gmane.org="" gmane.="" science.biology.informatics.conductor=""> > -- Tengfei Yin MCDB PhD student 1620 Howe Hall, 2274, Iowa State University Ames, IA,50011-2274 Homepage: www.tengfei.name [[alternative HTML version deleted]]
ADD REPLYlink written 6.2 years ago by Tengfei Yin420
Hi Tengfei, Thanks a lot for your reply. Here is my session Info(): > sessionInfo() R version 2.15.0 (2012-03-30) Platform: x86_64-pc-linux-gnu (64-bit) locale: [1] LC_CTYPE=en_GB.UTF-8 LC_NUMERIC=C [3] LC_TIME=en_GB.UTF-8 LC_COLLATE=en_GB.UTF-8 [5] LC_MONETARY=en_GB.UTF-8 LC_MESSAGES=en_GB.UTF-8 [7] LC_PAPER=C LC_NAME=C [9] LC_ADDRESS=C LC_TELEPHONE=C [11] LC_MEASUREMENT=en_GB.UTF-8 LC_IDENTIFICATION=C attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] BiocInstaller_1.5.12 BSgenome.Hsapiens.UCSC.hg19_1.3.17 [3] BSgenome_1.25.3 Rsamtools_1.9.24 [5] Biostrings_2.25.8 GenomicRanges_1.9.39 [7] IRanges_1.15.24 BiocGenerics_0.3.0 [9] ggbio_1.5.10 ggplot2_0.9.1 loaded via a namespace (and not attached): [1] AnnotationDbi_1.19.28 Biobase_2.17.6 biomaRt_2.13.1 [4] biovizBase_1.5.6 bitops_1.0-4.1 cluster_1.14.2 [7] colorspace_1.1-1 DBI_0.2-5 dichromat_1.2-4 [10] digest_0.5.2 GenomicFeatures_1.9.28 grid_2.15.0 [13] gridExtra_0.9 Hmisc_3.9-3 labeling_0.1 [16] lattice_0.20-6 MASS_7.3-18 Matrix_1.0-6 [19] memoise_0.1 munsell_0.3 plyr_1.7.1 [22] proto_0.3-9.2 RColorBrewer_1.0-5 RCurl_1.91-1 [25] reshape2_1.2.1 RSQLite_0.11.1 rtracklayer_1.17.13 [28] scales_0.2.1 snpStats_1.7.3 splines_2.15.0 [31] stats4_2.15.0 stringr_0.6 survival_2.36-14 [34] tcltk_2.15.0 tools_2.15.0 VariantAnnotation_1.3.16 [37] XML_3.9-4 zlibbioc_1.3.0 When I installed the package, actually there were some warnings that might matter...? >useDevel(TRUE) > source("http://bioconductor.org/biocLite.R") > biocLite("ggbio") BioC_mirror: http://bioconductor.org Using R version 2.15, BiocInstaller version 1.5.12. Installing package(s) 'ggbio' trying URL 'http://bioconductor.org/packages/2.11/bioc/src/contrib/ggb io_1.5.10.tar.gz' Content type 'application/x-gzip' length 5820717 bytes (5.6 Mb) opened URL ================================================== downloaded 5.6 Mb * installing *source* package 'ggbio' ... ** R ** inst ** preparing package for lazy loading Warning: No function found corresponding to methods exports from 'GenomicFeatures' for: 'seqnameStyle' Warning: found methods to import for function 'append' but not the generic itself Warning: found methods to import for function 'IQR' but not the generic itself Warning: found methods to import for function 'as.table' but not the generic itself Creating a new generic function for 'rescale' in package 'ggbio' Creating a generic function for 'summary' from package 'base' in package 'ggbio' Creating a generic function for 'print' from package 'base' in package 'ggbio' Creating a new generic function for 'xlim' in package 'ggbio' Creating a generic function for 'update' from package 'stats' in package 'ggbio' Creating a new generic function for 'geom_rect' in package 'ggbio' Creating a new generic function for 'geom_segment' in package 'ggbio' Creating a new generic function for 'geom_bar' in package 'ggbio' Creating a new generic function for 'stat_identity' in package 'ggbio' Creating a new generic function for 'stat_bin' in package 'ggbio' Warning in FUN(X[[1L]], ...) : Created a package name, '2012-07-23 17:11:45', when none found ** help *** installing help indices ** building package indices ** installing vignettes 'Manhattan.Rnw' 'autoplot.Rnw' 'chip-seq.Rnw' 'circular.Rnw' 'ideogram.Rnw' 'intro.Rnw' 'karyogram.Rnw' 'mismatch.Rnw' 'rangeslinkedtodata.Rnw' 'tracks.Rnw' 'txdb.Rnw' ** testing if installed package can be loaded Warning: No function found corresponding to methods exports from 'GenomicFeatures' for: 'seqnameStyle' Warning: found methods to import for function 'as.list' but not the generic itself Warning: found methods to import for function 'aggregate' but not the generic itself Warning: found methods to import for function 'as.table' but not the generic itself Warning: found methods to import for function 'complete.cases' but not the generic itself Warning: found methods to import for function 'cor' but not the generic itself Warning: found methods to import for function 'append' but not the generic itself Warning: found methods to import for function 'as.data.frame' but not the generic itself Warning: found methods to import for function 'as.list' but not the generic itself * DONE (ggbio) The downloaded source packages are in '/tmp/RtmpLWEw0M/downloaded_packages' Warning message: installed directory not writeable, cannot offer to update old packages 'boot', 'class', 'KernSmooth', 'MASS', 'mgcv', 'nnet', 'rpart', 'spatial' And the problem is still there. Many thanks, Xin On 23/07/12 16:28, Tengfei Yin wrote: > Hi Xin, > > Could you please sent me your sessionInfo(). > > btw: You can try to install the dev-version of ggbio(by running > 'useDevel(TRUE)' in R 2.15 and update ggbio), to see if your problem > has been fixed or not. > > Thanks a lot. > > Tengfei > > > > On Mon, Jul 23, 2012 at 6:35 AM, Xin Yang <xin.yang@cimr.cam.ac.uk> <mailto:xin.yang@cimr.cam.ac.uk>> wrote: > > Dear members, > > I'm using ggbio to get some coverage plot for bam files and I did: > > autoplot(bamfile, which=genesymbol["IFIH1"],method = "raw") > > > reading in as Bamfile > > Error in .local(data, ...) : method 'raw' require which argument > > > It seems the "which" argument doesn't work and I checked the > "genesymbol["IFIH1"]" as follows: > > genesymbol["IFIH1"] > > > GRanges with 1 range and 2 elementMetadata cols: > > seqnames ranges strand | symbol > ensembl_id > > <rle> <iranges> <rle> |<character> <character> > > IFIH1 chr2 [163123590, 163175039] - | IFIH1 > ENSG00000115267 > > --- > > seqlengths: > > chr1 chr10 ... > chrY > > NA NA ... > NA > > class(genesymbol["IFIH1"]) > > > [1] "GRanges" > > attr(,"package") > > [1] "GenomicRanges" > > > Does anyone have a solution? > Many thanks, > > Xin > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org <mailto:bioconductor@r-project.org> > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > > > -- > Tengfei Yin > MCDB PhD student > 1620 Howe Hall, 2274, > Iowa State University > Ames, IA,50011-2274 > Homepage: www.tengfei.name <http: www.tengfei.name=""> > > [[alternative HTML version deleted]]
ADD REPLYlink written 6.2 years ago by Xin Yang30
Hi Xin, This works on my bamfile samples, it's probably sample dependent, could be a bug in the package, would you mind try runing autoplot(BamFile(bamfile), which=genesymbol["IFIH1"],method = "raw") and library(Rsamtools) length(biovizBase:::fetch(BamFile(bamfile), which = genesymbol["IFIH1"])) to see what happened? Thanks a lot. Tengfei On Mon, Jul 23, 2012 at 9:17 AM, Xin Yang <xin.yang@cimr.cam.ac.uk> wrote: > Hi Tengfei, > > Thanks a lot for your reply. > > Here is my session Info(): > > > sessionInfo() > > R version 2.15.0 (2012-03-30) > > Platform: x86_64-pc-linux-gnu (64-bit) > > locale: > > [1] LC_CTYPE=en_GB.UTF-8 LC_NUMERIC=C > > [3] LC_TIME=en_GB.UTF-8 LC_COLLATE=en_GB.UTF-8 > > [5] LC_MONETARY=en_GB.UTF-8 LC_MESSAGES=en_GB.UTF-8 > > [7] LC_PAPER=C LC_NAME=C > > [9] LC_ADDRESS=C LC_TELEPHONE=C > > [11] LC_MEASUREMENT=en_GB.UTF-8 LC_IDENTIFICATION=C > > attached base packages: > > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > > [1] BiocInstaller_1.5.12 BSgenome.Hsapiens.UCSC.hg19_1.3.17 > > [3] BSgenome_1.25.3 Rsamtools_1.9.24 > > [5] Biostrings_2.25.8 GenomicRanges_1.9.39 > > [7] IRanges_1.15.24 BiocGenerics_0.3.0 > > [9] ggbio_1.5.10 ggplot2_0.9.1 > > loaded via a namespace (and not attached): > > [1] AnnotationDbi_1.19.28 Biobase_2.17.6 biomaRt_2.13.1 > > [4] biovizBase_1.5.6 bitops_1.0-4.1 cluster_1.14.2 > > [7] colorspace_1.1-1 DBI_0.2-5 dichromat_1.2-4 > > [10] digest_0.5.2 GenomicFeatures_1.9.28 grid_2.15.0 > > [13] gridExtra_0.9 Hmisc_3.9-3 labeling_0.1 > > [16] lattice_0.20-6 MASS_7.3-18 Matrix_1.0-6 > > [19] memoise_0.1 munsell_0.3 plyr_1.7.1 > > [22] proto_0.3-9.2 RColorBrewer_1.0-5 RCurl_1.91-1 > > [25] reshape2_1.2.1 RSQLite_0.11.1 rtracklayer_1.17.13 > > [28] scales_0.2.1 snpStats_1.7.3 splines_2.15.0 > > [31] stats4_2.15.0 stringr_0.6 survival_2.36-14 > > [34] tcltk_2.15.0 tools_2.15.0 VariantAnnotation_1.3.16 > > [37] XML_3.9-4 zlibbioc_1.3.0 > > When I installed the package, actually there were some warnings that > might matter...? > > >useDevel(TRUE) > > > source("http://bioconductor.org/biocLite.R" <http: bioconductor.org="" bioclite.r="">) > > > biocLite("ggbio") > > BioC_mirror: http://bioconductor.org > > Using R version 2.15, BiocInstaller version 1.5.12. > > Installing package(s) 'ggbio' > > trying URL 'http://bioconductor.org/packages/2.11/bioc/src/contrib/g gbio_1.5.10.tar.gz' > > Content type 'application/x-gzip' length 5820717 bytes (5.6 Mb) > > opened URL > > ================================================== > > downloaded 5.6 Mb > > * installing *source* package ‘ggbio’ ... > > ** R > > ** inst > > ** preparing package for lazy loading > > Warning: No function found corresponding to methods exports from ‘GenomicFeatures’ for: ‘seqnameStyle’ > > Warning: found methods to import for function ‘append’ but not the generic itself > > Warning: found methods to import for function ‘IQR’ but not the generic itself > > Warning: found methods to import for function ‘as.table’ but not the generic itself > > Creating a new generic function for ‘rescale’ in package ‘ggbio’ > > Creating a generic function for ‘summary’ from package ‘base’ in package ‘ggbio’ > > Creating a generic function for ‘print’ from package ‘base’ in package ‘ggbio’ > > Creating a new generic function for ‘xlim’ in package ‘ggbio’ > > Creating a generic function for ‘update’ from package ‘stats’ in package ‘ggbio’ > > Creating a new generic function for ‘geom_rect’ in package ‘ggbio’ > > Creating a new generic function for ‘geom_segment’ in package ‘ggbio’ > > Creating a new generic function for ‘geom_bar’ in package ‘ggbio’ > > Creating a new generic function for ‘stat_identity’ in package ‘ggbio’ > > Creating a new generic function for ‘stat_bin’ in package ‘ggbio’ > > Warning in FUN(X[[1L]], ...) : > > Created a package name, ‘2012-07-23 17:11:45’, when none found > > ** help > > *** installing help indices > > ** building package indices > > ** installing vignettes > > ‘Manhattan.Rnw’ > > ‘autoplot.Rnw’ > > ‘chip-seq.Rnw’ > > ‘circular.Rnw’ > > ‘ideogram.Rnw’ > > ‘intro.Rnw’ > > ‘karyogram.Rnw’ > > ‘mismatch.Rnw’ > > ‘rangeslinkedtodata.Rnw’ > > ‘tracks.Rnw’ > > ‘txdb.Rnw’ > > ** testing if installed package can be loaded > > Warning: No function found corresponding to methods exports from ‘GenomicFeatures’ for: ‘seqnameStyle’ > > Warning: found methods to import for function ‘as.list’ but not the generic itself > > Warning: found methods to import for function ‘aggregate’ but not the generic itself > > Warning: found methods to import for function ‘as.table’ but not the generic itself > > Warning: found methods to import for function ‘complete.cases’ but not the generic itself > > Warning: found methods to import for function ‘cor’ but not the generic itself > > Warning: found methods to import for function ‘append’ but not the generic itself > > Warning: found methods to import for function ‘as.data.frame’ but not the generic itself > > Warning: found methods to import for function ‘as.list’ but not the generic itself > > * DONE (ggbio) > > The downloaded source packages are in > > ‘/tmp/RtmpLWEw0M/downloaded_packages’ > > Warning message: > > installed directory not writeable, cannot offer to update old packages 'boot', > > 'class', 'KernSmooth', 'MASS', 'mgcv', 'nnet', 'rpart', 'spatial' > > And the problem is still there. > > Many thanks, > Xin > > > On 23/07/12 16:28, Tengfei Yin wrote: > > Hi Xin, > > Could you please sent me your sessionInfo(). > > btw: You can try to install the dev-version of ggbio(by running 'useDevel(TRUE)' > in R 2.15 and update ggbio), to see if your problem has been fixed or not. > > Thanks a lot. > > Tengfei > > > > On Mon, Jul 23, 2012 at 6:35 AM, Xin Yang <xin.yang@cimr.cam.ac.uk> wrote: > >> Dear members, >> >> I'm using ggbio to get some coverage plot for bam files and I did: >> >> autoplot(bamfile, which=genesymbol["IFIH1"],method = "raw") >>> >> >> reading in as Bamfile >> >> Error in .local(data, ...) : method 'raw' require which argument >> >> >> It seems the "which" argument doesn't work and I checked the >> "genesymbol["IFIH1"]" as follows: >> >> genesymbol["IFIH1"] >>> >> >> GRanges with 1 range and 2 elementMetadata cols: >> >> seqnames ranges strand | symbol >> ensembl_id >> >> <rle> <iranges> <rle> |<character> >> <character> >> >> IFIH1 chr2 [163123590, 163175039] - | IFIH1 >> ENSG00000115267 >> >> --- >> >> seqlengths: >> >> chr1 chr10 ... chrY >> >> NA NA ... NA >> >> class(genesymbol["IFIH1"]) >>> >> >> [1] "GRanges" >> >> attr(,"package") >> >> [1] "GenomicRanges" >> >> >> Does anyone have a solution? >> Many thanks, >> >> Xin >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor@r-project.org >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor >> > > > > -- > Tengfei Yin > MCDB PhD student > 1620 Howe Hall, 2274, > Iowa State University > Ames, IA,50011-2274 > Homepage: www.tengfei.name > > > > -- Tengfei Yin MCDB PhD student 1620 Howe Hall, 2274, Iowa State University Ames, IA,50011-2274 Homepage: www.tengfei.name [[alternative HTML version deleted]]
ADD REPLYlink written 6.2 years ago by Tengfei Yin420
Hi Tengfei, Thanks a lot! autoplot(BamFile(bamfile), which=genesymbol["IFIH1"],method = "raw") generated the plot successfully , while library(Rsamtools) length(biovizBase:::fetch(BamFile(bamfile), which = genesymbol["IFIH1"])) yields no plot. Besides, may I ask whether ggbio can plot gtf file? I saw in the geom_alignment, you simulated a GRanges object, is there a way to plot gtf file automatically like autoplot? I saw in your website homepage: http://tengfei.github.com/ggbio/, there is a very nice track figure (figure5, see attachment please) and I like it very much. May I ask how you did it? If you could share the codes, it would be fantastic! Many thanks for your help!!! Xin On 23/07/12 18:01, Tengfei Yin wrote: > Hi Xin, > > This works on my bamfile samples, it's probably sample dependent, > could be a bug in the package, would you mind try runing > autoplot(BamFile(bamfile), which=genesymbol["IFIH1"],method = "raw") > > and > > library(Rsamtools) > length(biovizBase:::fetch(BamFile(bamfile), which = genesymbol["IFIH1"])) > > to see what happened? > > Thanks a lot. > > Tengfei > > > On Mon, Jul 23, 2012 at 9:17 AM, Xin Yang <xin.yang at="" cimr.cam.ac.uk=""> <mailto:xin.yang at="" cimr.cam.ac.uk="">> wrote: > > Hi Tengfei, > > Thanks a lot for your reply. > > Here is my session Info(): > > > sessionInfo() > > R version 2.15.0 (2012-03-30) > > Platform: x86_64-pc-linux-gnu (64-bit) > > locale: > > [1] LC_CTYPE=en_GB.UTF-8 LC_NUMERIC=C > > [3] LC_TIME=en_GB.UTF-8 LC_COLLATE=en_GB.UTF-8 > > [5] LC_MONETARY=en_GB.UTF-8 LC_MESSAGES=en_GB.UTF-8 > > [7] LC_PAPER=C LC_NAME=C > > [9] LC_ADDRESS=C LC_TELEPHONE=C > > [11] LC_MEASUREMENT=en_GB.UTF-8 LC_IDENTIFICATION=C > > attached base packages: > > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > > [1] BiocInstaller_1.5.12 BSgenome.Hsapiens.UCSC.hg19_1.3.17 > > [3] BSgenome_1.25.3 Rsamtools_1.9.24 > > [5] Biostrings_2.25.8 GenomicRanges_1.9.39 > > [7] IRanges_1.15.24 BiocGenerics_0.3.0 > > [9] ggbio_1.5.10 ggplot2_0.9.1 > > loaded via a namespace (and not attached): > > [1] AnnotationDbi_1.19.28 Biobase_2.17.6 biomaRt_2.13.1 > > [4] biovizBase_1.5.6 bitops_1.0-4.1 cluster_1.14.2 > > [7] colorspace_1.1-1 DBI_0.2-5 dichromat_1.2-4 > > [10] digest_0.5.2 GenomicFeatures_1.9.28 grid_2.15.0 > > [13] gridExtra_0.9 Hmisc_3.9-3 labeling_0.1 > > [16] lattice_0.20-6 MASS_7.3-18 Matrix_1.0-6 > > [19] memoise_0.1 munsell_0.3 plyr_1.7.1 > > [22] proto_0.3-9.2 RColorBrewer_1.0-5 RCurl_1.91-1 > > [25] reshape2_1.2.1 RSQLite_0.11.1 rtracklayer_1.17.13 > > [28] scales_0.2.1 snpStats_1.7.3 splines_2.15.0 > > [31] stats4_2.15.0 stringr_0.6 survival_2.36-14 > > [34] tcltk_2.15.0 tools_2.15.0 VariantAnnotation_1.3.16 > > [37] XML_3.9-4 zlibbioc_1.3.0 > > When I installed the package, actually there were some warnings > that might matter...? > > >useDevel(TRUE) > > > source("http://bioconductor.org/biocLite.R" <http: bioconductor.org="" bioclite.r="">) > > > biocLite("ggbio") > > BioC_mirror:http://bioconductor.org > > Using R version 2.15, BiocInstaller version 1.5.12. > > Installing package(s) 'ggbio' > > trying URL 'http://bioconductor.org/packages/2.11/bioc/src/contr ib/ggbio_1.5.10.tar.gz' > > Content type 'application/x-gzip' length 5820717 bytes (5.6 Mb) > > opened URL > > ================================================== > > downloaded 5.6 Mb > > * installing *source* package ?ggbio? ... > > ** R > > ** inst > > ** preparing package for lazy loading > > Warning: No function found corresponding to methods exports from ?GenomicFeatures? for: ?seqnameStyle? > > Warning: found methods to import for function ?append? but not the generic itself > > Warning: found methods to import for function ?IQR? but not the generic itself > > Warning: found methods to import for function ?as.table? but not the generic itself > > Creating a new generic function for ?rescale? in package ?ggbio? > > Creating a generic function for ?summary? from package ?base? in package ?ggbio? > > Creating a generic function for ?print? from package ?base? in package ?ggbio? > > Creating a new generic function for ?xlim? in package ?ggbio? > > Creating a generic function for ?update? from package ?stats? in package ?ggbio? > > Creating a new generic function for ?geom_rect? in package ?ggbio? > > Creating a new generic function for ?geom_segment? in package ?ggbio? > > Creating a new generic function for ?geom_bar? in package ?ggbio? > > Creating a new generic function for ?stat_identity? in package ?ggbio? > > Creating a new generic function for ?stat_bin? in package ?ggbio? > > Warning in FUN(X[[1L]], ...) : > > Created a package name, ?2012-07-23 17:11:45?, when none found > > ** help > > *** installing help indices > > ** building package indices > > ** installing vignettes > > ?Manhattan.Rnw? > > ?autoplot.Rnw? > > ?chip-seq.Rnw? > > ?circular.Rnw? > > ?ideogram.Rnw? > > ?intro.Rnw? > > ?karyogram.Rnw? > > ?mismatch.Rnw? > > ?rangeslinkedtodata.Rnw? > > ?tracks.Rnw? > > ?txdb.Rnw? > > ** testing if installed package can be loaded > > Warning: No function found corresponding to methods exports from ?GenomicFeatures? for: ?seqnameStyle? > > Warning: found methods to import for function ?as.list? but not the generic itself > > Warning: found methods to import for function ?aggregate? but not the generic itself > > Warning: found methods to import for function ?as.table? but not the generic itself > > Warning: found methods to import for function ?complete.cases? but not the generic itself > > Warning: found methods to import for function ?cor? but not the generic itself > > Warning: found methods to import for function ?append? but not the generic itself > > Warning: found methods to import for function ?as.data.frame? but not the generic itself > > Warning: found methods to import for function ?as.list? but not the generic itself > > * DONE (ggbio) > > The downloaded source packages are in > > ?/tmp/RtmpLWEw0M/downloaded_packages? > > Warning message: > > installed directory not writeable, cannot offer to update old packages 'boot', > > 'class', 'KernSmooth', 'MASS', 'mgcv', 'nnet', 'rpart', 'spatial' > > And the problem is still there. > > Many thanks, > Xin > > > On 23/07/12 16:28, Tengfei Yin wrote: >> Hi Xin, >> >> Could you please sent me your sessionInfo(). >> >> btw: You can try to install the dev-version of ggbio(by running >> 'useDevel(TRUE)' in R 2.15 and update ggbio), to see if your >> problem has been fixed or not. >> >> Thanks a lot. >> >> Tengfei >> >> >> >> On Mon, Jul 23, 2012 at 6:35 AM, Xin Yang >> <xin.yang at="" cimr.cam.ac.uk="" <mailto:xin.yang="" at="" cimr.cam.ac.uk="">> wrote: >> >> Dear members, >> >> I'm using ggbio to get some coverage plot for bam files and I >> did: >> >> autoplot(bamfile, which=genesymbol["IFIH1"],method = "raw") >> >> >> reading in as Bamfile >> >> Error in .local(data, ...) : method 'raw' require which argument >> >> >> It seems the "which" argument doesn't work and I checked the >> "genesymbol["IFIH1"]" as follows: >> >> genesymbol["IFIH1"] >> >> >> GRanges with 1 range and 2 elementMetadata cols: >> >> seqnames ranges strand | symbol >> ensembl_id >> >> <rle> <iranges> <rle> |<character> <character> >> >> IFIH1 chr2 [163123590, 163175039] - | IFIH1 >> ENSG00000115267 >> >> --- >> >> seqlengths: >> >> chr1 chr10 ... >> chrY >> >> NA NA ... >> NA >> >> class(genesymbol["IFIH1"]) >> >> >> [1] "GRanges" >> >> attr(,"package") >> >> [1] "GenomicRanges" >> >> >> Does anyone have a solution? >> Many thanks, >> >> Xin >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at r-project.org <mailto:bioconductor at="" r-project.org=""> >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> >> >> >> -- >> Tengfei Yin >> MCDB PhD student >> 1620 Howe Hall, 2274, >> Iowa State University >> Ames, IA,50011-2274 >> Homepage: www.tengfei.name <http: www.tengfei.name=""> >> >> > > > > > -- > Tengfei Yin > MCDB PhD student > 1620 Howe Hall, 2274, > Iowa State University > Ames, IA,50011-2274 > Homepage: www.tengfei.name <http: www.tengfei.name=""> > > -- Xin Yang JDRF/WT Diabetes and Inflammation Laboratory NIHR Cambridge Biomedical Research Centre Cambridge Institute for Medical Research, University of Cambridge Wellcome Trust/MRC Building, Addenbrooke's Hospital, Cambridge, CB2 0XY Tel: 44 (0)1223 763222 Email: xy249 at cam.ac.uk Website: http://www-gene.cimr.cam.ac.uk/ -------------- next part -------------- A non-text attachment was scrubbed... Name: tracks.png Type: image/png Size: 43587 bytes Desc: not available URL: <https: stat.ethz.ch="" pipermail="" bioconductor="" attachments="" 20120724="" 373594fa="" attachment.png="">
ADD REPLYlink written 6.2 years ago by Xin Yang30
On Tue, Jul 24, 2012 at 3:19 AM, Xin Yang <xin.yang@cimr.cam.ac.uk> wrote: > Hi Tengfei, > > Thanks a lot! > > > autoplot(BamFile(bamfile), which=genesymbol["IFIH1"],method = "raw") > generated the plot successfully , while > > > library(Rsamtools) > length(biovizBase:::fetch(BamFile(bamfile), which = genesymbol["IFIH1"])) > > yields no plot. > > Besides, may I ask whether ggbio can plot gtf file? I saw in the > geom_alignment, you simulated a GRanges object, is there a way to plot gtf > file automatically like autoplot? > > yes, autoplot support character which is your file path, currently support .bam file and other files rtracklayer support, such as gtf and bed, it's internally use import to import those file as GRanges and plot them. By default for character, it tries to use 'score' as y automatically, and a 'which' argument is recommended if your file is too large. So you could run autoplot("you_file_path.gtf", which = GRanges("chr1", IRanges(range_start, range_end)), color = "gray70") - The color argument is required now for dev-branch, it make sure single position are shown in the plot, (ggplot2 default is that the rectangle border is transparent). - Since your code doesn't work for character .bam file, (I am trying to find out why currently), there is a chance the 'which' argument doesn't work properly in this case too, in that case, use import function in package rtracklayer to import gtf as GRanges object, make sure you use asRangedData = FALSE in your import., then just autoplot this GRanges data set. > I saw in your website homepage: http://tengfei.github.com/ggbio/, there > is a very nice track figure (figure5, see attachment please) and I like it > very much. May I ask how you did it? If you could share the codes, it would > be fantastic! > around 10 vignettes are added to dev-branch of ggbio, please run browseVignettes(package = "ggbio") and read following 4 tutorials: Get and plot ideogram(make top ideogram track) How to visualize genomic features from TranscriptDb object.(build genomic features as bottom track) Buidling tracks(more features added to make tracks) Case study: visualize chip-seq data The vignette will be refined gradually before next release of bioconductor. Please feel free to report any bug or feature request to me. Thanks a lot Tengfei > Many thanks for your help!!! > Xin > > > On 23/07/12 18:01, Tengfei Yin wrote: > > Hi Xin, > > This works on my bamfile samples, it's probably sample dependent, could > be a bug in the package, would you mind try runing > autoplot(BamFile(bamfile), which=genesymbol["IFIH1"],method = "raw") > > and > > library(Rsamtools) > length(biovizBase:::fetch(BamFile(bamfile), which = genesymbol["IFIH1"])) > > to see what happened? > > Thanks a lot. > > Tengfei > > > On Mon, Jul 23, 2012 at 9:17 AM, Xin Yang <xin.yang@cimr.cam.ac.uk> wrote: > >> Hi Tengfei, >> >> Thanks a lot for your reply. >> >> Here is my session Info(): >> >> > sessionInfo() >> >> R version 2.15.0 (2012-03-30) >> >> Platform: x86_64-pc-linux-gnu (64-bit) >> >> locale: >> >> [1] LC_CTYPE=en_GB.UTF-8 LC_NUMERIC=C >> >> [3] LC_TIME=en_GB.UTF-8 LC_COLLATE=en_GB.UTF-8 >> >> [5] LC_MONETARY=en_GB.UTF-8 LC_MESSAGES=en_GB.UTF-8 >> >> [7] LC_PAPER=C LC_NAME=C >> >> [9] LC_ADDRESS=C LC_TELEPHONE=C >> >> [11] LC_MEASUREMENT=en_GB.UTF-8 LC_IDENTIFICATION=C >> >> attached base packages: >> >> [1] stats graphics grDevices utils datasets methods base >> >> other attached packages: >> >> [1] BiocInstaller_1.5.12 BSgenome.Hsapiens.UCSC.hg19_1.3.17 >> >> [3] BSgenome_1.25.3 Rsamtools_1.9.24 >> >> [5] Biostrings_2.25.8 GenomicRanges_1.9.39 >> >> [7] IRanges_1.15.24 BiocGenerics_0.3.0 >> >> [9] ggbio_1.5.10 ggplot2_0.9.1 >> >> loaded via a namespace (and not attached): >> >> [1] AnnotationDbi_1.19.28 Biobase_2.17.6 biomaRt_2.13.1 >> >> [4] biovizBase_1.5.6 bitops_1.0-4.1 cluster_1.14.2 >> >> [7] colorspace_1.1-1 DBI_0.2-5 dichromat_1.2-4 >> >> [10] digest_0.5.2 GenomicFeatures_1.9.28 grid_2.15.0 >> >> [13] gridExtra_0.9 Hmisc_3.9-3 labeling_0.1 >> >> [16] lattice_0.20-6 MASS_7.3-18 Matrix_1.0-6 >> >> [19] memoise_0.1 munsell_0.3 plyr_1.7.1 >> >> [22] proto_0.3-9.2 RColorBrewer_1.0-5 RCurl_1.91-1 >> >> [25] reshape2_1.2.1 RSQLite_0.11.1 rtracklayer_1.17.13 >> >> [28] scales_0.2.1 snpStats_1.7.3 splines_2.15.0 >> >> [31] stats4_2.15.0 stringr_0.6 survival_2.36-14 >> >> [34] tcltk_2.15.0 tools_2.15.0 VariantAnnotation_1.3.16 >> >> [37] XML_3.9-4 zlibbioc_1.3.0 >> >> When I installed the package, actually there were some warnings that >> might matter...? >> >> >useDevel(TRUE) >> >> > source("http://bioconductor.org/biocLite.R" <http: bioconductor.org="" bioclite.r="">) >> >> > biocLite("ggbio") >> >> BioC_mirror: http://bioconductor.org >> >> Using R version 2.15, BiocInstaller version 1.5.12. >> >> Installing package(s) 'ggbio' >> >> trying URL 'http://bioconductor.org/packages/2.11/bioc/src/contrib/ ggbio_1.5.10.tar.gz' >> >> Content type 'application/x-gzip' length 5820717 bytes (5.6 Mb) >> >> opened URL >> >> ================================================== >> >> downloaded 5.6 Mb >> >> * installing *source* package ‘ggbio’ ... >> >> ** R >> >> ** inst >> >> ** preparing package for lazy loading >> >> Warning: No function found corresponding to methods exports from ‘GenomicFeatures’ for: ‘seqnameStyle’ >> >> Warning: found methods to import for function ‘append’ but not the generic itself >> >> Warning: found methods to import for function ‘IQR’ but not the generic itself >> >> Warning: found methods to import for function ‘as.table’ but not the generic itself >> >> Creating a new generic function for ‘rescale’ in package ‘ggbio’ >> >> Creating a generic function for ‘summary’ from package ‘base’ in package ‘ggbio’ >> >> Creating a generic function for ‘print’ from package ‘base’ in package ‘ggbio’ >> >> Creating a new generic function for ‘xlim’ in package ‘ggbio’ >> >> Creating a generic function for ‘update’ from package ‘stats’ in package ‘ggbio’ >> >> Creating a new generic function for ‘geom_rect’ in package ‘ggbio’ >> >> Creating a new generic function for ‘geom_segment’ in package ‘ggbio’ >> >> Creating a new generic function for ‘geom_bar’ in package ‘ggbio’ >> >> Creating a new generic function for ‘stat_identity’ in package ‘ggbio’ >> >> Creating a new generic function for ‘stat_bin’ in package ‘ggbio’ >> >> Warning in FUN(X[[1L]], ...) : >> >> Created a package name, ‘2012-07-23 17:11:45’, when none found >> >> ** help >> >> *** installing help indices >> >> ** building package indices >> >> ** installing vignettes >> >> ‘Manhattan.Rnw’ >> >> ‘autoplot.Rnw’ >> >> ‘chip-seq.Rnw’ >> >> ‘circular.Rnw’ >> >> ‘ideogram.Rnw’ >> >> ‘intro.Rnw’ >> >> ‘karyogram.Rnw’ >> >> ‘mismatch.Rnw’ >> >> ‘rangeslinkedtodata.Rnw’ >> >> ‘tracks.Rnw’ >> >> ‘txdb.Rnw’ >> >> ** testing if installed package can be loaded >> >> Warning: No function found corresponding to methods exports from ‘GenomicFeatures’ for: ‘seqnameStyle’ >> >> Warning: found methods to import for function ‘as.list’ but not the generic itself >> >> Warning: found methods to import for function ‘aggregate’ but not the generic itself >> >> Warning: found methods to import for function ‘as.table’ but not the generic itself >> >> Warning: found methods to import for function ‘complete.cases’ but not the generic itself >> >> Warning: found methods to import for function ‘cor’ but not the generic itself >> >> Warning: found methods to import for function ‘append’ but not the generic itself >> >> Warning: found methods to import for function ‘as.data.frame’ but not the generic itself >> >> Warning: found methods to import for function ‘as.list’ but not the generic itself >> >> * DONE (ggbio) >> >> The downloaded source packages are in >> >> ‘/tmp/RtmpLWEw0M/downloaded_packages’ >> >> Warning message: >> >> installed directory not writeable, cannot offer to update old packages 'boot', >> >> 'class', 'KernSmooth', 'MASS', 'mgcv', 'nnet', 'rpart', 'spatial' >> >> And the problem is still there. >> >> Many thanks, >> Xin >> >> >> On 23/07/12 16:28, Tengfei Yin wrote: >> >> Hi Xin, >> >> Could you please sent me your sessionInfo(). >> >> btw: You can try to install the dev-version of ggbio(by running 'useDevel(TRUE)' >> in R 2.15 and update ggbio), to see if your problem has been fixed or >> not. >> >> Thanks a lot. >> >> Tengfei >> >> >> >> On Mon, Jul 23, 2012 at 6:35 AM, Xin Yang <xin.yang@cimr.cam.ac.uk>wrote: >> >>> Dear members, >>> >>> I'm using ggbio to get some coverage plot for bam files and I did: >>> >>> autoplot(bamfile, which=genesymbol["IFIH1"],method = "raw") >>>> >>> >>> reading in as Bamfile >>> >>> Error in .local(data, ...) : method 'raw' require which argument >>> >>> >>> It seems the "which" argument doesn't work and I checked the >>> "genesymbol["IFIH1"]" as follows: >>> >>> genesymbol["IFIH1"] >>>> >>> >>> GRanges with 1 range and 2 elementMetadata cols: >>> >>> seqnames ranges strand | symbol >>> ensembl_id >>> >>> <rle> <iranges> <rle> |<character> >>> <character> >>> >>> IFIH1 chr2 [163123590, 163175039] - | IFIH1 >>> ENSG00000115267 >>> >>> --- >>> >>> seqlengths: >>> >>> chr1 chr10 ... chrY >>> >>> NA NA ... NA >>> >>> class(genesymbol["IFIH1"]) >>>> >>> >>> [1] "GRanges" >>> >>> attr(,"package") >>> >>> [1] "GenomicRanges" >>> >>> >>> Does anyone have a solution? >>> Many thanks, >>> >>> Xin >>> >>> _______________________________________________ >>> Bioconductor mailing list >>> Bioconductor@r-project.org >>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>> Search the archives: >>> http://news.gmane.org/gmane.science.biology.informatics.conductor >>> >> >> >> >> -- >> Tengfei Yin >> MCDB PhD student >> 1620 Howe Hall, 2274, >> Iowa State University >> Ames, IA,50011-2274 >> Homepage: www.tengfei.name >> >> >> >> > > > -- > Tengfei Yin > MCDB PhD student > 1620 Howe Hall, 2274, > Iowa State University > Ames, IA,50011-2274 > Homepage: www.tengfei.name > > > > > -- > Xin Yang > JDRF/WT Diabetes and Inflammation Laboratory > NIHR Cambridge Biomedical Research Centre > Cambridge Institute for Medical Research, University of Cambridge > Wellcome Trust/MRC Building, Addenbrooke's Hospital, Cambridge, CB2 0XY > Tel: 44 (0)1223 763222 > Email: xy249@cam.ac.uk > Website: http://www-gene.cimr.cam.ac.uk/ > > -- Tengfei Yin MCDB PhD student 1620 Howe Hall, 2274, Iowa State University Ames, IA,50011-2274 Homepage: www.tengfei.name [[alternative HTML version deleted]]
ADD REPLYlink written 6.2 years ago by Tengfei Yin420
Hello Tim, I tried your first suggestion (for chromosome 1). I got an error message as shown below: Error in scan(file, what, nmax, sep, dec, quote, skip, nlines, na.strings, : line 2134 did not have 2 elements Did you see something like this at your end? Thanks, Karthik On Mon, Jul 23, 2012 at 5:24 PM, Tim Smith <tim_smith_666@yahoo.com> wrote: > Try: > > chrom <- c(1:22,'X','Y') > > ------------------------------ > *From:* Karthik K N <karthikuttan@gmail.com> > *To:* Tim Smith <tim_smith_666@yahoo.com> > *Cc:* "bioconductor@r-project.org" <bioconductor@r-project.org> > *Sent:* Monday, July 23, 2012 7:46 AM > *Subject:* Re: [BioC] Problems in retrieving 3'UTR sequences of ALL human > genes using biomaRt > > Hello Tim, > > Thanks for the reply. I think this will give the 3'UTRs of all the genes > in chromosome 1. How can I get this for ALL the genes in ALL the chromosome > instead of repeating the step by changing the chromosome number? > > Thanks a lot once again. > > On Mon, Jul 23, 2012 at 5:04 PM, Tim Smith <tim_smith_666@yahoo.com>wrote: > > Seems to work with: > > chrom <- '1' > xx <- getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", > > values = chrom, mart = ensembl) > > ------------------------------ > *From:* Karthik K N <karthikuttan@gmail.com> > *To:* bioconductor@r-project.org > *Sent:* Monday, July 23, 2012 5:02 AM > *Subject:* [BioC] Problems in retrieving 3'UTR sequences of ALL human > genes using biomaRt > > Dear Members, > > I am trying to download the 3'UTR sequences of all human genes from Ensembl > Biomart using the package biomaRt. Ideally, after retrieving I want to save > these in FASTA format. When I am using the code given below to get 3'UTRs > of genes in chromosome 1, 2 and 3 (not sure if this is the best way to > achieve what I want), I am getting an error: > > "Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = > "chromosome_name", : > Query ERROR: caught BioMart::Exception::Database: Could not connect to > mysql database ensembl_mart_67a: DBI > connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca > ;port=3306','bm_web',...) > failed: Too many connections at /srv/biomart_server/ > biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98" > > Code is given below: > > > library(biomaRt) > > ensembl=useMart("ensembl") > > ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) > > chrom=c(1,2,3) > > getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", > values = chrom, mart = ensembl) > Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = > "chromosome_name", : > Query ERROR: caught BioMart::Exception::Database: Could not connect to > mysql database ensembl_mart_67a: DBI > connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca > ;port=3306','bm_web',...) > failed: Too many connections at /srv/biomart_server/ > biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98 > > *SessionInfo is given below:* > * > > * > > sessionInfo() > R version 2.15.0 (2012-03-30) > Platform: i386-pc-mingw32/i386 (32-bit) > > locale: > [1] LC_COLLATE=English_India.1252 LC_CTYPE=English_India.1252 > LC_MONETARY=English_India.1252 LC_NUMERIC=C > [5] LC_TIME=English_India.1252 > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] biomaRt_2.12.0 > > loaded via a namespace (and not attached): > [1] RCurl_1.91-1.1 XML_3.9-1.1 > > > Can somebody please tell me where I am going wrong? > > Thanks a lot, > > Regards, > > Kart > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > > > > - > > > -- Karthik K.N Cancer Discovery Biology Laboratory Division of Molecular Medicine Amrita Center for Nanosciences and Molecular Medicine Amrita Institute of Medical Sciences AIMS-Ponekkara (P.O), Kochi Cochin, Kerala - 682 041 +91-484-280 1234 x 8720 +91-9400193907 [[alternative HTML version deleted]]
ADD REPLYlink written 6.2 years ago by Karthik K N200
Hi Karthik, Alternatively: library(GenomicFeatures) txdb <- makeTranscriptDbFromBiomart("ensembl", "hsapiens_gene_ensembl") three_utrs <- threeUTRsByTranscript(txdb, use.names=TRUE) library(BSgenome.Hsapiens.UCSC.hg19) ## Some gymnastic in order to deal with different chromosome naming ## conventions between Ensembl and UCSC. We only keep the 25 main ## chromosomes (1-22, X, Y, M). seqlevels(three_utrs, force=TRUE) <- seqlevels(three_utrs)[1:25] seqlevels(three_utrs) <- seqlevels(Hsapiens)[1:25] three_utr_seqs <- extractTranscriptsFromGenome(Hsapiens, three_utrs, use.names=TRUE) > head(three_utr_seqs) A DNAStringSet instance of length 6 width seq names [1] 37 ATGATATAATAAGCCCTTCTCATTAAACATGATATGG ENST00000426406 [2] 601 TGTAGTCTGATGTAGTCTCATGT...TATTGCTTTGGATAGTATGGATG ENST00000358533 [3] 422 GGTTGCCGGGGGTAGGGGTGGGG...GAAAAATAAATAATAAAGCCTGT ENST00000342066 [4] 422 GGTTGCCGGGGGTAGGGGTGGGG...GAAAAATAAATAATAAAGCCTGT ENST00000341065 [5] 106 GGTTGCCGGGGGTAGGGGTGGGG...TCTTTCGGTTTCGGATGCAAAAC ENST00000455979 [6] 523 CCCACCTACCACCAGAGGCCTGC...TTAATAAACACATTTCTGGGGTT ENST00000455747 HTH, H. On 07/23/2012 06:56 AM, Karthik K N wrote: > Hello Tim, > > I tried your first suggestion (for chromosome 1). I got an error message as > shown below: > > Error in scan(file, what, nmax, sep, dec, quote, skip, nlines, na.strings, > : > line 2134 did not have 2 elements > > Did you see something like this at your end? > > Thanks, > > Karthik > > > On Mon, Jul 23, 2012 at 5:24 PM, Tim Smith <tim_smith_666 at="" yahoo.com=""> wrote: > >> Try: >> >> chrom <- c(1:22,'X','Y') >> >> ------------------------------ >> *From:* Karthik K N <karthikuttan at="" gmail.com=""> >> *To:* Tim Smith <tim_smith_666 at="" yahoo.com=""> >> *Cc:* "bioconductor at r-project.org" <bioconductor at="" r-project.org=""> >> *Sent:* Monday, July 23, 2012 7:46 AM >> *Subject:* Re: [BioC] Problems in retrieving 3'UTR sequences of ALL human >> genes using biomaRt >> >> Hello Tim, >> >> Thanks for the reply. I think this will give the 3'UTRs of all the genes >> in chromosome 1. How can I get this for ALL the genes in ALL the chromosome >> instead of repeating the step by changing the chromosome number? >> >> Thanks a lot once again. >> >> On Mon, Jul 23, 2012 at 5:04 PM, Tim Smith <tim_smith_666 at="" yahoo.com="">wrote: >> >> Seems to work with: >> >> chrom <- '1' >> xx <- getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", >> >> values = chrom, mart = ensembl) >> >> ------------------------------ >> *From:* Karthik K N <karthikuttan at="" gmail.com=""> >> *To:* bioconductor at r-project.org >> *Sent:* Monday, July 23, 2012 5:02 AM >> *Subject:* [BioC] Problems in retrieving 3'UTR sequences of ALL human >> genes using biomaRt >> >> Dear Members, >> >> I am trying to download the 3'UTR sequences of all human genes from Ensembl >> Biomart using the package biomaRt. Ideally, after retrieving I want to save >> these in FASTA format. When I am using the code given below to get 3'UTRs >> of genes in chromosome 1, 2 and 3 (not sure if this is the best way to >> achieve what I want), I am getting an error: >> >> "Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = >> "chromosome_name", : >> Query ERROR: caught BioMart::Exception::Database: Could not connect to >> mysql database ensembl_mart_67a: DBI >> connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca >> ;port=3306','bm_web',...) >> failed: Too many connections at /srv/biomart_server/ >> biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98" >> >> Code is given below: >> >>> library(biomaRt) >>> ensembl=useMart("ensembl") >>> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) >>> chrom=c(1,2,3) >>> getBM(attributes=c("hgnc_symbol", "3utr"),filters="chromosome_name", >> values = chrom, mart = ensembl) >> Error in getBM(attributes = c("hgnc_symbol", "3utr"), filters = >> "chromosome_name", : >> Query ERROR: caught BioMart::Exception::Database: Could not connect to >> mysql database ensembl_mart_67a: DBI >> connect('database=ensembl_mart_67a;host=bmdccdb.oicr.on.ca >> ;port=3306','bm_web',...) >> failed: Too many connections at /srv/biomart_server/ >> biomart.org/biomart-perl/lib/BioMart/Configuration/DBLocation.pm line 98 >> >> *SessionInfo is given below:* >> * >> >> * >>> sessionInfo() >> R version 2.15.0 (2012-03-30) >> Platform: i386-pc-mingw32/i386 (32-bit) >> >> locale: >> [1] LC_COLLATE=English_India.1252 LC_CTYPE=English_India.1252 >> LC_MONETARY=English_India.1252 LC_NUMERIC=C >> [5] LC_TIME=English_India.1252 >> >> attached base packages: >> [1] stats graphics grDevices utils datasets methods base >> >> other attached packages: >> [1] biomaRt_2.12.0 >> >> loaded via a namespace (and not attached): >> [1] RCurl_1.91-1.1 XML_3.9-1.1 >> >> >> Can somebody please tell me where I am going wrong? >> >> Thanks a lot, >> >> Regards, >> >> Kart >> >> [[alternative HTML version deleted]] >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at r-project.org >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> >> >> >> >> - >> >> >> > > -- Hervé Pagès Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N, M1-B514 P.O. Box 19024 Seattle, WA 98109-1024 E-mail: hpages at fhcrc.org Phone: (206) 667-5791 Fax: (206) 667-1319
ADD REPLYlink written 6.2 years ago by Hervé Pagès ♦♦ 13k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 137 users visited in the last hour