Search
Question: BLAST - annotate package?
0
gravatar for Tim Smith
5.2 years ago by
Tim Smith1.0k
Tim Smith1.0k wrote:
Hi, Sorry for this basic question - I'm new to BLAST! I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a sequence with the rhesus organism. I would like to get the following values: 1. Score (bits) 2. E-value 3. # Matches I am trying to use the 'annotate' package with the following code: library(annotate) xx <- blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn") Can (how?) I get the values that I want from the object returned? If not, which package/function should I be using? Also, is there a website where I can get the abbreviations for the databases (e.g. is rhesus = 'rh'?)? Any pointers in the right direction would be highly appreciated many thanks [[alternative HTML version deleted]]
ADD COMMENTlink modified 5.2 years ago by James W. MacDonald45k • written 5.2 years ago by Tim Smith1.0k
0
gravatar for James W. MacDonald
5.2 years ago by
United States
James W. MacDonald45k wrote:
Hi Tim, Try changing the hitListSize to character: > blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize="2") [[1]] DNAMultipleAlignment with 2 rows and 36 columns aln [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [[2]] DNAMultipleAlignment with 2 rows and 36 columns aln [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT Best, Jim On 8/31/2012 2:44 PM, Tim Smith wrote: > Hi, > > Sorry for this basic question - I'm new to BLAST! > > I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a sequence with the rhesus organism. I would like to get the following values: > > 1. Score (bits) > 2. E-value > 3. # Matches > > > I am trying to use the 'annotate' package with the following code: > > library(annotate) > xx<- blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn") > > > Can (how?) I get the values that I want from the object returned? If not, which package/function should I be using? Also, is there a website where I can get the abbreviations for the databases (e.g. is rhesus = 'rh'?)? > > Any pointers in the right direction would be highly appreciated > > > many thanks > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099
ADD COMMENTlink written 5.2 years ago by James W. MacDonald45k
Hi Jim, Thanks for the reply. I can get it to work even with the 2 without the quotes. But how do I get the values that I want (E-value, mismatches etc.) from the object returned by blastSequences? many thanks! ________________________________ From: James W. MacDonald <jmacdon@uw.edu> Cc: bioc <bioconductor@stat.math.ethz.ch> Sent: Friday, August 31, 2012 3:09 PM Subject: Re: [BioC] BLAST - annotate package? Hi Tim, Try changing the hitListSize to character: > blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize="2") [[1]] DNAMultipleAlignment with 2 rows and 36 columns       aln [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [[2]] DNAMultipleAlignment with 2 rows and 36 columns       aln [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT Best, Jim On 8/31/2012 2:44 PM, Tim Smith wrote: > Hi, > [[elided Yahoo spam]] > > I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a sequence with the rhesus organism. I would like to get the following values: > > 1. Score (bits) > 2. E-value > 3. # Matches > > > I am trying to use the 'annotate' package with the following code: > > library(annotate) > xx<- blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn") > > > Can (how?) I get the values that I want from the object returned? If not, which package/function should I be using? Also, is there a website where I can get the abbreviations for the databases (e.g. is rhesus = 'rh'?)? > > Any pointers in the right direction would be highly appreciated > > > many thanks >     [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099 [[alternative HTML version deleted]]
ADD REPLYlink written 5.2 years ago by Tim Smith1.0k
Hi Tim, My bad. I didn't read your email carefully. I don't know if there is anything within BioC for this - you might just need to use BLAST directly. Best, Jim On 8/31/2012 3:47 PM, Tim Smith wrote: > Hi Jim, > > Thanks for the reply. I can get it to work even with the 2 without the > quotes. But how do I get the values that I want (E-value, mismatches > etc.) from the object returned by blastSequences? > > many thanks! > > -------------------------------------------------------------------- ---- > *From:* James W. MacDonald <jmacdon at="" uw.edu=""> > *To:* Tim Smith <tim_smith_666 at="" yahoo.com=""> > *Cc:* bioc <bioconductor at="" stat.math.ethz.ch=""> > *Sent:* Friday, August 31, 2012 3:09 PM > *Subject:* Re: [BioC] BLAST - annotate package? > > Hi Tim, > > Try changing the hitListSize to character: > > > blastSequences(x = > "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize="2") > [[1]] > DNAMultipleAlignment with 2 rows and 36 columns > aln > [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > > [[2]] > DNAMultipleAlignment with 2 rows and 36 columns > aln > [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > > > Best, > > Jim > > > > On 8/31/2012 2:44 PM, Tim Smith wrote: > > Hi, > > > > Sorry for this basic question - I'm new to BLAST! > > > > I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a > sequence with the rhesus organism. I would like to get the following > values: > > > > 1. Score (bits) > > 2. E-value > > 3. # Matches > > > > > > I am trying to use the 'annotate' package with the following code: > > > > library(annotate) > > xx<- blastSequences(x = > "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn") > > > > > > Can (how?) I get the values that I want from the object returned? If > not, which package/function should I be using? Also, is there a > website where I can get the abbreviations for the databases (e.g. is > rhesus = 'rh'?)? > > > > Any pointers in the right direction would be highly appreciated > > > > > > many thanks > > [[alternative HTML version deleted]] > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor at r-project.org <mailto:bioconductor at="" r-project.org=""> > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > -- > James W. MacDonald, M.S. > Biostatistician > University of Washington > Environmental and Occupational Health Sciences > 4225 Roosevelt Way NE, # 100 > Seattle WA 98105-6099 > > > -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099
ADD REPLYlink written 5.2 years ago by James W. MacDonald45k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 154 users visited in the last hour