Just getting to my mail after the power outage in New Jersey. I'm laying claim to the sapply quoted here, verbatim as far as I can tell, sent off-list (my bad) about a year ago in order to offer an exploratory approach to the setting of max.Rmismatch. The conclusion would be, for this subject sequence and for the first Rpattern here, that 0 is a good value, and in the second case, as Herv? has said, that 2 is good when 1 was not enough. trimLRPatterns does not actually use any nedit function nor an sapply, although it does "stop" (at the C level) at the first position satisfying max.Rmismatch, if any, which of course can vary over the subject space. On Oct 30, 2012, at 12:58 PM, wang peter wrote: > i want to know how this function works? > > for example: > trimLRPatterns(Rpattern = Rpattern, subject = subject, > max.Rmismatch=1,with.Lindels=TRUE) > > > subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" > Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" > > the function will try to calculate the distance by such coding: > > sapply((nchar(subject)-nchar(Rpattern)+1):nchar(subject), function(j) { > s = substr(subject, j, nchar(subject)) > p = substr(Rpattern, 1, nchar(subject)-j+1) > neditEndingAtending.at=nchar(s), pattern = p, subject = s, > with.indels=TRUE) > }) > [1] 0 2 4 6 8 10 12 14 15 14 13 12 11 10 9 9 8 7 8 7 6 5 > 6 6 5 4 4 4 3 2 1 0 > [33] 1 1 > when the function find the value which is first satisfy the > max.Rmismatch value, it will stop > in this case,they function will stop at the first position. > > IF > subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" > Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGTT" > The results > [1] 2 3 4 6 8 10 12 14 15 14 13 12 11 10 9 9 8 7 8 7 6 5 > 6 6 5 4 4 4 3 2 1 0 > [33] 1 1 > it will stop > in this case,they function will stop at > subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" > Rpattern = > "GAATAGTACTGTAGGCACCATCAATAGATCGGTT" > > > so the shortcoming is the trimLRPatterns cannot find the shared > sequence between subject and Rpattern > "GAATAGTACTGTAGGCACCATCAATAGATCGG" > > -- > shan gao > Room 231(Dr.Fei lab) > Boyce Thompson Institute > Cornell University > Tower Road, Ithaca, NY 14853-1801 > Office phone: 1-607-254-1267(day) > Official email:sg839 at cornell.edu > Facebook:http://www.facebook.com/profile.php?id=100001986532253 > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor