Have troubles with finding Annotations for Bovine and Rhesus\' platforms
Entering edit mode
Last seen 1 hour ago
United States
Hi Kaj, On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: > Dear whom it may concern, > > I'm working with the platforms as following: > 1. Agilent-015354 Bovine Oligo Microarray (4x44K) I don't think there is a .db package for this one. You could go to earray (https://earray.chem.agilent.com/earray/) and find the correct GeneList, and then use AnnotationForge to create one. It could be fun, and help you break out of that 'pure biologist' rut you appear to be in ;-D > 2. Affymetrix GeneChip Rhesus Macaque Genome Array [Rhesus] biocLite("rhesus.db") > 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array biocLite("mogene10sttranscriptcluster.db") assuming that you have summarized at the transcript level (and IMO you should). Best, Jim > > Since I'm quite pure biologist, I do have no idea how to find appropriate annotations (.db) for these platforms. I need to use them for virtaulArray. > > Would you please help me? > > Best Regards, > Kaj > > -- output of sessionInfo(): > > sessioninfo() > > -- > Sent via the guest posting facility at bioconductor.org. > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099
Microarray GO oligo AnnotationForge Microarray GO oligo AnnotationForge • 3.4k views
Entering edit mode
Last seen 7.6 years ago
Dear Kaj, Jim was mostly correct. You will have to setup a annotation package for your bovine chip, but don't worry, you can use Affymetrix' annotation files to get it done using AnnotationForge. For your Rhesus chip you could try to use the org.Mmu.eg.db or rhesus.db0 packages, but will need to convert your probesets into some gene/transcript identifier first using Affymetrix' annotations. Your mouse data can be used directly using one of the mogene10* annotation packages, as Jim already pointed out. Your approach involves some work, but is definitely possible. Cheers, Andreas 2013/2/14 James W. MacDonald <jmacdon@uw.edu> > Hi Kaj, > > > On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: > >> Dear whom it may concern, >> >> I'm working with the platforms as following: >> 1. Agilent-015354 Bovine Oligo Microarray (4x44K) >> > > I don't think there is a .db package for this one. You could go to earray ( > https://earray.chem.agilent.**com/earray/<https: earray.chem.agilen="" t.com="" earray=""/>) > and find the correct GeneList, and then use AnnotationForge to create one. > It could be fun, and help you break out of that 'pure biologist' rut you > appear to be in ;-D > > > 2. Affymetrix GeneChip Rhesus Macaque Genome Array [Rhesus] >> > > biocLite("rhesus.db") > > > 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array >> > > biocLite("**mogene10sttranscriptcluster.**db") > > assuming that you have summarized at the transcript level (and IMO you > should). > > Best, > > Jim > > > >> Since I'm quite pure biologist, I do have no idea how to find appropriate >> annotations (.db) for these platforms. I need to use them for virtaulArray. >> >> Would you please help me? >> >> Best Regards, >> Kaj >> >> -- output of sessionInfo(): >> >> sessioninfo() >> >> -- >> Sent via the guest posting facility at bioconductor.org. >> >> ______________________________**_________________ >> Bioconductor mailing list >> Bioconductor@r-project.org >> https://stat.ethz.ch/mailman/**listinfo/bioconductor<https: stat.e="" thz.ch="" mailman="" listinfo="" bioconductor=""> >> Search the archives: http://news.gmane.org/gmane.** >> science.biology.informatics.**conductor<http: news.gmane.org="" gmane="" .science.biology.informatics.conductor=""> >> > > -- > James W. MacDonald, M.S. > Biostatistician > University of Washington > Environmental and Occupational Health Sciences > 4225 Roosevelt Way NE, # 100 > Seattle WA 98105-6099 > > [[alternative HTML version deleted]]
Entering edit mode
Dear All, I have loaded AnnotationForge. I will try my best to understand it. I will certainly come up with more questions. Thank you very much for your helps. Best Regards, Kaj On Fri, Feb 15, 2013 at 4:54 PM, Andreas Heider <aheider@trm.uni-leipzig.de>wrote: > Dear Kaj, > Jim was mostly correct. You will have to setup a annotation package for > your bovine chip, but don't worry, you can use Affymetrix' annotation files > to get it done using AnnotationForge. For your Rhesus chip you could try to > use the org.Mmu.eg.db or rhesus.db0 packages, but will need to convert your > probesets into some gene/transcript identifier first using Affymetrix' > annotations. Your mouse data can be used directly using one of the > mogene10* annotation packages, as Jim already pointed out. > > Your approach involves some work, but is definitely possible. > > Cheers, > Andreas > > > 2013/2/14 James W. MacDonald <jmacdon@uw.edu> > > Hi Kaj, >> >> >> On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: >> >>> Dear whom it may concern, >>> >>> I'm working with the platforms as following: >>> 1. Agilent-015354 Bovine Oligo Microarray (4x44K) >>> >> >> I don't think there is a .db package for this one. You could go to earray >> (https://earray.chem.agilent.**com/earray/<https: earray.chem.agil="" ent.com="" earray=""/>) >> and find the correct GeneList, and then use AnnotationForge to create one. >> It could be fun, and help you break out of that 'pure biologist' rut you >> appear to be in ;-D >> >> >> 2. Affymetrix GeneChip Rhesus Macaque Genome Array [Rhesus] >>> >> >> biocLite("rhesus.db") >> >> >> 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array >>> >> >> biocLite("**mogene10sttranscriptcluster.**db") >> >> assuming that you have summarized at the transcript level (and IMO you >> should). >> >> Best, >> >> Jim >> >> >> >>> Since I'm quite pure biologist, I do have no idea how to find >>> appropriate annotations (.db) for these platforms. I need to use them for >>> virtaulArray. >>> >>> Would you please help me? >>> >>> Best Regards, >>> Kaj >>> >>> -- output of sessionInfo(): >>> >>> sessioninfo() >>> >>> -- >>> Sent via the guest posting facility at bioconductor.org. >>> >>> ______________________________**_________________ >>> Bioconductor mailing list >>> Bioconductor@r-project.org >>> https://stat.ethz.ch/mailman/**listinfo/bioconductor<https: stat.="" ethz.ch="" mailman="" listinfo="" bioconductor=""> >>> Search the archives: http://news.gmane.org/gmane.** >>> science.biology.informatics.**conductor<http: news.gmane.org="" gman="" e.science.biology.informatics.conductor=""> >>> >> >> -- >> James W. MacDonald, M.S. >> Biostatistician >> University of Washington >> Environmental and Occupational Health Sciences >> 4225 Roosevelt Way NE, # 100 >> Seattle WA 98105-6099 >> >> > [[alternative HTML version deleted]]
Entering edit mode
Dear All, I hope this won't be too tedious for you, please be patient with me. I have found the bovine gene list from Agilent ( http://www.chem.agilent.com/cag/bsp/gene_lists.asp). Is this what I need for making db package? Best Regards, Kaj On Fri, Feb 15, 2013 at 7:54 PM, Kaj Chokeshaiusaha < kajkajkajkajkaj at gmail.com> wrote: > Dear All, > > I have loaded AnnotationForge. I will try my best to understand it. I will > certainly come up with more questions. Thank you very much for your helps. > > Best Regards, > Kaj > > > On Fri, Feb 15, 2013 at 4:54 PM, Andreas Heider < > aheider at trm.uni-leipzig.de> wrote: > >> Dear Kaj, >> Jim was mostly correct. You will have to setup a annotation package for >> your bovine chip, but don't worry, you can use Affymetrix' annotation files >> to get it done using AnnotationForge. For your Rhesus chip you could try to >> use the org.Mmu.eg.db or rhesus.db0 packages, but will need to convert your >> probesets into some gene/transcript identifier first using Affymetrix' >> annotations. Your mouse data can be used directly using one of the >> mogene10* annotation packages, as Jim already pointed out. >> >> Your approach involves some work, but is definitely possible. >> >> Cheers, >> Andreas >> >> >> 2013/2/14 James W. MacDonald <jmacdon at="" uw.edu=""> >> >> Hi Kaj, >>> >>> >>> On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: >>> >>>> Dear whom it may concern, >>>> >>>> I'm working with the platforms as following: >>>> 1. Agilent-015354 Bovine Oligo Microarray (4x44K) >>>> >>> >>> I don't think there is a .db package for this one. You could go to >>> earray (https://earray.chem.agilent.**com/earray/<https: earray.c="" hem.agilent.com="" earray=""/>) >>> and find the correct GeneList, and then use AnnotationForge to create one. >>> It could be fun, and help you break out of that 'pure biologist' rut you >>> appear to be in ;-D >>> >>> >>> 2. Affymetrix GeneChip Rhesus Macaque Genome Array [Rhesus] >>>> >>> >>> biocLite("rhesus.db") >>> >>> >>> 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array >>>> >>> >>> biocLite("**mogene10sttranscriptcluster.**db") >>> >>> assuming that you have summarized at the transcript level (and IMO you >>> should). >>> >>> Best, >>> >>> Jim >>> >>> >>> >>>> Since I'm quite pure biologist, I do have no idea how to find >>>> appropriate annotations (.db) for these platforms. I need to use them for >>>> virtaulArray. >>>> >>>> Would you please help me? >>>> >>>> Best Regards, >>>> Kaj >>>> >>>> -- output of sessionInfo(): >>>> >>>> sessioninfo() >>>> >>>> -- >>>> Sent via the guest posting facility at bioconductor.org. >>>> >>>> ______________________________**_________________ >>>> Bioconductor mailing list >>>> Bioconductor at r-project.org >>>> https://stat.ethz.ch/mailman/**listinfo/bioconductor<https: stat="" .ethz.ch="" mailman="" listinfo="" bioconductor=""> >>>> Search the archives: http://news.gmane.org/gmane.** >>>> science.biology.informatics.**conductor<http: news.gmane.org="" gma="" ne.science.biology.informatics.conductor=""> >>>> >>> >>> -- >>> James W. MacDonald, M.S. >>> Biostatistician >>> University of Washington >>> Environmental and Occupational Health Sciences >>> 4225 Roosevelt Way NE, # 100 >>> Seattle WA 98105-6099 >>> >>> >> >
Entering edit mode
Dear All, Sorry for my previous confusing mail. I've found the corresponding .adf of 'Agilent-015354 Bovine Oligo Microarray (4x44K)' in eArray. Best Regards, Kaj On Sat, Feb 16, 2013 at 10:20 PM, Kaj Chokeshaiusaha < kajkajkajkajkaj@gmail.com> wrote: > Dear All, > > I hope this won't be too tedious for you, please be patient with me. > > I have found the bovine gene list from Agilent ( > http://www.chem.agilent.com/cag/bsp/gene_lists.asp). > > Is this what I need for making db package? > > Best Regards, > Kaj > > On Fri, Feb 15, 2013 at 7:54 PM, Kaj Chokeshaiusaha < > kajkajkajkajkaj@gmail.com> wrote: > >> Dear All, >> >> I have loaded AnnotationForge. I will try my best to understand it. I >> will certainly come up with more questions. Thank you very much for your >> helps. >> >> Best Regards, >> Kaj >> >> >> On Fri, Feb 15, 2013 at 4:54 PM, Andreas Heider < >> aheider@trm.uni-leipzig.de> wrote: >> >>> Dear Kaj, >>> Jim was mostly correct. You will have to setup a annotation package for >>> your bovine chip, but don't worry, you can use Affymetrix' annotation files >>> to get it done using AnnotationForge. For your Rhesus chip you could try to >>> use the org.Mmu.eg.db or rhesus.db0 packages, but will need to convert your >>> probesets into some gene/transcript identifier first using Affymetrix' >>> annotations. Your mouse data can be used directly using one of the >>> mogene10* annotation packages, as Jim already pointed out. >>> >>> Your approach involves some work, but is definitely possible. >>> >>> Cheers, >>> Andreas >>> >>> >>> 2013/2/14 James W. MacDonald <jmacdon@uw.edu> >>> >>> Hi Kaj, >>>> >>>> >>>> On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: >>>> >>>>> Dear whom it may concern, >>>>> >>>>> I'm working with the platforms as following: >>>>> 1. Agilent-015354 Bovine Oligo Microarray (4x44K) >>>>> >>>> >>>> I don't think there is a .db package for this one. You could go to >>>> earray (https://earray.chem.agilent.**com/earray/<https: earray.="" chem.agilent.com="" earray=""/>) >>>> and find the correct GeneList, and then use AnnotationForge to create one. >>>> It could be fun, and help you break out of that 'pure biologist' rut you >>>> appear to be in ;-D >>>> >>>> >>>> 2. Affymetrix GeneChip Rhesus Macaque Genome Array [Rhesus] >>>>> >>>> >>>> biocLite("rhesus.db") >>>> >>>> >>>> 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array >>>>> >>>> >>>> biocLite("**mogene10sttranscriptcluster.**db") >>>> >>>> assuming that you have summarized at the transcript level (and IMO you >>>> should). >>>> >>>> Best, >>>> >>>> Jim >>>> >>>> >>>> >>>>> Since I'm quite pure biologist, I do have no idea how to find >>>>> appropriate annotations (.db) for these platforms. I need to use them for >>>>> virtaulArray. >>>>> >>>>> Would you please help me? >>>>> >>>>> Best Regards, >>>>> Kaj >>>>> >>>>> -- output of sessionInfo(): >>>>> >>>>> sessioninfo() >>>>> >>>>> -- >>>>> Sent via the guest posting facility at bioconductor.org. >>>>> >>>>> ______________________________**_________________ >>>>> Bioconductor mailing list >>>>> Bioconductor@r-project.org >>>>> https://stat.ethz.ch/mailman/**listinfo/bioconductor<https: sta="" t.ethz.ch="" mailman="" listinfo="" bioconductor=""> >>>>> Search the archives: http://news.gmane.org/gmane.** >>>>> science.biology.informatics.**conductor<http: news.gmane.org="" gm="" ane.science.biology.informatics.conductor=""> >>>>> >>>> >>>> -- >>>> James W. MacDonald, M.S. >>>> Biostatistician >>>> University of Washington >>>> Environmental and Occupational Health Sciences >>>> 4225 Roosevelt Way NE, # 100 >>>> Seattle WA 98105-6099 >>>> >>>> >>> >> > [[alternative HTML version deleted]]
Entering edit mode
Hi, This is very tedious, but I have a lot of trouble reading the adf file of an Agilent chip I attached here. I try to read it with the script. >read.table("9712.adf.txt", skip=11, sep = "\t", header = FALSE, as.is = TRUE)[,c(2,5)] Then R shows.. >Error in scan(file, what, nmax, sep, dec, quote, skip, nlines, na.strings, : line 512 did not have 17 elements What should I do? Best, Kaj On Sat, Feb 16, 2013 at 11:30 PM, Kaj Chokeshaiusaha < kajkajkajkajkaj@gmail.com> wrote: > Dear All, > > Sorry for my previous confusing mail. I've found the corresponding .adf of > 'Agilent-015354 Bovine Oligo Microarray (4x44K)' in eArray. > > Best Regards, > Kaj > > > On Sat, Feb 16, 2013 at 10:20 PM, Kaj Chokeshaiusaha < > kajkajkajkajkaj@gmail.com> wrote: > >> Dear All, >> >> I hope this won't be too tedious for you, please be patient with me. >> >> I have found the bovine gene list from Agilent ( >> http://www.chem.agilent.com/cag/bsp/gene_lists.asp). >> >> Is this what I need for making db package? >> >> Best Regards, >> Kaj >> >> On Fri, Feb 15, 2013 at 7:54 PM, Kaj Chokeshaiusaha < >> kajkajkajkajkaj@gmail.com> wrote: >> >>> Dear All, >>> >>> I have loaded AnnotationForge. I will try my best to understand it. I >>> will certainly come up with more questions. Thank you very much for your >>> helps. >>> >>> Best Regards, >>> Kaj >>> >>> >>> On Fri, Feb 15, 2013 at 4:54 PM, Andreas Heider < >>> aheider@trm.uni-leipzig.de> wrote: >>> >>>> Dear Kaj, >>>> Jim was mostly correct. You will have to setup a annotation package for >>>> your bovine chip, but don't worry, you can use Affymetrix' annotation files >>>> to get it done using AnnotationForge. For your Rhesus chip you could try to >>>> use the org.Mmu.eg.db or rhesus.db0 packages, but will need to convert your >>>> probesets into some gene/transcript identifier first using Affymetrix' >>>> annotations. Your mouse data can be used directly using one of the >>>> mogene10* annotation packages, as Jim already pointed out. >>>> >>>> Your approach involves some work, but is definitely possible. >>>> >>>> Cheers, >>>> Andreas >>>> >>>> >>>> 2013/2/14 James W. MacDonald <jmacdon@uw.edu> >>>> >>>> Hi Kaj, >>>>> >>>>> >>>>> On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: >>>>> >>>>>> Dear whom it may concern, >>>>>> >>>>>> I'm working with the platforms as following: >>>>>> 1. Agilent-015354 Bovine Oligo Microarray (4x44K) >>>>>> >>>>> >>>>> I don't think there is a .db package for this one. You could go to >>>>> earray (https://earray.chem.agilent.**com/earray/<https: earray="" .chem.agilent.com="" earray=""/>) >>>>> and find the correct GeneList, and then use AnnotationForge to create one. >>>>> It could be fun, and help you break out of that 'pure biologist' rut you >>>>> appear to be in ;-D >>>>> >>>>> >>>>> 2. Affymetrix GeneChip Rhesus Macaque Genome Array [Rhesus] >>>>>> >>>>> >>>>> biocLite("rhesus.db") >>>>> >>>>> >>>>> 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array >>>>>> >>>>> >>>>> biocLite("**mogene10sttranscriptcluster.**db") >>>>> >>>>> assuming that you have summarized at the transcript level (and IMO you >>>>> should). >>>>> >>>>> Best, >>>>> >>>>> Jim >>>>> >>>>> >>>>> >>>>>> Since I'm quite pure biologist, I do have no idea how to find >>>>>> appropriate annotations (.db) for these platforms. I need to use them for >>>>>> virtaulArray. >>>>>> >>>>>> Would you please help me? >>>>>> >>>>>> Best Regards, >>>>>> Kaj >>>>>> >>>>>> -- output of sessionInfo(): >>>>>> >>>>>> sessioninfo() >>>>>> >>>>>> -- >>>>>> Sent via the guest posting facility at bioconductor.org. >>>>>> >>>>>> ______________________________**_________________ >>>>>> Bioconductor mailing list >>>>>> Bioconductor@r-project.org >>>>>> https://stat.ethz.ch/mailman/**listinfo/bioconductor<https: st="" at.ethz.ch="" mailman="" listinfo="" bioconductor=""> >>>>>> Search the archives: http://news.gmane.org/gmane.** >>>>>> science.biology.informatics.**conductor<http: news.gmane.org="" g="" mane.science.biology.informatics.conductor=""> >>>>>> >>>>> >>>>> -- >>>>> James W. MacDonald, M.S. >>>>> Biostatistician >>>>> University of Washington >>>>> Environmental and Occupational Health Sciences >>>>> 4225 Roosevelt Way NE, # 100 >>>>> Seattle WA 98105-6099 >>>>> >>>>> >>>> >>> >> > [[alternative HTML version deleted]]
Entering edit mode
Hi Kaj, First some admonishment. You appear not to be trying very hard to figure out how to do this on your own. I gave you some pretty clear instructions that you need a file that has two columns, one with the probe IDs and one with some other annotation ID. I then pointed you to the vignette that shows how to create the package. So you then went out and found a file that looks promising. It is called the 015354 somethingsomething genelist, and that corresponds to your array. So good for you. But then you came back to us to see if it is OK. This is a problem, as you will never get far with OpenSource software if you aren't willing to figure things out on your own (especially if you have already been told explicitly what you need to do). Rather than telling you what to do next, let's try the Socratic approach. 1.) What data are represented in this file? Do they perhaps fulfill one of the requirements for AnnotationForge? If you think not, why do you think that? If you think they do, why are you asking us? 2.) If this file does contain data sufficient for building an annotation package, what do you need to do in order to proceed from here? Have you read the vignette? Do you not understand something? Don't be afraid to try things. You are very unlikely to break anything, and failing is the best way to learn. If/when you fail, try to figure out on your own why the failure occurred. Google is your friend. If you want to learn how to analyze data using Bioconductor you will need to become self-reliant. People are amazingly willing to help people who are truly struggling, and have tried their best to progress. They are much less willing to help those who seem not to help themselves. If you try and fail, don't be afraid to come back with questions. But be prepared to show what you have tried, and supply the error message. Also supply the output of sessionInfo(). Best, Jim On 2/16/2013 10:20 AM, Kaj Chokeshaiusaha wrote: > +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ > > Warning text added to this message by > UW Information Technology > help at uw.edu > > ATTACHMENTS RENAMED > > This message came to the UW with an attached file with a > name that ended in .zip or .exe. Because files of this > type can automatically infect computers with a virus, the > attachment has been renamed. > > o If the sender of the message is known to you, and you > were expecting the message, you need simply save the > attachment using the original name or save it as is and > rename it back to the original name on your computer. > > o If the sender is not known to you, it is possible that > the attachment contains a virus and you may simply > delete the message. > > o If this message claims to be official and > instructs you to open the attachment to get > important information, it is likely to be fake. > Virus writers are increasingly using sophisticated > social engineering techniques to mislead people. > > UW-IT never sends important information about your > account or password in an email attachment. Instead > you will be directed to a web page on a UW-IT site. > > If you have further questions, please contact your > local computing support or > UW Information Technology > email: help at uw.edu > phone: 206.221.5000 > > Warning text added to this message by > UW Information Technology > +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ > Dear All, > > I hope this won't be too tedious for you, please be patient with me. > > I have found the bovine gene list from Agilent > (http://www.chem.agilent.com/cag/bsp/gene_lists.asp). > > Is this what I need for making db package? > > Best Regards, > Kaj > > On Fri, Feb 15, 2013 at 7:54 PM, Kaj Chokeshaiusaha > <kajkajkajkajkaj at="" gmail.com="" <mailto:kajkajkajkajkaj="" at="" gmail.com="">> wrote: > > Dear All, > > I have loaded AnnotationForge. I will try my best to understand > it. I will certainly come up with more questions. Thank you very > much for your helps. > > Best Regards, > Kaj > > > On Fri, Feb 15, 2013 at 4:54 PM, Andreas Heider > <aheider at="" trm.uni-leipzig.de="" <mailto:aheider="" at="" trm.uni-="" leipzig.de="">> > wrote: > > Dear Kaj, > Jim was mostly correct. You will have to setup a annotation > package for your bovine chip, but don't worry, you can use > Affymetrix' annotation files to get it done using > AnnotationForge. For your Rhesus chip you could try to use the > org.Mmu.eg.db or rhesus.db0 packages, but will need to convert > your probesets into some gene/transcript identifier first > using Affymetrix' annotations. Your mouse data can be used > directly using one of the mogene10* annotation packages, as > Jim already pointed out. > > Your approach involves some work, but is definitely possible. > > Cheers, > Andreas > > > 2013/2/14 James W. MacDonald <jmacdon at="" uw.edu=""> <mailto:jmacdon at="" uw.edu="">> > > Hi Kaj, > > > On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: > > Dear whom it may concern, > > I'm working with the platforms as following: > 1. Agilent-015354 Bovine Oligo Microarray (4x44K) > > > I don't think there is a .db package for this one. You > could go to earray > (https://earray.chem.agilent.com/earray/) and find the > correct GeneList, and then use AnnotationForge to create > one. It could be fun, and help you break out of that 'pure > biologist' rut you appear to be in ;-D > > > 2. Affymetrix GeneChip Rhesus Macaque Genome Array > [Rhesus] > > > biocLite("rhesus.db") > > > 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array > > > biocLite("mogene10sttranscriptcluster.db") > > assuming that you have summarized at the transcript level > (and IMO you should). > > Best, > > Jim > > > > Since I'm quite pure biologist, I do have no idea how > to find appropriate annotations (.db) for these > platforms. I need to use them for virtaulArray. > > Would you please help me? > > Best Regards, > Kaj > > -- output of sessionInfo(): > > sessioninfo() > > -- > Sent via the guest posting facility at > bioconductor.org <http: bioconductor.org="">. > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > <mailto:bioconductor at="" r-project.org=""> > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > -- > James W. MacDonald, M.S. > Biostatistician > University of Washington > Environmental and Occupational Health Sciences > 4225 Roosevelt Way NE, # 100 > Seattle WA 98105-6099 > > > > -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099
Entering edit mode
Dear all, Thanks for your admonishment. I will try better. The adf file here is the details of the bovine Agilent platform I'm trying to create annotation. It's just because my weak R, I can't read it in table. Now I can read it by adding 'fill=TRUE' in the command. After reading your advice, In fact, I do have two things disturbing me a lot. 1. To create the two column file, I decide to have 'ProbeID' and 'Genebank ID'. I choose them because they show corresponding data in every line with no missing data. I don't know this is the correct way to choose them or not. 2. I do have trouble with dbschemas for 'makeDBPackage' function in R. There are two dbschemas; BOVINE_DB and BOVINECHIP_DB. I can't find the details of these files. In fact, I don't even understand dbschemas. What should I choose here and how to check it? I'm very scared to acquire the false Annnotation package due to this step. I'm tremedously sorry for the previous mail. I must admit that I get nervous and confused. I'm the only one here to use R and interested in the field, so I get anxious quite frequently. I deeply apologize you all. Please help me. Best Regards, Kaj On Mon, Feb 18, 2013 at 10:19 PM, James W. MacDonald <jmacdon@uw.edu> wrote: > Hi Kaj, > > First some admonishment. You appear not to be trying very hard to figure > out how to do this on your own. I gave you some pretty clear instructions > that you need a file that has two columns, one with the probe IDs and one > with some other annotation ID. I then pointed you to the vignette that > shows how to create the package. > > So you then went out and found a file that looks promising. It is called > the 015354 somethingsomething genelist, and that corresponds to your array. > So good for you. > > But then you came back to us to see if it is OK. This is a problem, as you > will never get far with OpenSource software if you aren't willing to figure > things out on your own (especially if you have already been told explicitly > what you need to do). > > Rather than telling you what to do next, let's try the Socratic approach. > > 1.) What data are represented in this file? Do they perhaps fulfill one of > the requirements for AnnotationForge? If you think not, why do you think > that? If you think they do, why are you asking us? > > 2.) If this file does contain data sufficient for building an annotation > package, what do you need to do in order to proceed from here? Have you > read the vignette? Do you not understand something? > > Don't be afraid to try things. You are very unlikely to break anything, > and failing is the best way to learn. If/when you fail, try to figure out > on your own why the failure occurred. Google is your friend. > > If you want to learn how to analyze data using Bioconductor you will need > to become self-reliant. People are amazingly willing to help people who are > truly struggling, and have tried their best to progress. They are much less > willing to help those who seem not to help themselves. > > If you try and fail, don't be afraid to come back with questions. But be > prepared to show what you have tried, and supply the error message. Also > supply the output of sessionInfo(). > > Best, > > Jim > > On 2/16/2013 10:20 AM, Kaj Chokeshaiusaha wrote: > >> ++++++++++++++++++++++++++++++**++++++++++++++++++++++++++++++**+ >> >> Warning text added to this message by >> UW Information Technology >> help@uw.edu >> >> ATTACHMENTS RENAMED >> >> This message came to the UW with an attached file with a >> name that ended in .zip or .exe. Because files of this >> type can automatically infect computers with a virus, the >> attachment has been renamed. >> >> o If the sender of the message is known to you, and you >> were expecting the message, you need simply save the >> attachment using the original name or save it as is and >> rename it back to the original name on your computer. >> >> o If the sender is not known to you, it is possible that >> the attachment contains a virus and you may simply >> delete the message. >> >> o If this message claims to be official and >> instructs you to open the attachment to get >> important information, it is likely to be fake. >> Virus writers are increasingly using sophisticated >> social engineering techniques to mislead people. >> >> UW-IT never sends important information about your >> account or password in an email attachment. Instead >> you will be directed to a web page on a UW-IT site. >> >> If you have further questions, please contact your >> local computing support or >> UW Information Technology >> email: help@uw.edu >> phone: 206.221.5000 >> >> Warning text added to this message by >> UW Information Technology >> ++++++++++++++++++++++++++++++**++++++++++++++++++++++++++++++**+ >> >> Dear All, >> >> I hope this won't be too tedious for you, please be patient with me. >> >> I have found the bovine gene list from Agilent ( >> http://www.chem.agilent.com/**cag/bsp/gene_lists.asp<http: www.che="" m.agilent.com="" cag="" bsp="" gene_lists.asp=""> >> ). >> >> Is this what I need for making db package? >> >> Best Regards, >> Kaj >> >> On Fri, Feb 15, 2013 at 7:54 PM, Kaj Chokeshaiusaha < >> kajkajkajkajkaj@gmail.com <mailto:kajkajkajkajkaj@gmail.**com<kajkajkajkajkaj@gmail.com>>> >> wrote: >> >> Dear All, >> >> I have loaded AnnotationForge. I will try my best to understand >> it. I will certainly come up with more questions. Thank you very >> much for your helps. >> >> Best Regards, >> Kaj >> >> >> On Fri, Feb 15, 2013 at 4:54 PM, Andreas Heider >> <aheider@trm.uni-leipzig.de <mailto:aheider@trm.uni-**leipzig.de<aheider@trm.uni-leipzig.de=""> >> >> >> >> wrote: >> >> Dear Kaj, >> Jim was mostly correct. You will have to setup a annotation >> package for your bovine chip, but don't worry, you can use >> Affymetrix' annotation files to get it done using >> AnnotationForge. For your Rhesus chip you could try to use the >> org.Mmu.eg.db or rhesus.db0 packages, but will need to convert >> your probesets into some gene/transcript identifier first >> using Affymetrix' annotations. Your mouse data can be used >> directly using one of the mogene10* annotation packages, as >> Jim already pointed out. >> >> Your approach involves some work, but is definitely possible. >> >> Cheers, >> Andreas >> >> >> 2013/2/14 James W. MacDonald <jmacdon@uw.edu>> <mailto:jmacdon@uw.edu>> >> >> >> Hi Kaj, >> >> >> On 2/14/2013 11:48 AM, Kaj Chokeshaiusaha [guest] wrote: >> >> Dear whom it may concern, >> >> I'm working with the platforms as following: >> 1. Agilent-015354 Bovine Oligo Microarray (4x44K) >> >> >> I don't think there is a .db package for this one. You >> could go to earray >> (https://earray.chem.agilent.**com/earray/<https: earr="" ay.chem.agilent.com="" earray=""/>) >> and find the >> correct GeneList, and then use AnnotationForge to create >> one. It could be fun, and help you break out of that 'pure >> biologist' rut you appear to be in ;-D >> >> >> 2. Affymetrix GeneChip Rhesus Macaque Genome Array >> [Rhesus] >> >> >> biocLite("rhesus.db") >> >> >> 3. Affymetrix GeneChip Mouse Gene 1.0 ST Array >> >> >> biocLite("**mogene10sttranscriptcluster.**db") >> >> assuming that you have summarized at the transcript level >> (and IMO you should). >> >> Best, >> >> Jim >> >> >> >> Since I'm quite pure biologist, I do have no idea how >> to find appropriate annotations (.db) for these >> platforms. I need to use them for virtaulArray. >> >> Would you please help me? >> >> Best Regards, >> Kaj >> >> -- output of sessionInfo(): >> >> sessioninfo() >> >> -- >> Sent via the guest posting facility at >> bioconductor.org <http: bioconductor.org="">. >> >> >> ______________________________**_________________ >> Bioconductor mailing list >> Bioconductor@r-project.org >> <mailto:bioconductor@r-**project.org<bioconductor@r-project.org> >> > >> >> https://stat.ethz.ch/mailman/**listinfo/bioconducto r<https: stat.ethz.ch="" mailman="" listinfo="" bioconductor=""> >> Search the archives: >> http://news.gmane.org/gmane.** >> science.biology.informatics.**conductor<http: news.gmane.org="" gmane="" .science.biology.informatics.conductor=""> >> >> >> -- James W. MacDonald, M.S. >> Biostatistician >> University of Washington >> Environmental and Occupational Health Sciences >> 4225 Roosevelt Way NE, # 100 >> Seattle WA 98105-6099 >> >> >> >> >> > -- > James W. MacDonald, M.S. > Biostatistician > University of Washington > Environmental and Occupational Health Sciences > 4225 Roosevelt Way NE, # 100 > Seattle WA 98105-6099 > > [[alternative HTML version deleted]]
Entering edit mode
Dear all, I've tried the script as following.. library(AnnotationForge) #Please see the attached "A-GEOD-9712.adf.txt # bov<-read.table("A-GEOD-9712.adf.txt", skip=13, sep = "\t", header = FALSE, as.is = TRUE, fill=T)[,c(2,5)] output="D:/Progect for MOU/Detailed Projects/Cumulus cell/Cow GPL9712" makeDBPackage("BOVINECHIP_DB", affy=FALSE, prefix="bov", fileName=bov, baseMapType="gb", outputDir=output, version="1.0.0", manufacturer = "Agilent Technologies", chipName = "Agilent-015354 Bovine Oligo Microarray") then R show me.. Error in read.table(file = file, header = header, sep = sep, quote = quote, : 'file' must be a character string or connection I also try using BOVINE_DB in 'makeDBPackage'. It show me no error but doesn't give me back any file Please suggest me, Kaj -------------- next part -------------- Array Design Name Agilent-015354 Bovine Oligo Microarray (4x44K) (Probe Name version) Provider Agilent Technologies(cag_sales-na at agilent.com) Comment[ArrayExpressAccession] A-GEOD-9712 Comment[SecondaryAccession] GPL9712 Comment[Description] Array Manufacturer: Agilent Technologies, Catalogue number: G2514F, Distribution: commercial, Technology: in situ oligonucleotide, Design ID: 015354 Agilent has developed a genome-wide bovine microarray to enable scientists to study gene expression profiling at the global level. Agilent's Bovine Oligo ? 4X44K microarray covers 21,475 unique genes and transcripts of Bos Taurus, two probes for each gene are produced. Oligonucleotides, 60-mers, are synthesized directly on glass slide using the Agilent?s SurePrint Technology. *** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL7053.
Reporter Name = Identifier for the probe printed in the microarray
Comment[SPOT_ID] = spot identifier
Reporter Database Entry [genbank] = GenBank accession number LINK_PRE:http://ww w.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term=
Reporter Comment = Description Comment[SubmittedName] Agilent-015354 Bovine Oligo Microarray (4x44K) (Probe Name version) Comment[Organism] Bos taurus Printing Protocol See manufacturer?s web site at http://www.agilent.com/ Surface Type Substrate Type Term Source Name chromosome_coordinate genbank go locus unigene Reporter Name Comment[SPOT_ID] Comment[CONTROL_TYPE] Comment[REFSEQ] Reporter Database Entry [genbank] Reporter Database Entry [locus] Comment[GENE_SYMBOL] Comment[GENE_NAME] Reporter Database Entry [unigene] Comment[ENSEMBL_ID] Comment[TIGR_ID] Comment[ACCESSION_STRING] Reporter Database Entry [chromosome_coordinate] Comment[CYTOBAND] Reporter Comment Reporter Database Entry [go] Reporter Sequence A_73_100000 A_73_100000 FALSE XM_867354 XM_867354 LOC615520 ref|XM_867354 unmapped PREDICTED: Bos taurus similar to tomosyn isoform m (LOC615520) CGAGTGCCAGGGTTAGAACGCCAATAATACTCAGTACCGCGAATAAAGGGCTTGCTCCCA A_73_100001 A_73_100001 FALSE BF602095 BF602095 gb|Unidentified transcripts on BTA4 position 20820920-20821464 unmapped Unknown TGAACAATTCTTTATTCTGTTTTTTCATACTGTATTCACTAAATTAAGTAGCAACTCATT A_73_100002 A_73_100002 FALSE XM_588956 XM_588956 LOC511591 ref|XM_588956 unmapped Bos taurus similar to Homo sapiens sortilin 1 (SORT1) TATTCGCTTCCTCTTAGGTTGCTGCTCTACATGGAGCTGTGACTAGACATGTTTTCAGTT A_73_100003 A_73_100003 FALSE XM_871116 XM_871116 LOC618793 ref|XM_871116 unmapped PREDICTED: Bos taurus similar to Putative fork head domain transcription factor AFX1 (Forkhead box protein O4) (LOC618793), partial mRNA. ATGACCTCATGGATGGGGACGAAGGACTGGACTTCAACTTTGAGCCAGGTGTCCAGCTAG A_73_100004 A_73_100004 FALSE NM_001001153 NM_001001153 MOGAT1 ref|NM_001001153 unmapped Bos taurus putative monoacylglycerol acyltransferase 1 (MOGAT1) GTTCCACGCCAGAGGAATTTTTCAATACAATTTTGGCCTAATCCCCTATAGGAAGCCCAT A_73_100005 A_73_100005 FALSE NM_001035300 NM_001035300 TEX261 ref|NM_001035300 unmapped Bos taurus similar to Homo sapiens testis expressed sequence 261 (TEX261) TGTCCAGTTTTTGTATCAACAGCGCCTAGCTTGGCACCTGGCACATAGAAAGTACTTCAA A_73_100006 A_73_100006 FALSE CB418663 CB418663 gb|Bos taurus similar to Homo sapiens leukemia inhibitory factor receptor alpha (LIFR) unmapped Unknown ATCATTGTATAATTTCAGAATGTAGTGTCCGTATCTTTTGGGAAACATGGTCATAGCAAG A_73_100007 A_73_100007 FALSE XM_597589 XM_597589 LOC519372 ref|XM_597589 unmapped Bos taurus similar to Homo sapiens PDZ domain containing 6 (PDZD6) CTGTTTTCATGACTCAGTTACAGAAATTGCCATTGAAATGGCTTTTAAACTGTTCTTTGG A_73_100008 A_73_100008 FALSE XM_591204 XM_591204 LOC513513 ref|XM_591204 unmapped Bos taurus similar to Homo sapiens chitinase 3-like 2 (CHI3L2), transcript variant 1 TGGACATAAGTTGGATCTACCCAAATGTAAAAGACAACACTCATTTCACTGTGCTGATTC A_73_100009 A_73_100009 FALSE CB169312 CB169312 gb|Unidentified transcripts unmapped Unknown TGTGCAAGTTTCCTCCTGTAAGGACACCTCTAATCGGAAAGGCCATTTCCTTGGTATCAT A_73_100010 A_73_100010 FALSE XM_587935 XM_587935 LOC510748 ref|XM_587935 unmapped Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 (PLEKHA4) TCCCCAGCCAGACGCCAGCCTGATGCGGAACAAAAAGTGAGGGAAACGGGGGTGGGTCAA A_73_100011 A_73_100011 FALSE XM_612454 XM_612454 LOC533145 ref|XM_612454 unmapped Bos taurus similar to Homo sapiens pleckstrin homology-like domain, family B, member 3 (PHLDB3) TTCTGCCTAACATCTTACCTCTCCTCCCCTGGAGAAATGGAACCGGGCCTGCCCAGATGT A_73_100012 A_73_100012 FALSE XM_585953 XM_585953 LOC509064 ref|XM_585953 unmapped Bos taurus similar to Homo sapiens chromosome 7 open reading frame 11 (C7orf11) GAAAATAGACCATACTTTGTGCTGTAGACAGGTTTATATATTTGTTCATAGGGAAAAGGG A_73_100013 A_73_100013 FALSE NM_174106 NM_174106 MAPT ref|NM_174106 unmapped Bos taurus microtubule associated protein tau (MAPT) TAAAAAACACTCAAAAAGAGGGCCACACCCAGAATTTCCCTGGGCAATTACTTTGATTCT A_73_100014 A_73_100014 FALSE NM_001031750 NM_001031750 FOXL2 ref|NM_001031750 unmapped Bos taurus forkhead box L2 (FOXL2) GAGCTCGCCATGATGCATTGCTCTTACTGGGACCACGACAGCAAGACCGGCGCGCTGCAT A_73_100015 A_73_100015 FALSE EE891661 EE891661 gb|Unidentified transcripts unmapped Unknown CAAGTATACAAAGAAAAGTGGACGTCGGGGTACAAAGCGTGTTCTTCTTTTGTGAACAAA A_73_100016 A_73_100016 FALSE XM_589315 XM_589315 LOC511889 ref|XM_589315 unmapped Bos taurus similar to Homo sapiens centaurin, delta 2 (CENTD2), transcript variant 2 GCTGCCCGGTGCCCCTTCCCCACTTTGGGGACGTTTTGATAATATAAATATATCTGTATA A_73_100017 A_73_100017 FALSE XM_590757 XM_590757 LOC539996 ref|XM_590757 unmapped Bos taurus similar to Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B (SEMA3B), transcript variant 1 CAGCATCTTCCAAGGTTCTGCCGTGTGCGTGTACAGCATGAATGATGTACGCCGGGCCTT A_73_100018 A_73_100018 FALSE XM_613742 XM_613742 LOC540932 ref|XM_613742 unmapped Bos taurus similar to Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila) (FBXW7), transcript variant 1 AGCAGGGAAGATGAACACACACATAGGAACAGTGTCACAAACTCTAATAGTATCGTGGAC A_73_100019 A_73_100019 FALSE NM_001015545 NM_001015545 LGP2 ref|NM_001015545 unmapped Bos taurus likely ortholog of mouse D11lgp2 (LGP2) CCAAGGCCACTTCTATTTTTTGAGATTCTCCATAAATTAAAAATAAAGAAGTGGAAAACG A_73_100020 A_73_100020 FALSE XM_870577 XM_870577 LOC618247 ref|XM_870577 unmapped Bos taurus similar to Homo sapiens zinc finger, MYM-type 6 (ZMYM6) TGAGACTATAATGTACTACTTTATTTTCCTTGCTTTCTAAACCTAACACACTAACTAACA A_73_100021 A_73_100021 FALSE XM_611869 XM_611869 LOC532713 ref|XM_611869 unmapped Bos taurus similar to Homo sapiens calcium /calmodulin-dependent protein kinase (CaM kinase) II delta (CAMK2D), transcript variant 2 CATGGTATCTTCATCAACCTTATTTTAACAGCAGTAATTCACAATCCTCAGAAGCCTATT A_73_100022 A_73_100022 FALSE XM_612571 XM_612571 LOC540667 ref|XM_612571 unmapped Bos taurus similar to Homo sapiens membrane- associated ring finger (C3HC4) 8 (MARCH8), transcript variant 1 TTGAAAAACCTGCACTACCAGAGCCCAACTTTGAAAGTAAAGATGGACGTGGAGTCTGTC A_73_100023 A_73_100023 FALSE XM_613774 XM_613774 LOC534119 ref|XM_613774 unmapped Bos taurus similar to Homo sapiens dystrobrevin, beta (DTNB), transcript variant 1 GCACAGTCCTGCATGAACTAGCATCTTCATCACTCTCCTCCGGGCATGGTCTCATCTCTG A_73_100024 A_73_100024 FALSE XM_864313 XM_864313 LOC537503 ref|XM_864313 unmapped PREDICTED: Bos taurus similar to SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 5 (SWI/SNF-related matrix-associated actin- dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog)... AAGCAGGATTACCCAAATTGTAGTGTCAGGATTTTAGCTGTACCAGAGGCCTTTATGTGC A_73_100025 A_73_100025 FALSE XM_871193 XM_871193 LOC618876 ref|XM_871193 unmapped Bos taurus IgD heavy chain (membrane-bound isoform), constant region TGTGGTCAGCCACGAGGCCTCCCGGACGCTCCTCAATGGCAGCTGCAGCCTGGACACTGG A_73_100026 A_73_100026 FALSE XM_585520 XM_585520 LOC508703 ref|XM_585520 unmapped Bos taurus similar to Homo sapiens PRA1 domain family, member 2 (PRAF2) CCCTGACCAGGAATGGGGCATATATAGCAGTATTGCTGCAACAATAAAGGCTGTTGCATT A_73_100027 A_73_100027 FALSE BM285537 BM285537 gb|Unidentified transcripts on BTA22 position 45118728-45117955 unmapped Unknown CTACAGCAACCCAACTCAAGACTCATCATTGACTTTGCTTCCTTGCCCAAGATAAAAGGG A_73_100028 A_73_100028 FALSE BI536584 BI536584 gb|Unidentified transcripts on BTA3 position 82784887-82784321 unmapped Unknown GCACGCGTCCTTGTTACAAGACCCACAGGCGTTTTCTCCCAGGTGGTGGTTTCTGCTGTT A_73_100029 A_73_100029 FALSE NM_001040473 NM_001040473 GART ref|NM_001040473 unmapped Bos taurus similar to Homo sapiens phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase (GART), transcript variant 1 AGGTGTCCTCTATGCTGGTATAATGCTGACCAAGAACGGCCCCAAAGTTCTGGAATTTAA A_73_100030 A_73_100030 FALSE XM_872277 XM_872277 LOC533279 ref|XM_872277 unmapped PREDICTED: Bos taurus similar to Double- stranded RNA-binding protein Staufen homolog 2, transcript variant 4 (LOC533279) TAAGCTGCTCACTGTTTGCATCCAAAGTGTTCTTTGATAACTGCCTCTGCACTTGGGTCA A_73_100031 A_73_100031 FALSE BM255900 BM255900 gb|Bos taurus similar to Homo sapiens cyclin-dependent kinase 6 (CDK6) unmapped Unknown TTTCTTTGCTTCAGTGACCACACAGCAGTGCTTCTCTACAAAACCACCTTGCTTGAAGCA A_73_100032 A_73_100032 FALSE XM_865195 XM_865195 LOC523640 ref|XM_865195 unmapped PREDICTED: Bos taurus similar to UDP glycosyltransferase 1 family, polypeptide A3 precursor (LOC523640), partial mRNA. CTGACCCTGAAGTACCTTTGCCATTTTTCTTTTGCTCCTTATGCTCATATGGCCTCTGAG A_73_100033 A_73_100033 FALSE EE909649 EE909649 gb|Unidentified transcripts on BTA4 position 18795417-18795986 unmapped Unknown TCTCCATCATTTCTGAATGTAGATCTTGACAGTCAACATGATTTCTGAATTTGGCTTTAC A_73_100034 A_73_100034 FALSE XM_865378 XM_865378 LOC613730 ref|XM_865378 unmapped Bos taurus similar to Homo sapiens polymerase (DNA-directed), epsilon 4 (p12 subunit) (POLE4) TCTGGCCTGGATGCAGCTGCTTGTGGTAGAAATATAGAAAATGGTTTGTGTAGGTTGGTT A_73_100035 A_73_100035 FALSE XM_610919 XM_610919 LOC532402 ref|XM_610919 unmapped Bos taurus similar to Homo sapiens ankyrin repeat domain 9 (ANKRD9) CCTGGCCGCTTCCCCGAGGCCCTGGACGAGCTGCCGCTGCCGCCCTTCCTGCAGCCACTG A_73_100036 A_73_100036 FALSE XM_587169 XM_587169 LOC539441 ref|XM_587169 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 116 (C1orf116) AGTACCAGAGCCAAAAAAGAGTGACTCCATTCAGCTCAGCTCATCCACCTGGGCCCCAAA A_73_100037 A_73_100037 FALSE NM_173969 NM_173969 VIM ref|NM_173969 unmapped Bos taurus vimentin (VIM) AAATCCATATCTTAAAGAAACAGCTTTCAAGTGCCTTTCTGCAGTTTTTTCAGGAGCGCA A_73_100038 A_73_100038 FALSE NM_001034416 NM_001034416 IMPDH1 ref|NM_001034416 unmapped Bos taurus IMP (inosine monophosphate) dehydrogenase 1 (IMPDH1) AGCCTCCATTCGTAAGTGGCAACCCTGTCTACTCCTCTGTCCTTGGGATAGAGGTCTCTC A_73_100039 A_73_100039 FALSE NM_001024536 NM_001024536 CCHCR1 ref|NM_001024536 unmapped Bos taurus coiled-coil alpha-helical rod protein 1 (CCHCR1) CCGCCCTCAGGGACACCAGCCGCCAAGATGTCATGAATTCTCCCGTGGCTCAATAAAGAT A_73_100040 A_73_100040 FALSE XM_605896 XM_605896 LOC527504 ref|XM_605896 unmapped Bos taurus similar to Homo sapiens translin- associated factor X interacting protein 1 (TSNAXIP1) AAGAAGGCATTGTGACACAGCTCCAGACTGCACTAGAACAGCTTCAGATGAGTGACATTA A_73_100041 A_73_100041 FALSE XM_584012 XM_584012 LOC538970 ref|XM_584012 unmapped Bos taurus similar to Homo sapiens chromosome 7 open reading frame 25 (C7orf25) TGGTAATCGCATCTCTTTGACTATGGCTACATTGCATCTTGCATTAAATATCGAGCAACC A_73_100042 A_73_100042 FALSE XM_591933 XM_591933 MEST ref|XM_591933 unmapped Bos taurus similar to Homo sapiens mesoderm specific transcript homolog (mouse) (MEST), transcript variant 1 AGACAGGAAAGTTCCAGAAACTTAAAGAACACAGTCTGAAAGGCCTATGAGCAAATGGTG A_73_100043 A_73_100043 FALSE XM_605172 XM_605172 LOC526798 ref|XM_605172 unmapped Bos taurus similar to Homo sapiens MAM domain containing 2 (MAMDC2) ATATGCTGTGTCTCAACACATCACAGTTGCTGAACAAAGAACAGATGGGACCCTGATCTC A_73_100044 A_73_100044 FALSE XM_613760 XM_613760 LOC534106 ref|XM_613760 unmapped Bos taurus similar to Homo sapiens centaurin, alpha 2 (CENTA2) CTGCAGATCACCTACCGGAGAGATGGCCGCGTTCGGAACCTGTTTGTGTACCACGAGAAT A_73_100045 A_73_100045 FALSE CB442673 CB442673 gb|Unidentified transcripts on BTA19 position 43701216-43701909 unmapped Unknown ATCTTCACACATCTTAACTGTGCCAGGAAGCCATCCTCCTATGTCATTTTGCAGCCGTTT A_73_100046 A_73_100046 FALSE XM_594058 XM_594058 LOC540440 ref|XM_594058 unmapped Bos taurus similar to Homo sapiens SET domain containing 4 (SETD4), transcript variant 1 TGCCACTACAATTTGGACGTAACTGTGGTTTTGGTTTGGCCGACATTCAAATGCCCCAAA A_73_100047 A_73_100047 FALSE NM_174056 NM_174056 FGF2 ref|NM_174056 unmapped Bos taurus fibroblast growth factor 2 (basic) (FGF2) TGCTGTTTCAAAGAACTTGGATTCATTCTTCTAACACCAAAATGCTACAGTCATCAGAAG A_73_100048 A_73_100048 FALSE XM_594682 XM_594682 LOC516527 ref|XM_594682 unmapped PREDICTED: Bos taurus similar to T-cell activation kelch repeat protein (LOC516527) GAGAGAAGTGATTGTCGATGGAAGCGCAATGAGATCCCCAGCCCCTCCCCAGCGTGAAAA A_73_100049 A_73_100049 FALSE XM_865414 XM_865414 LOC512350 ref|XM_865414 unmapped Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa (EIF2S3) TTACAATCAAGCTTGGGTATGCTAATGCCAAGATTTACAAACTTGATGATGAAAGTTGTC A_73_100050 A_73_100050 FALSE CB462967 CB462967 gb|Unidentified transcripts unmapped Unknown AATGAACTAGCCTCAGTAGCCACTACAGAATCCCATCATTTGCTTAAATATTCTTGTACT A_73_100051 A_73_100051 FALSE NW_928144 NW_928144 gb|Putative orthologue of human miRNA hsa-mir-190 on chr 15, (+) strand. Mature length 22 nt, stem-loop length 85 nt. Source: NW_928144.1:1604464-1604548 unmapped Unknown TGATATGTTTGATATATTAGGTTATCCTACTATACGTATCACATA A_73_100052 A_73_100052 FALSE NW_001011209 NW_001011209 gb|Putative orthologue of human miRNA hsa-mir-497 on chr 17, (-) strand. Mature length 21 nt, stem-loop length 112 nt. Source: NW_001011209.1:349-460 unmapped Unknown CAGCAGCACACTGTGGTTTGTTATCCTACTATACGTATCACATAG A_73_100053 A_73_100053 FALSE XM_870638 XM_870638 LOC618308 ref|XM_870638 unmapped PREDICTED: Bos taurus similar to ADAM metallopeptidase with thrombospondin type 1 motif, 17 preproprotein (LOC618308) ATGGCAATGAGTGCCCTGCCCTCTCCAAGCCAGCCGCCTACAAACAGTGCCACCAGGGAA A_73_100054 A_73_100054 FALSE CB437706 CB437706 gb|Bos taurus similar to Homo sapiens chromosome 4 open reading frame 22 (C4orf22) unmapped Unknown GAATGACTCCTATAACCAGAAGCAAATCAGAATAATAAGTGAGTCCAGTAGCTATAAGGC A_73_100055 A_73_100055 FALSE EE907157 EE907157 gb|Bos taurus similar to Homo sapiens kinesin family member 3C (KIF3C) unmapped Unknown CCTGCAGGCCCCAGCCCTGTTCAAATTAACACAGTCGATAATAAAGGAATGAGTATCGTT A_73_100056 A_73_100056 FALSE NM_001035331 NM_001035331 NUDT21 ref|NM_001035331 unmapped Bos taurus similar to Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 21 (NUDT21) TTTTGATGTTATCTCTTTCCCAGTCCTGAAATTAGCACCTGCTTTCTATTGTCTGAATAG A_73_100057 A_73_100057 FALSE XM_593491 XM_593491 LOC515466 ref|XM_593491 unmapped Bos taurus similar to Homo sapiens SLAM family member 7 (SLAMF7) TTCCCTTCCCTCCCATTCCTGAAGAGATGCCCGAGTATGATACAATCTCTACTTTTAATG A_73_100058 A_73_100058 FALSE AW484021 AW484021 gb|Bos taurus similar to Homo sapiens WD and tetratricopeptide repeats 1 (WDTC1) unmapped Unknown GTTGCTCCGCTCCCAGGAGAGTGAGGGTGACGCAACTGATTAAAACCATTTTGTTCTAGG A_73_100059 A_73_100059 FALSE XM_609164 XM_609164 LOC530688 ref|XM_609164 unmapped Bos taurus similar to Homo sapiens ribonuclease P 25kDa subunit (RPP25) AGGGACGTCTCCATAGGCTCTTTTAACATCCCACTTTCCCCATGCTGGCCCAGAGGGAGA A_73_100060 A_73_100060 FALSE XM_582024 XM_582024 LOC444872 ref|XM_582024 unmapped Bos taurus similar to Homo sapiens heparan sulfate proteoglycan 2 (perlecan) (HSPG2) CCTACTCCTTCCTGCCGCTGCCCACCATCAAGGACGCCTACAGGAAGTTTGAGATCAAGA A_73_100061 A_73_100061 FALSE XM_868024 XM_868024 LOC523970 ref|XM_868024 unmapped PREDICTED: Bos taurus similar to amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 (LOC523970) AATGTAGAAAGGGGAGGGTGAACGAATGGAAACAGGATTAGCATGAGGTCTGTCTGATAA A_73_100062 A_73_100062 FALSE XM_871115 XM_871115 LOC618792 ref|XM_871115 unmapped Bos taurus similar to Homo sapiens WW domain containing oxidoreductase (WWOX), transcript variant 1 TTCCGCATCCTCTCGTCCCTTCCATCCTACGCTTAATAAAAGAACATGCTTGAATATGAT A_73_100063 A_73_100063 FALSE XM_874915 XM_874915 LOC613851 ref|XM_874915 unmapped PREDICTED: Bos taurus similar to zinc transporter like 2, transcript variant 5 (LOC613851) CTCTAATCATCTGGAATGTCTTCACTGAAGCTGCTGGAAACCACTGCTTTCATTCCCACA A_73_100064 A_73_100064 FALSE BI537859 BI537859 gb|Bos taurus similar to Homo sapiens chromosome 10 open reading frame 46 (C10orf46) unmapped Unknown GTGCTCTTTAGTTCCTTAGTGCTCTTTAGTCCTATAAAAGACTCTGAAGCTTACCCTATT A_73_100065 A_73_100065 FALSE NM_174653 NM_174653 SLC18A2 ref|NM_174653 unmapped Bos taurus solute carrier family 18 (vesicular monoamine), member 2 (SLC18A2) TTACCGGATGACAAAGACTGAGAAAGAAACACCTTATACTATCAGGATTGTTGAAGCATG A_73_100066 A_73_100066 FALSE CB172059 CB172059 gb|Unidentified transcripts unmapped Unknown AGGTGTCCAGTGACATTTTGAATCCATGCTGCACTTTCTTGCACAGTGGGCTGAAAATGT A_73_100067 A_73_100067 FALSE BI536018 BI536018 gb|Bos taurus similar to Homo sapiens cannabinoid receptor 1 (brain) (CNR1), transcript variant 1 unmapped Unknown ACATCCCATCATGTCTGTTGTCCAAAGTTACCTGGAATCAAATAAAAATCCTAGATTATC A_73_100068 A_73_100068 FALSE XM_585339 XM_585339 LOC539164 ref|XM_585339 unmapped Bos taurus similar to Homo sapiens intraflagellar transport 172 homolog (Chlamydomonas) (IFT172) AGCACCAGCTTCTCTTTCCAGTAACTGGGAGAGTCAGTAGGTTCCATCCTTCATTAAAGT A_73_100069 A_73_100069 FALSE CB446516 CB446516 gb|Unidentified transcripts unmapped Unknown TAACTGGCTTGGGTTTAGGACCTATGTATAGAGGCCACCAATTTCTTTTAATAACTGTGG A_73_100070 A_73_100070 FALSE AW668970 AW668970 gb|Bos taurus similar to Homo sapiens host cell factor C1 (VP16-accessory protein) (HCFC1) unmapped Unknown AGTAACCCTTGTGACTCAATATTACCATAGTGCGATGTCGTTTTGTGCTATTTTGAACAA A_73_100071 A_73_100071 FALSE XM_588725 XM_588725 LOC511397 ref|XM_588725 unmapped Bos taurus similar to PREDICTED: Homo sapiens zinc finger, CCHC domain containing 4, transcript variant 1 (ZCCHC4) TTGGACTTAAATTCTGTTGCTTTCAAAGGTATGCACCTTTCTAAGCTTGAAAATGAGGAG A_73_100072 A_73_100072 FALSE XM_613518 XM_613518 LOC540868 ref|XM_613518 unmapped PREDICTED: Bos taurus similar to Cytochrome P450 26B1 (P450 26A2) (P450 retinoic acid-inactivating 2) (P450RAI-2) (Retinoic-acid metabolizing cytochrome) (LOC540868) ACGGCCTCAGCGTCAAGTTCTTCGGCCTGGACTCTAACCAGAACAAGATCCTGCCAGAGA A_73_100073 A_73_100073 FALSE XM_585369 XM_585369 LOC508577 ref|XM_585369 unmapped Bos taurus similar to Homo sapiens zinc finger, MYND-type containing 17 (ZMYND17) ATATACTGCAGTTTGTTATCACTTGGTCTACACCACAATAAATTCAGTTTGGGGCTTCTT A_73_100074 A_73_100074 FALSE XM_869354 XM_869354 LOC617153 ref|XM_869354 unmapped PREDICTED: Bos taurus similar to Metabotropic glutamate receptor 5 precursor (mGluR5) (LOC617153) TCTTCTAGTGGCCTTAGAAAATATGGGCTTTTACAAAACACCGCTTCTACTTTTGAGGGC A_73_100075 A_73_100075 FALSE EE909420 EE909420 gb|Bos taurus similar to Homo sapiens POU domain, class 3, transcription factor 3 (POU3F3) unmapped Unknown CTGGACTGACTCAGATCAAGGGATTTAGAAAGACAGCACTTCTCCGGACTCCTGCCTTCA A_73_100076 A_73_100076 FALSE BE753766 BE753766 gb|Bos taurus similar to Homo sapiens TANK-binding kinase 1 (TBK1) unmapped Unknown TTTTTTGAGAAGGATAAAGTGGCATTATCCCAGTTATCCTCCTGTCTGTTTAATTTCAGG A_73_100077 A_73_100077 FALSE XM_871227 XM_871227 LOC618910 ref|XM_871227 unmapped PREDICTED: Bos taurus similar to KIAA1683 (LOC618910) GCTTACTGGTGGGGGGATGCCAGGGGAGGGGCCGCATGGCTCTCTGGGTTTCATGAATAA A_73_100078 A_73_100078 FALSE XM_592202 XM_592202 LOC514365 ref|XM_592202 unmapped Bos taurus similar to Homo sapiens XK, Kell blood group complex subunit-related family, member 8 (XKR8) TGCAGAACAGACGCATGGCCCACCTGGCTAAGAACTTTTTCCCCAAGGCGAGGGATGAAG A_73_100079 A_73_100079 FALSE NM_176660 NM_176660 NDUFB7 ref|NM_176660 unmapped Bos taurus NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa (NDUFB7) CAGTCAAGAAATAAAAGCCTCCAGGCCCCTCGGCCCAAGTTCCAAAAAGCTTCTTTTATA A_73_100080 A_73_100080 FALSE BI540952 BI540952 gb|Bos taurus similar to Homo sapiens adrenergic, alpha-1B-, receptor (ADRA1B) unmapped Unknown GCACAGCCTCCATTCTAAGCCTGTGCGCCATCTCCATCGACCGCTACATTGGGGTGCGCT A_73_100081 A_73_100081 FALSE EE937047 EE937047 gb|Unidentified transcripts on BTA19 position 41679270-41680101 unmapped Unknown AGAAGGACGAGGCAGGTGGGCATGATGTTAAATGTTGAGAAGGCCAAAATAAGGCTTTCA A_73_100082 A_73_100082 FALSE NM_177495 NM_177495 DNTT ref|NM_177495 unmapped Bos taurus deoxynucleotidyltransferase, terminal (DNTT) CTCATTTCCAGGGAAGTTCATCAAAGCCCACTTTGCCCACAGTGTAGCTGAAATACTGTA A_73_100083 A_73_100083 FALSE AV596340 AV596340 gb|Unidentified transcripts on BTA18 position 52859628-52859967 unmapped Unknown AACTCCCCTGCTAAATGTACTTATCAGATGGAAATAAATCAAGTCTCTGTTTATAAGGTC A_73_100084 A_73_100084 FALSE NM_001038187 NM_001038187 MGC134524 ref|NM_001038187 unmapped Bos taurus similar to Homo sapiens interleukin enhancer binding factor 2, 45kDa (ILF2) CCAGCTCCTGAAACCTCTCTCAGCCAGTACTTTGTTGTTGAAATGTTGTGAACTGTGTTT A_73_100085 A_73_100085 FALSE NM_001040592 NM_001040592 FLJ14525 ref|NM_001040592 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 198 (C1orf198) CATTGCACCCCCGTGGGTGTCAGAACAGCCTCTTCTTTGATACACATTTTCAAAAACGAA A_73_100086 A_73_100086 FALSE XM_864796 XM_864796 ADSS ref|XM_864796 unmapped Bos taurus similar to Homo sapiens adenylosuccinate synthase (ADSS) AAGGTGTTATTTTGACTATTTGGCTTAACGTACTGCGTTGTAGATTATCCTTCAATGAAC A_73_100087 A_73_100087 FALSE XM_875663 XM_875663 LOC541143 ref|XM_875663 unmapped PREDICTED: Bos taurus similar to putative transcription factor ZNF131, transcript variant 5 (LOC541143) ATATCAGGCTTTGTTTTGAATGAATCTTTTCCCCCAATCCTTAATGTAAAGATCTTGTGC A_73_100088 A_73_100088 FALSE XM_603378 XM_603378 LOC525035 ref|XM_603378 unmapped PREDICTED: Bos taurus similar to lipoxygenase homology domains 1 (LOC525035) AAGAGGAAGTACTTCAAGGTCTTCGAGGTCACCAAGACTACGGAGAGCTTTGCCAGCAAG A_73_100089 A_73_100089 FALSE XM_582303 XM_582303 LOC505935 ref|XM_582303 unmapped Bos taurus similar to Homo sapiens glutaredoxin 5 homolog (S. cerevisiae) (GLRX5) CCCCCCAGTTTTTCATGACTCATTCTGTTAAGAAAACTGATGGGCAAGGAAGAAAATAAG A_73_100090 A_73_100090 FALSE XM_584702 XM_584702 LOC539083 ref|XM_584702 unmapped Bos taurus similar to Homo sapiens fibroblast growth factor 20 (FGF20) TGCCTAGACCAGTGGATCCAGAAAGAGTTCCTGAACTGTACAAGGACCTACTTATGTACA A_73_100091 A_73_100091 FALSE XM_880625 XM_880625 LOC514387 ref|XM_880625 unmapped Bos taurus similar to Homo sapiens thyroid hormone receptor interactor 12 (TRIP12) CTTTGCTGTGTGAAATTTAAAAAAGGGATGTTTTTCCAGGCTGAAACAATAAATGTCGCT A_73_100092 A_73_100092 FALSE XM_581054 XM_581054 LOC504869 ref|XM_581054 unmapped Bos taurus similar to Homo sapiens ataxia telangiectasia and Rad3 related (ATR) ACCTTATACAAGAAGCTACTGATGAAAACTTGCTATGCCAGATGTACCTTGGTTGGACCC A_73_100093 A_73_100093 FALSE XM_613451 XM_613451 LOC533892 ref|XM_613451 unmapped Bos taurus similar to Homo sapiens ribosomal protein S9 (RPS9) AAGGTAATGCCCTGTTGCGGCGGCTCGTCCGTATCGGGGTGCTGGATGAGGGCAAGATGA A_73_100094 A_73_100094 FALSE NM_001015548 NM_001015548 RPS6 ref|NM_001015548 unmapped Bos taurus ribosomal protein S6 (RPS6) GAGGCTGTCCTCTCTGAGAGCTTCTACTTCTAAGTCTGAGTCCAGTCAAAAATGAGATGT A_73_100095 A_73_100095 FALSE XM_612610 XM_612610 LOC540677 ref|XM_612610 unmapped Bos taurus similar to Homo sapiens synaptotagmin XVI (SYT16) GTACCATGAAGCGTAAAGAGATGATTGGTTGGATTGCTTTGGGTCAAAACAACAGTGGAG A_73_100096 A_73_100096 FALSE NM_001034487 NM_001034487 RBM7 ref|NM_001034487 unmapped Bos taurus similar to Homo sapiens RNA binding motif protein 7 (RBM7) CCTTGTAAAATTTGAGTCCTTTTTAATAACTACAGCATTTGTACTATGTTGCTTTTTAAT A_73_100097 A_73_100097 FALSE CB220453 CB220453 gb|Unidentified transcripts unmapped Unknown AACCCTTAACTCTTCAGCACAGTTCTCACAGCTTTCTGAAAGACTGTCTCCCTGGTTATA A_73_100098 A_73_100098 FALSE NM_174753 NM_174753 PTHLH ref|NM_174753 unmapped Bos taurus parathyroid hormone-like hormone (PTHLH) GCATTGGAATAAAACTGTCTCCCCCATTGCTCTATGAAACTGCACATTGGTTATTGTGAA A_73_100099 A_73_100099 FALSE XM_870080 XM_870080 LOC518635 ref|XM_870080 unmapped Bos taurus similar to Homo sapiens hypothetical protein ET (ET) TTTCCCTTGTGGTTCAGATACTAAAGAATCTGTCTGTAGTGCAGGAGACCTGCGTTTGAT A_73_100100 A_73_100100 FALSE CB424656 CB424656 gb|Unidentified transcripts unmapped Unknown ACTGAGTAGTTCCAGCACCATGGATTCCTCATTTTGTCTTTCTATGTCTGTACCCACCTC A_73_100101 A_73_100101 FALSE CB170894 CB170894 gb|Bos taurus similar to Homo sapiens 3-oxoacid CoA transferase 1 (OXCT1), nuclear gene encoding mitochondrial protein unmapped Unknown ATTTGTAAACTTACTTCTTCTGTGATTCTAAGAAAGCTCCTCATGTTGAGTGGCAAATTC A_73_100102 A_73_100102 FALSE BM446421 BM446421 gb|Unidentified transcripts on BTA16 position 41296368-41297020 unmapped Unknown TAGGGAAAGTTGGAGCCGCCCCAGCCTGGAGCTGGGGAGTATTGTGTGGAGTGAATGAAA A_73_100103 A_73_100103 FALSE XM_611956 XM_611956 LOC540535 ref|XM_611956 unmapped Bos taurus similar to Homo sapiens popeye domain containing 2 (POPDC2) TGATGTTTTGCTATTCATTCCCAAAGCTGCTGGAAGCATTCCTCCCAAGAAAGGTGGAGT A_73_100104 A_73_100104 FALSE XM_602920 XM_602920 LOC524593 ref|XM_602920 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to opposite strand transcription unit to Stag3 (LOC402670) TTCAAGTTCGACCACGCACTGGTACCGGAAGAAAACATCAACGGCGTCATCAGCGCCCTG A_73_100105 A_73_100105 FALSE NM_001038025 NM_001038025 MGC134463 ref|NM_001038025 unmapped Bos taurus similar to Homo sapiens histone deacetylase 5 (HDAC5), transcript variant 1 GTGACGCCCTGGCCCCCATCTCTCTGGGCTTCATCATTGTGATTTTGTTTATTTTTTCTA A_73_100106 A_73_100106 FALSE CB166415 CB166415 gb|Bos taurus similar to Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre- Chotzen syndrome) (Drosophila) (TWIST1) unmapped Unknown GGTAACGGTCAGAGGGATTTTAAGAACACCTTTAGAAATAAAAATATTGGGATCAAACTG A_73_100107 A_73_100107 FALSE XM_582062 XM_582062 LOC505725 ref|XM_582062 unmapped PREDICTED: Bos taurus similar to G antigen family C 1 protein (Prostate-associated gene protein 4) (PAGE-4) (PAGE-1) (JM27) (GAGE-9), transcript variant 1 (LOC505725) GAAGACAAACTGAAGCCATAAATACTGTTATGTTGATTATTTGGCTTGATCAGTTCTCTC A_73_100108 A_73_100108 FALSE NM_001038170 NM_001038170 MGC134356 ref|NM_001038170 unmapped Bos taurus similar to Homo sapiens galactokinase 2 (GALK2), transcript variant 1 TTTTAAAGGCACGTGGTAAAAGACCATCGATACTGGTACCTCACAGATTGTACCTGAATT A_73_100109 A_73_100109 FALSE XM_869574 XM_869574 LOC617336 ref|XM_869574 unmapped Bos taurus similar to Homo sapiens transmembrane protein 46 (TMEM46) GCTGCAGACGGGCTACAGGCAGCTCCAGGCTCCCTTCCCTCACACTAACAGCGAACAGAA A_73_100110 A_73_100110 FALSE XM_595691 XM_595691 LOC517519 ref|XM_595691 unmapped Bos taurus similar to Homo sapiens cholinergic receptor, nicotinic, beta 2 (neuronal) (CHRNB2) AGCTCCATGCTCCTTCAGCCCCTCTGTTGGACAGTAGTTTTGGGTGGAGGAGAGATGCGT A_73_100111 A_73_100111 FALSE NM_001024563 NM_001024563 KCNB2 ref|NM_001024563 unmapped Bos taurus potassium voltage-gated channel, Shab-related subfamily, member 2 (KCNB2) AAACTTGTTTCTTAAAAATGCGGTTAATAAGGCCTGTGAACTAAAACGTGGGAAGCCCCT A_73_100112 A_73_100112 FALSE XM_863879 XM_863879 LOC521706 ref|XM_863879 unmapped Bos taurus similar to Homo sapiens intersectin 2 (ITSN2), transcript variant 3 GCGTTGTCATAGGACATGCATCTTTAAGCTTTATCATTGCCAATATGTACAGAAAGAGAA A_73_100113 A_73_100113 FALSE XM_591009 XM_591009 LOC540027 ref|XM_591009 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein FLJ21438 (FLJ21438) AAGGATACCATCCAGAACCTGCAGCTTCTTCCCAGGACATCGGAGTCCCAGAGCCAGCCC A_73_100114 A_73_100114 FALSE XM_581198 XM_581198 LOC504986 ref|XM_581198 unmapped Bos taurus similar to Homo sapiens polycystic kidney disease 1 (autosomal dominant) (PKD1), transcript variant 2 TCCACTGGGCATGGCCGAAGCTACAGCCTAGATCCCACCCCCTAACAGACGAAGTCAAAT A_73_100115 A_73_100115 FALSE BF600213 BF600213 gb|Bos taurus similar to Homo sapiens ethanolamine kinase 1 (ETNK1), transcript variant 1 unmapped Unknown TTTGTTCTGTGGTTAAAATGGGGTTGCCAGTGAATAAAATTAAAAACAGCCTCATTCATG A_73_100116 A_73_100116 FALSE XM_870743 XM_870743 LOC618413 ref|XM_870743 unmapped Bos taurus similar to Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) (ERBB2), transcript variant 1 TGGGATTGGGGGAGGGATGTCCTCCACACTCACTTTCTCCATTTGCAAATATATTTTGGA A_73_100117 A_73_100117 FALSE XM_870238 XM_870238 LOC617906 ref|XM_870238 unmapped Bos taurus similar to Homo sapiens processing of precursor 7, ribonuclease P subunit (S. cerevisiae) (POP7) CAGCCCCAGTGTTTGTTTTAAAATATTTCATCCTTGCAGAAGAAGGCAGAGAGAATAAGT A_73_100118 A_73_100118 FALSE NM_001034236 NM_001034236 CENPH ref|NM_001034236 unmapped Bos taurus similar to Homo sapiens centromere protein H (CENPH) TTTTTTGCCTTTTTTAAAAAATCGAGGGGACTTCCTTGGTGTTCCAATGGCTGAGACTCC A_73_100119 A_73_100119 FALSE XM_581354 XM_581354 LOC538595 ref|XM_581354 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 89 (CCDC89) TGCAGTCCGAAGCTTTCAAAAAGCACAGCCTGGATCTTTTAAGCAAGGAGAGAGAACTCA A_73_100120 A_73_100120 FALSE NM_001035291 NM_001035291 COMMD7 ref|NM_001035291 unmapped Bos taurus similar to Homo sapiens COMM domain containing 7 (COMMD7) TCAGCTTGTTTTGGTTCAAGCTGACCTTCTGTGGTGGTTAGCTGAAGAATAAAGATTCTG A_73_100121 A_73_100121 FALSE NM_001015585 NM_001015585 RAE1 ref|NM_001015585 unmapped Bos taurus RAE1 RNA export 1 homolog (RAE1) CAGAGAACATTGGGAAACATTTGGCGAGCCTGTACTGTATTTTGTAATAAACATTTTGAA A_73_100122 A_73_100122 FALSE XM_587703 XM_587703 LOC510550 ref|XM_587703 unmapped Bos taurus similar to Homo sapiens KIAA1530 protein (KIAA1530) AGACTTCCAAGACGTGGATGCTCGCACTGTGGCAGAAAGAAAGCGAGCAGAAGAGAGACA A_73_100123 A_73_100123 FALSE XM_581235 XM_581235 LOC505012 ref|XM_581235 unmapped Bos taurus similar to Homo sapiens glucose-6-phosphatase, catalytic, 2 (G6PC2) TAAAAGTGCGTCCATCCCACTGACTGTGGTTGCCCTGATTCCCTACTGTATTCATATGTT A_73_100124 A_73_100124 FALSE CB429702 CB429702 gb|Unidentified transcripts on BTA14 position 26221213-26220306 unmapped Unknown TCAGTTGCGAAGAGTAATCATAAGCTCCATCACAGTATGTGAAAAGCCAAGATACAGAAA A_73_100125 A_73_100125 FALSE XM_617081 XM_617081 LOC536930 ref|XM_617081 unmapped Bos taurus similar to Homo sapiens chromosome 15 open reading frame 27 (C15orf27) CCTCCTTCGAGCCTCCCTTGGATGGATTGTGAGGAAGAAATCTCCTTTTGGAAGCACCCA A_73_100126 A_73_100126 FALSE NM_177956 NM_177956 ECE2 ref|NM_177956 unmapped Bos taurus endothelin converting enzyme 2 (ECE2), transcript variant 2a-2 GAGGGAGTGGTCTGGCCCCTGGAGGACCCTGTGCCAATAAATAGACACGCATCAGTCAAA A_73_100127 A_73_100127 FALSE XM_865044 XM_865044 LOC613862 ref|XM_865044 unmapped Bos taurus similar to Homo sapiens tubby like protein 1 (TULP1) CCGAGTCACCCAGGCCTCAGTCAAGAATTTCCAGATTGTCCACGCTGATGACCCCGACTA A_73_100128 A_73_100128 FALSE AW463595 AW463595 gb|Unidentified transcripts on BTA16 position 55955310-55956072 unmapped Unknown AATACTTTTATTTTGTTATGCTTCAAATACACATACTACGAAGACTCTGTTGTTAGCTTT A_73_100129 A_73_100129 FALSE XM_614113 XM_614113 LOC541016 ref|XM_614113 unmapped Bos taurus similar to Homo sapiens splicing factor, arginine/serine-rich 15 (SFRS15) AGGTAACGGTGAAAGCTCCTCAAAAAACAATAGGGATGTTTTTAATAAACTCTATTCTCG A_73_100130 A_73_100130 FALSE NM_001035050 NM_001035050 VTN ref|NM_001035050 unmapped Bos taurus similar to Homo sapiens vitronectin (VTN) TCTTCTCAGAAGACAAGTACTACCGAGTGAACCTTCGCACACGGCGGGTGGACGCTGTGA A_73_100131 A_73_100131 FALSE XM_868118 XM_868118 LOC513830 ref|XM_868118 unmapped PREDICTED: Bos taurus chromobox-like protein 6, transcript variant 2 (LOC513830) CACTGCTGGGCAACATCCTCCCATGGGAGGACAAGCTAGTGGAGGCCTTTGGGGGTGCAA A_73_100132 A_73_100132 FALSE NW_930042 NW_930042 gb|Putative orthologue of human miRNA hsa-mir-382 on chr 14, (+) strand. Mature length 22 nt, stem-loop length 76 nt. Source: NW_930042.1:566877-566952 unmapped Unknown GAAGTTGTTCGTGGTGGATTCGTATCCTACTATACGTATCACATA A_73_100133 A_73_100133 FALSE EE893412 EE893412 gb|Unidentified transcripts on BTA17 position 33759368-33758555 unmapped Unknown TCTGCTGGGCTGTTGATTATGACATTTTTATATTAAAGTATTACATCCTTAACAGGCTGG A_73_100134 A_73_100134 FALSE NM_174134 NM_174134 OXTR ref|NM_174134 unmapped Bos taurus oxytocin receptor (OXTR) GATTCTCTTCGGAGACTGTCTGGCACAGGCAGCCAAGTAAAACTTGGGTTAAAAGTGTTT A_73_100135 A_73_100135 FALSE XM_596500 XM_596500 LOC518312 ref|XM_596500 unmapped PREDICTED: Bos taurus similar to RAB36, member RAS oncogene family (LOC518312) CTGTTACGGCGTCTCTTCTGAAGCGGCCGTGGGCCCACTGATCCCACAAGTCCACAGAGA A_73_100136 A_73_100136 FALSE XM_590537 XM_590537 LOC512927 ref|XM_590537 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 118 (C20orf118) GACCGGAAGCAACTCTTTCTTTGTGAAAGGCGACTTGGATTCTCTGATGATGGGCTGTGG A_73_100137 A_73_100137 FALSE NM_001034430 NM_001034430 MGC127618 ref|NM_001034430 unmapped Bos taurus similar to Homo sapiens PDZ and LIM domain 2 (mystique) (PDLIM2), transcript variant 2 TCAACATATGAGCACTAAAAATATATACTGTACGTGAACAAAATAAAGTAGGTGCCCCTC A_73_100138 A_73_100138 FALSE BF043494 BF043494 gb|Bos taurus similar to Homo sapiens core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (CBFA2T3), transcript variant 2 unmapped Unknown CACAAAGAAAAGCAATTTGCCCTCCCTGCACCTTCTGGAGACTTGACCAGCTGTATATAA A_73_100139 A_73_100139 FALSE AW479006 AW479006 gb|Unidentified transcripts unmapped Unknown CACTGCCCTGTTGCCAGCCCAGCATCATTCCTGTATATAAACCGTATGATGTACTTTTCT A_73_100140 A_73_100140 FALSE XM_616395 XM_616395 LOC536269 ref|XM_616395 unmapped Bos taurus similar to Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like (MTHFD2L) CAAAAGACATATTAATACATCTCTGGTCAATAATGTGTTAAAAGAGATGACCGAGGATGG A_73_100141 A_73_100141 FALSE NM_001040520 NM_001040520 LOC513128 ref|NM_001040520 unmapped Bos taurus similar to Homo sapiens ribosomal protein L7a (RPL7A) GAAGGCCAAAGAGCTGGCCACCAAGCTGGGCTGAGCGCACTAGGGAGTTTACTGTACATA A_73_100142 A_73_100142 FALSE XM_590458 XM_590458 LOC512863 ref|XM_590458 unmapped Bos taurus similar to Homo sapiens sialic acid binding Ig-like lectin 5 (SIGLEC5) TGTGTTATGACAGTATCTTTGTTATGACAAAGAGTAAATTCCATTGAAAAGAGAACAAAA A_73_100143 A_73_100143 FALSE BI534528 BI534528 gb|Unidentified transcripts unmapped Unknown TGCTGCCATTTACAATGTGCCTCTGTTTTATTCAGAATGTGTCATAAGTCTTGTGCACTA A_73_100144 A_73_100144 FALSE XM_585197 XM_585197 LOC539146 ref|XM_585197 unmapped PREDICTED: Bos taurus similar to Lysophosphatidylcholine receptor G2A (G2 accumulation protein) (G-protein coupled receptor 132) (LOC539146) GTGAAAGACCCTAAGACATGTGATTTCACATCTGGGAATAAAAACACACGAGTCCGCCAA A_73_100145 A_73_100145 FALSE NM_174542 NM_174542 GABRA3 ref|NM_174542 unmapped Bos taurus gamma-aminobutyric acid (GABA) A receptor, alpha 3 (GABRA3) AGCCTGACCTTTACCTCTCTGTAGAAATTGTGTTTCCAAATGCTTTGGTGCAATGTTTAG A_73_100146 A_73_100146 FALSE XM_586851 XM_586851 LOC509808 ref|XM_586851 unmapped PREDICTED: Bos taurus similar to Endothelial lipase precursor (Endothelial cell-derived lipase) (EDL) (EL) (LOC509808), partial mRNA. CAGTGCCCTTTCTGTGCTGAACTTCTTCGAAAAGCCCCTACTTCTAGATCTTGGTTTGAA A_73_100147 A_73_100147 FALSE XM_608143 XM_608143 LOC529689 ref|XM_608143 unmapped PREDICTED: Bos taurus similar to ATPase, Class VI, type 11C isoform a (LOC529689) TGGTTCTAACAATTACAAAAGCATTTTCCTACAGATCTGCATGAAGTGCACAGCAGTGCT A_73_100148 A_73_100148 FALSE XM_866188 XM_866188 LOC523324 ref|XM_866188 unmapped Bos taurus similar to Homo sapiens ralA binding protein 1 (RALBP1) GCATTGGTAAACTAATTTTTGCCAGGACCATTATTGATCAAGCAAATAAATTCAACAGCC A_73_100149 A_73_100149 FALSE NM_176619 NM_176619 PAG8 ref|NM_176619 unmapped Bos taurus pregnancy-associated glycoprotein 8 (PAG8) CAGGGATGCTGGTGAACTATGCCTGATGCTCTGCAAAGCCGTATTCTCAGTAAAGAATAA A_73_100150 A_73_100150 FALSE XM_595296 XM_595296 LOC517133 ref|XM_595296 unmapped Bos taurus similar to Homo sapiens KIAA0100 (KIAA0100) TCCCCAAACTGCCAACCTCACTTTGGAGAATGGCAGTAGGAGACAGGGCTGGCCATGGAT A_73_100151 A_73_100151 FALSE XM_589847 XM_589847 LOC512342 ref|XM_589847 unmapped Bos taurus similar to Homo sapiens selenocysteine lyase (SCLY) GGCCCCCGGCCTCAAGAGAAAGGTCACTTTCTATGACCCCCAATAAACCGGACCCAATGT A_73_100152 A_73_100152 FALSE XM_616301 XM_616301 LOC536180 ref|XM_616301 unmapped Bos taurus similar to Homo sapiens chromosome 10 open reading frame 59 (C10orf59), transcript variant 2 CACATTTGGAACACAGCACTGAGGATGTGCAGGAGTTAATCTTCAAGCAGCTGGAAAACA A_73_100153 A_73_100153 FALSE XM_866126 XM_866126 LOC532701 ref|XM_866126 unmapped Bos taurus similar to Homo sapiens similar to splicing factor, arginine/serine-rich 4 (FLJ11021), transcript variant 1 TTTAAGAACAACTACGCTATAGGCAATACCATGGTGAGCAAAAATGTAAAAAGGAAGTTG A_73_100154 A_73_100154 FALSE NM_177511 NM_177511 GGTA1 ref|NM_177511 unmapped Bos taurus alpha-galactosyltransferase 1 (glycoprotein) (GGTA1) TGCCAGTACATTTCTGAATTTGAGAGAGTATTATTCTGGCTACTTCCTCAGAAAAGTAAC A_73_100155 A_73_100155 FALSE CB427436 CB427436 gb|Unidentified transcripts on BTA23 position 13338652-13337526 unmapped Unknown ATGTTGAGGAGTCTATGTAAAGAGGAACCGTGGGCAGCTTCTAGAAACTTTGGGCAACTT A_73_100156 A_73_100156 FALSE XM_587442 XM_587442 LOC510313 ref|XM_587442 unmapped Bos taurus similar to Homo sapiens BUD13 homolog (yeast) (BUD13) GCTTTCAGAGGAAGTGTTGATTTCTCTGTGTCCCAGGGCTTGTTCTTGGTTAGGGTATTT A_73_100157 A_73_100157 FALSE NM_174754 NM_174754 ATP6V0A1 ref|NM_174754 unmapped Bos taurus ATPase, H+ transporting, lysosomal V0 subunit a isoform 1 (ATP6V0A1) AGCAGAGTTCTGTATCAGGAATCCTGCCAAGGTCCCTCTGTTCAGACATGCCTGTGCTGA A_73_100158 A_73_100158 FALSE XM_607166 XM_607166 LOC528735 ref|XM_607166 unmapped Bos taurus similar to Homo sapiens S100 calcium binding protein A1 (S100A1) CAAGAATAGTGGGCCAGGCCTGCAACTCCTCTTTCATTAAAGGCTTCTGTCTCCCCAGCC A_73_100159 A_73_100159 FALSE XM_593042 XM_593042 LOC515088 ref|XM_593042 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor kinase interactor 1 (GIT1) CCAGGCTCTACCTGTGTGGTGGTGGGTGGGCTGACTGTCAAGACGTGTGTCATGTACATT A_73_100160 A_73_100160 FALSE XM_868071 XM_868071 LOC509566 ref|XM_868071 unmapped Bos taurus similar to Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 3 GTGTTGTCTGTGTACGCTAACTCCACCGTTTCCAGCCTACTGCCAATAAACAGCTATTTA A_73_100161 A_73_100161 FALSE XM_872546 XM_872546 LOC515169 ref|XM_872546 unmapped Bos taurus similar to Homo sapiens phosphoribosyl pyrophosphate synthetase 1 (PRPS1) TTCAGCCATGTCCCTTTATAATACAATAACTCCTGAGGCTTTTCAAAAATAAAGTGAGCC A_73_100162 A_73_100162 FALSE NM_181011 NM_181011 FDX1 ref|NM_181011 unmapped Bos taurus ferredoxin 1 (FDX1) TCTGGAGGACGGGGGGCTTGAGCTTAAACACATCCATGCATGGCAGATATTTGTATTTTA A_73_100163 A_73_100163 FALSE XM_589904 XM_589904 LOC512391 ref|XM_589904 unmapped Bos taurus similar to Homo sapiens hypothetical protein LOC348262 (LOC348262) ATTCAAGTGTCTGACTGGAACCTGAAGACCAGTAAATAAAGGTGGGGTGGCATTGGCTTG A_73_100164 A_73_100164 FALSE XM_592198 XM_592198 LOC514361 ref|XM_592198 unmapped Bos taurus similar to Homo sapiens ERO1-like beta (S. cerevisiae) (ERO1LB) GCACCCAGCCGAGGTGGGTGTCTCACACATTTTCATGCTTTTGGATATTATTCACAAGAT A_73_100165 A_73_100165 FALSE XM_608792 XM_608792 LOC530323 ref|XM_608792 unmapped PREDICTED: Bos taurus similar to scavenger receptor cysteine-rich type 1 protein M160 precursor (LOC530323), partial mRNA. AGATGGAGAGCAGAGCACAGAGATCAGAGGACTGATGTCCCTGCTGAAAATTACGATAAT A_73_100166 A_73_100166 FALSE XM_586889 XM_586889 LOC509840 ref|XM_586889 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 112 (CCDC112), transcript variant 2 CAACGCATTGTCATTAGTGTTTCTTGTTTATACTAAGAGGGTAATTAATACATGTTGGCC A_73_100167 A_73_100167 FALSE XM_607530 XM_607530 LOC529090 ref|XM_607530 unmapped Bos taurus similar to Homo sapiens HpaII tiny fragments locus 9C (HTF9C), transcript variant 2 TAAACAAGTGCGGAACTGCCAGTGTTTGTGATATGAACCTGGGGGGCAGGCCCCGAAAGG A_73_100168 A_73_100168 FALSE XM_590870 XM_590870 LOC513217 ref|XM_590870 unmapped Bos taurus similar to Homo sapiens complement component 8, beta polypeptide (C8B) CATTTGGAGCTGGCCCATGGGTGGAGGGCTGTGCCATTCAGAATGTTTAAAATAAAGATA A_73_100169 A_73_100169 FALSE XM_612584 XM_612584 LOC533243 ref|XM_612584 unmapped Bos taurus similar to Homo sapiens zinc finger protein 143 (ZNF143) ATCAGATTGCAAACTCCTAGAGTCTACGTGCAAGAACCAGTGAAGTCTTACGGAGTCTTA A_73_100170 A_73_100170 FALSE XM_583848 XM_583848 LOC507268 ref|XM_583848 unmapped Bos taurus similar to Homo sapiens zinc finger protein 212 (ZNF212) CTGGCTCCTGTGTGAGTGTCCCCTTTGATGATTTGCAGTTGCCTAGAATAAAACTTGCTA A_73_100171 A_73_100171 FALSE XM_870085 XM_870085 LOC617764 ref|XM_870085 unmapped Bos taurus similar to PREDICTED: Homo sapiens forkhead-associated (FHA) phosphopeptide binding domain 1, transcript variant 1 (FHAD1) GGGTAAGGTGCACCTTTTATGAATGTGTCTGATATTTCACCATGTGTGTGAAATAATTCC A_73_100172 A_73_100172 FALSE XM_868165 XM_868165 LOC616200 ref|XM_868165 unmapped PREDICTED: Bos taurus similar to Glyceraldehyde-3-phosphate dehydrogenase, liver (GAPDH) (LOC616200) CATCTCTAAGGCCCTGAGGAAGGGGAGGGGCTTAGAGAGCTCTGCCTTGTGTACCATCAA A_73_100173 A_73_100173 FALSE XM_866656 XM_866656 LOC614986 ref|XM_866656 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ32312 (FLJ32312) GGTTGTTTTTACCCACCATAACGGTGTCTTGGAAATCATTTGGATCATGTTGATCTATGT A_73_100174 A_73_100174 FALSE AW358978 AW358978 gb|Unidentified transcripts on BTA26 position 8588986-8588099 unmapped Unknown CATTTTGGAGAAACATTCCCAGCTGTAATGTTGTGTATGGTAGTTCTCACTGGATGCTAG A_73_100175 A_73_100175 FALSE NM_001034786 NM_001034786 TMEM50B ref|NM_001034786 unmapped Bos taurus similar to Homo sapiens transmembrane protein 50B (TMEM50B) TGCTCAGGTTTCAGTCATTCCCAGTGGTCCTGGTCAAAGAAGTGACTTCCCTTTACAAAA A_73_100176 A_73_100176 FALSE XM_588006 XM_588006 LOC510803 ref|XM_588006 unmapped Bos taurus similar to Homo sapiens peptidoglycan recognition protein 2 (PGLYRP2) CAAGAACGTGAAACCAAGAACTGCCAGGAGGGCCTCCAGCAGATCCAAGAGAAGACCACC A_73_100177 A_73_100177 FALSE BI541193 BI541193 gb|Unidentified transcripts on BTA11 position 77990270-77989877 unmapped Unknown AGCCTGACTTACCTATTGTGACTTGGTAAATCACTTTAATCAGTCCCACATCATTCTGAC A_73_100178 A_73_100178 FALSE NM_001038075 NM_001038075 MGC133766 ref|NM_001038075 unmapped Bos taurus similar to Homo sapiens B-cell receptor-associated protein 29 (BCAP29), transcript variant 2 CAACTCATACTATTGAAAAGAGCTCAGCCAGCAGACCTGCTGCCTATGAACATACACAAA A_73_100179 A_73_100179 FALSE AW418140 AW418140 gb|Bos taurus similar to Homo sapiens KIAA0999 protein (KIAA0999) unmapped Unknown CACCCAGACGAAAGCCAGTGAGCCTATTAACCGTGCCATCTTGCAAACTACACTTTTAAA A_73_100180 A_73_100180 FALSE NM_174278 NM_174278 CNGA1 ref|NM_174278 unmapped Bos taurus cyclic nucleotide gated channel alpha 1 (CNGA1) CAATTTATATTGCTCAGGGGCAACTGAAAATTATCATGTACCTCATGTTCAGGATACTAT A_73_100181 A_73_100181 FALSE XM_582366 XM_582366 LOC505988 ref|XM_582366 unmapped Bos taurus similar to Homo sapiens suppressor of var1, 3-like 1 (S. cerevisiae) (SUPV3L1) TGGAATTCTTTGGCAAACATTGCTGTCTGTTGTACCCACATACCAGAGGCTCTTCTCTGT A_73_100182 A_73_100182 FALSE XM_867518 XM_867518 LOC527695 ref|XM_867518 unmapped PREDICTED: Bos taurus similar to echinoderm microtubule associated protein like 5 (LOC527695) AGTGTCAGCTTCCCAGATGCCTGTGAAAGTGCCTCCATGAATAATGCTGAGGATGTTAAA A_73_100183 A_73_100183 FALSE XM_866642 XM_866642 LOC614976 ref|XM_866642 unmapped PREDICTED: Bos taurus similar to kelch-like 1 (LOC614976) CCAGAATTCTCCTAATAGATAGTGTGACAGTACTAGAAGGCCCTATCTATGCTGTGGGAG A_73_100184 A_73_100184 FALSE CB221265 CB221265 gb|Unidentified transcripts on BTA19 position 17171120-17170685 unmapped Unknown GCTCAATGCAGGTTTGCCACAAACGTTCAATTTGTAAAAATCGCAATCTCAGCCAAGTAT A_73_100185 A_73_100185 FALSE NM_001013603 NM_001013603 IFT20 ref|NM_001013603 unmapped Bos taurus intraflagellar transport protein 20 (IFT20) CGGGTTGAATATGAAGCTTTGTGTAAAGTAGAAGCAGAACAAAATGAGTTTATTGACCAA A_73_100186 A_73_100186 FALSE BE755486 BE755486 gb|Bos taurus similar to Homo sapiens protein kinase N2 (PKN2) unmapped Unknown ACTGTATGTGTAAGTGACTGCTCAAGCACTTTGTAAGGAAATTAGGATATTTTAGAATGG A_73_100187 A_73_100187 FALSE NM_001038148 NM_001038148 POLR3F ref|NM_001038148 unmapped Bos taurus similar to Homo sapiens polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa (POLR3F) AAGGGAATATCTTCCCTGGCTCTTTGTTGTTAAAGTCTGTGGCTCAATTGTATTATTTGC A_73_100188 A_73_100188 FALSE NM_001037142 NM_001037142 CTNNBIP1 ref|NM_001037142 unmapped Bos taurus similar to Homo sapiens catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 1 TTGAATGTCGAAAACAGGGTTTGGGACATTGGTTGTTATATTTGACTTGAAAAAAGGAAG A_73_100189 A_73_100189 FALSE BF776879 BF776879 gb|Bos taurus similar to Homo sapiens runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 1 unmapped Unknown TATAGTGTGAATCCATTAACCCTTCGTCGTCCAGGGTCCAGACCAGAACTACTTGTTAGT A_73_100190 A_73_100190 FALSE XM_867600 XM_867600 LOC615724 ref|XM_867600 unmapped Bos taurus similar to Homo sapiens chromosome 10 open reading frame 4 (C10orf4), transcript variant FRA10AC1-1 GTTGCAACTTGAGTGGTTTGTCTTTGGAAATAAAAGATCCATCTAGGATGGATTGTCAGA A_73_100191 A_73_100191 FALSE NM_174038 NM_174038 DMP1 ref|NM_174038 unmapped Bos taurus dentin matrix acidic phosphoprotein (DMP1) GCAAAGCTAGAAAAACTGTTCTTGGAGTACTCTATTTGTGTTGCACATAGCAAAATTGTG A_73_100192 A_73_100192 FALSE XM_590961 XM_590961 LOC513300 ref|XM_590961 unmapped Bos taurus similar to Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8) GGGGGAATCTTAAATAACTTTGTTAAAATTAATGCCTGTGGTGGACCTCTTGTTTTGCAT A_73_100193 A_73_100193 FALSE XM_612328 XM_612328 LOC533057 ref|XM_612328 unmapped Bos taurus similar to Homo sapiens isoleucine- tRNA synthetase 2, mitochondrial (IARS2) CAGGTGGATCCATAATGGACTTAACTCAGAACATAACACTGAAAATGCTTGCCTACAAAT A_73_100194 A_73_100194 FALSE XM_584317 XM_584317 LOC507662 ref|XM_584317 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 52, subfamily A, member 5 (OR52A5) CCTATTGTTTATGGTGTAAAGACCAAACAGATTCGAGATCGAGTGTCCAAGATTTTTCAC A_73_100195 A_73_100195 FALSE NM_177491 NM_177491 ZFY ref|NM_177491 unmapped Bos taurus zinc finger protein Y-linked (ZFY) GGGTTCCGAAGACCTTCAGAAAAGAACCAGCATATAACACGACACCATAAAGAAGTTGGT A_73_100196 A_73_100196 FALSE NM_001034789 NM_001034789 TCTA ref|NM_001034789 unmapped Bos taurus similar to Homo sapiens T-cell leukemia translocation altered gene (TCTA) TGACAACAAACACCACACTCACAGTCGGTCTCACGTTTCACCCCAGGCTCAACTGAGGAT A_73_100197 A_73_100197 FALSE NW_001013579 NW_001013579 gb|Putative orthologue of human miRNA hsa-mir-126 on chr 9, (+) strand. Mature length 21 and 21 nt, stem-loop length 85 nt. Source: NW_001013579.1:586-662 unmapped Unknown CATTATTACTTTTGGTACGCGTATCCTACTATACGTATCACATAG A_73_100198 A_73_100198 FALSE BM482880 BM482880 gb|Unidentified transcripts on BTA21 position 45992378-45992993 unmapped Unknown CTGGAGCAGATCACGCATCATTTGACATATCAATCATCTTTATTTCTCCCCTTCAGATTC A_73_100199 A_73_100199 FALSE XM_864500 XM_864500 LOC527454 ref|XM_864500 unmapped PREDICTED: Bos taurus similar to MAP/microtubule affinity-regulating kinase 3 isoform 1 (LOC527454) AAGTGACTGATACTGAGGAGACTCTGCTTATACTAATGGAGCAAAAGACAGAGGCAGAGG A_73_100200 A_73_100200 FALSE NM_174301 NM_174301 CXCR4 ref|NM_174301 unmapped Bos taurus chemokine (C-X-C motif) receptor 4 (CXCR4) GAAATCACTTAGGCTAGAAATGATTCTCAGCTATTTGTAAATAAGTGATCTCTCCATTCC A_73_100201 A_73_100201 FALSE XM_868341 XM_868341 LOC616342 ref|XM_868341 unmapped Bos taurus similar to Homo sapiens serologically defined colon cancer antigen 8 (SDCCAG8) AGGAACTCTCTGGAATGAAAAATAGGGTACAAGTAGTTGTGCTTGAAAATGAAAGGCTCC A_73_100202 A_73_100202 FALSE XM_587289 XM_587289 LOC510177 ref|XM_587289 unmapped PREDICTED: Bos taurus similar to splicing factor 3b, subunit 1 isoform 1, transcript variant 1 (LOC510177) AATTGTATTTTTAAAGATTGTTGTATGGTGCCCTGTGAGCATCAAGTACCACCAGATGAA A_73_100203 A_73_100203 FALSE BM090415 BM090415 gb|Unidentified transcripts on BTA13 position 8487322-8488006 unmapped Unknown CGACAAAGTTAGCCCAAGTACCCAACCTACATAGTCGGCTGTATAGGACTGTACTGTAAT A_73_100204 A_73_100204 FALSE NM_001013598 NM_001013598 PSMD4 ref|NM_001013598 unmapped Bos taurus proteasome 26S non-ATPase subunit 4 (PSMD4) GTAGGGTGGGGGGTAGGGTCGGAGGTGTTGTCTGTAACCACTGCGCCCTAAATAAAGCTT A_73_100205 A_73_100205 FALSE XM_617220 XM_617220 LOC537065 ref|XM_617220 unmapped PREDICTED: Bos taurus similar to Killer cell immunoglobulin-like receptor 3DL1 precursor (MHC class I NK cell receptor) (Natural killer associated transcript 3) (NKAT-3) (p70 natural killer cell receptor clones CL-2/CL-11) (HLA-BW4 specific inhibitory NK GAATCTGCTGATATGTAGAAGAGGATGGTCCATAACAGAAGACGTAGGATGGGTCCATGT A_73_100206 A_73_100206 FALSE AW430182 AW430182 gb|Bos taurus similar to Homo sapiens chromosome 20 open reading frame 94 (C20orf94) unmapped Unknown TGCTCAACATTGGGTGGTCCTTTGAAGTAATACCTCCTCCCTGGTAACACGGAAAATCAA A_73_100207 A_73_100207 FALSE AW659152 AW659152 gb|Bos taurus similar to Homo sapiens KIAA1853 (KIAA1853) unmapped Unknown AAGAAAAGCTATGCCTCATCTTCTAACGAGCTGAGCCAAAGAGACTGGAACAGCGTTCTT A_73_100208 A_73_100208 FALSE XM_586026 XM_586026 LOC539263 ref|XM_586026 unmapped Bos taurus similar to Homo sapiens calcium and integrin binding family member 3 (CIB3) GACGTCGGGGTGACCCCTCATCCTGTTGTGAAATCTGCTTTCCCTGGGCTCTGGGAATAA A_73_100209 A_73_100209 FALSE gb|Putative orthologue of human miRNA hsa-miR-9* on chr 1, (-) strand. Mature length 21 nt, stem-loop length 89 nt. Source: NW_001022087.1:3170-3258 unmapped Unknown TAAAGCTAGATAACCGAAAGTTATCCTACTATACGTATCACATAG A_73_100210 A_73_100210 FALSE XM_590476 XM_590476 LOC539951 ref|XM_590476 unmapped Bos taurus similar to Homo sapiens Ras and Rab interactor 3 (RIN3) CGTCATGGAGAAGATCCTGCAGAAGTTCGCCAGCATGCACAAGGCCTACTCGCCCGAAAA A_73_100211 A_73_100211 FALSE XM_593832 XM_593832 LOC515756 ref|XM_593832 unmapped Bos taurus similar to Homo sapiens EPH receptor B4 (EPHB4) GTGGAAACAGGGACCCGTCATCGTGTCTTGTTTCCAGAACAGTGCCTTGGTCACGCCACA A_73_100212 A_73_100212 FALSE XM_865906 XM_865906 LOC614415 ref|XM_865906 unmapped Bos taurus similar to Homo sapiens annexin A13 (ANXA13), transcript variant 1 CTTCAGGGGATAAAAGCCAGATTCCAAGAGAAGTACCAGAAGTCTCTCTCTGACATGGTT A_73_100213 A_73_100213 FALSE XM_600754 XM_600754 FZD1 ref|XM_600754 unmapped Bos taurus similar to Homo sapiens frizzled homolog 1 (Drosophila) (FZD1) AAATGCCCGTACTTAGGACATAAATCTATCTATGTCTGTCATACCCTAAAATGACAATGC A_73_100214 A_73_100214 FALSE CB432231 CB432231 gb|Unidentified transcripts on BTA13 position 14230821-14231423 unmapped Unknown AGAGTTTATTGGCTCTGCCTTCTGAGATGGTCCATCCTCTGTCTGTGGAGTTTTGTTTCT A_73_100215 A_73_100215 FALSE XM_615672 XM_615672 LOC535566 ref|XM_615672 unmapped Bos taurus similar to Homo sapiens vacuolar protein sorting 37 homolog B (S. cerevisiae) (VPS37B) CGGAAGCTGGCCCACATGCGAAGGGTTAAAATCGAGAAGCTCCAGGAGATGGTGCTGAAG A_73_100216 A_73_100216 FALSE XM_584372 XM_584372 LOC507711 ref|XM_584372 unmapped Bos taurus similar to Homo sapiens alcohol dehydrogenase, iron containing, 1 (ADHFE1) TTTGCCCAGTAATCAACCCCACATCTAGAAATGTATTCTATAAAATTCTAGCACAAGTGT A_73_100217 A_73_100217 FALSE XM_866433 XM_866433 LOC614802 ref|XM_866433 unmapped PREDICTED: Bos taurus similar to hedgehog acyltransferase (LOC614802), partial mRNA. AGGGTGAAAGGCTGCAAGACTTACAGGAAGAAAAGAGATTCCGTTCAGATGTGGATATGA A_73_100218 A_73_100218 FALSE BE752367 BE752367 gb|Unidentified transcripts on BTA16 position 38317831-38318172 unmapped Unknown TGGGTAACATTAGATGAAAATAACCTTTCCCGTGGGAAAGGTTTCTTGAAGGCATGGTTG A_73_100219 A_73_100219 FALSE CB427429 CB427429 gb|Unidentified transcripts unmapped Unknown CGTGTTTCCTGCTGAAAACGCGTGTGTGAAGATTGTGAAACAAGCACAGGTCATCTTCAA A_73_100220 A_73_100220 FALSE XM_584897 XM_584897 LOC508157 ref|XM_584897 unmapped Bos taurus similar to Homo sapiens dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive) (DYSF) CGCTGTCATCATTTCTTTCTCCCCTGAACCAAACCATTTGGGATCAGCCCATGTGTATTT A_73_100221 A_73_100221 FALSE XM_606579 XM_606579 LOC528167 ref|XM_606579 unmapped Bos taurus similar to Homo sapiens trinucleotide repeat containing 6B (TNRC6B), transcript variant 1 AAATAGCTTTTTAACTTTGTTTGCACTGGGTGTGTTTCCGTCCTTAGGTCTACCATGTTT A_73_100222 A_73_100222 FALSE BP107122 BP107122 gb|Bos taurus similar to Homo sapiens dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) (DUSP3) unmapped Unknown CCTGCTGTCAGCTTTTAGGGTAATTTGACTGTGAAAGCATCAATTTTCTGGACAGAAAAG A_73_100223 A_73_100223 FALSE XM_591924 XM_591924 LOC514123 ref|XM_591924 unmapped Bos taurus similar to Homo sapiens skeletal muscle and kidney enriched inositol phosphatase (SKIP), transcript variant 2 GGCCATGGCCGGCTGTGTTCTGTGGCTGTTGCATTGGGGGTTAATTAGAAACCAGTGGCT A_73_100224 A_73_100224 FALSE XM_869366 XM_869366 LOC512474 ref|XM_869366 unmapped Bos taurus similar to Homo sapiens dispatched homolog 2 (Drosophila) (DISP2) GGGGGATGGCAGCCCTGTGGTGCTGCCCAACAACCAACCAGATCTGCCAGATGTTTGGGT A_73_100225 A_73_100225 FALSE XM_614133 XM_614133 LOC534382 ref|XM_614133 unmapped Bos taurus similar to Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase (MTHFD1) CACGTCTAATTACCTTACTGAATCCCTGGAATAAAAGTAAATAATTTTTCAGTCTCCGTG A_73_100226 A_73_100226 FALSE XM_616055 XM_616055 LOC535940 ref|XM_616055 unmapped Bos taurus similar to Homo sapiens TNNI3 interacting kinase (TNNI3K) AAGGTATGGAGTACCTTCACAACTTGACACAGCCAATTATTCACCGTGACTTAAACAGGT A_73_100227 A_73_100227 FALSE XM_864493 XM_864493 LOC510019 ref|XM_864493 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 49, member B (FAM49B) AAACTGTGATGTGTGCGTAGAATATTACGTATGCATGTTCATGTTTAAAGAATGGCTGTT A_73_100228 A_73_100228 FALSE XM_613378 XM_613378 LOC533842 ref|XM_613378 unmapped Bos taurus similar to Homo sapiens hypothetical protein MGC2731 (MGC2731) TGTTTCTTGAGTGTGTGATGTGGAAGTCTAATTGAATCTCCTAATAAATGTTACCACTCT A_73_100229 A_73_100229 FALSE XM_586210 XM_586210 LOC539290 ref|XM_586210 unmapped Bos taurus similar to Homo sapiens phospholipid scramblase 4 (PLSCR4) TCATTGTAAGCCTTTTGCTGTTGAGCTATTCTGAGAGAATTATTCTTTCTGATGAGAAGT A_73_100230 A_73_100230 FALSE XM_608070 XM_608070 LOC529618 ref|XM_608070 unmapped Bos taurus similar to Homo sapiens glutamate receptor, ionotropic, AMPA 1 (GRIA1) CCTATGTATCCCCAGTAAACGGCTCCTCTTTCAGGCCACCTCTTCAGATTTCCCAGTTGG A_73_100231 A_73_100231 FALSE CB437846 CB437846 gb|Unidentified transcripts unmapped Unknown CTGTCATGAGGAAGATTATGGCTCCATAAAGCTGATTTTTTAAACCATGGGGACAAATAA A_73_100232 A_73_100232 FALSE XM_868753 XM_868753 LOC508118 ref|XM_868753 unmapped Bos taurus similar to Homo sapiens zinc finger and BTB domain containing 3 (ZBTB3) GATTATGGTTTATTGTGGAAGAAGGCAATGGCAACCCACTCCAGTACTCTTGCCTGGAAA A_73_100233 A_73_100233 FALSE XM_615021 XM_615021 LOC535043 ref|XM_615021 unmapped PREDICTED: Bos taurus similar to Integrin alpha-6 precursor (VLA-6) (CD49f) (LOC535043) GTACGAGTTCAGGGTAATTAACTTGGCAAACCTCTTAAAAACCTCGGCACAGCAACCTTG A_73_100234 A_73_100234 FALSE EE907768 EE907768 gb|Unidentified transcripts on BTAX position 21374174-21373209 unmapped Unknown TTAACAGAACTGTAAGGCAAAAATATGCTGTTTTCATACTTAAGTTGCTCACACTAGGAG A_73_100235 A_73_100235 FALSE NM_001040543 NM_001040543 SNRPG ref|NM_001040543 unmapped Bos taurus similar to Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG) GTCAGCGTCCATAACCCCCCAGTGTTTTAAGGGTCAACCATATAGTGGAACAGAAGTAAA A_73_100236 A_73_100236 FALSE BF776504 BF776504 gb|Bos taurus similar to Homo sapiens lipoma HMGIC fusion partner-like 4 (LHFPL4) unmapped Unknown TGCTGCTGCTGAATTTGAGCTTCAGTGCAGGTGGAATGATGTTCAAATAAAGACACACTT A_73_100237 A_73_100237 FALSE BM089549 BM089549 gb|Unidentified transcripts on BTA16 position 37666912-37667863 unmapped Unknown GCCTACTGGTTACTCTGTCCAAATTAAGCTACCATGGTAGCAACTATCTAGGACTCTTGG A_73_100238 A_73_100238 FALSE XM_867955 XM_867955 LOC616003 ref|XM_867955 unmapped Bos taurus similar to Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1) TTCCCAAGGAAAGTGAACTATTCACTGGGGTTTCAAAAACTGCTTTCACTGAAATTTTTT A_73_100239 A_73_100239 FALSE EE911771 EE911771 gb|Unidentified transcripts on BTA22 position 16664037-16664345 unmapped Unknown TGTGAATTCAAGAATCCTTTAAAAGGATGCTCTCTCTCCATACCAACACCTGATGAGCCC A_73_100240 A_73_100240 FALSE XM_866675 XM_866675 LOC614999 ref|XM_866675 unmapped PREDICTED: Bos taurus similar to Shaw-related voltage-gated potassium channel protein 2 isoform KV3.2a (LOC614999) AAATGCAGATGCTGTAATCAATAGCCAGATCTGCATTCCCAGCCAGGAGCAGGTATCAAT A_73_100241 A_73_100241 FALSE XM_588430 XM_588430 LOC539626 ref|XM_588430 unmapped Bos taurus similar to Homo sapiens methyl-CpG binding domain protein 2 (MBD2), transcript variant 1 GAGGACACCTGTACATTCTTCCATCATCACTGTAAAGACAAATAAATGATTATATTCACG A_73_100242 A_73_100242 FALSE NM_001035073 NM_001035073 WDR79 ref|NM_001035073 unmapped Bos taurus similar to Homo sapiens WD repeat domain 79 (WDR79) AGGCCCAGACACCAGCATCTCAGATGCCCACCAGGAGGAGATGGGACAGGGAAGGACAGA A_73_100243 A_73_100243 FALSE BE667995 BE667995 gb|Bos taurus similar to Homo sapiens purine-rich element binding protein B (PURB) unmapped Unknown CAAGTTAATCCCACCCCATCAAAAGGTATTCCTAGAAGTGTCATAGACCTAGGTAACTTT A_73_100244 A_73_100244 FALSE XM_615433 XM_615433 LOC535365 ref|XM_615433 unmapped Bos taurus similar to Homo sapiens guanine nucleotide binding protein (G protein), beta 5 (GNB5), transcript variant 2 AAATACGTGGTTGGGAATATACAGACTACATGGAGATTCAGGGATTAAACTTTAGGTAAT A_73_100245 A_73_100245 FALSE XM_589060 XM_589060 LOC511675 ref|XM_589060 unmapped Bos taurus similar to Homo sapiens R-spondin homolog (Xenopus laevis) (RSPO1) TGACTTTATCCTTGGAGAGAACTGTTACACATTCATATCAGGGCTTTCCTGACTCTGAAA A_73_100246 A_73_100246 FALSE XM_865163 XM_865163 LOC613934 ref|XM_865163 unmapped PREDICTED: Bos taurus similar to TatD DNase domain containing deoxyribonuclease 2 (LOC613934) GGTCGTCAAGCCGCTCCTGGAGCTCTTTCCCAACATGTCTGTGGGCTTCACGGCCATCCT A_73_100247 A_73_100247 FALSE XM_610909 XM_610909 LOC532393 ref|XM_610909 unmapped Bos taurus similar to Homo sapiens neurotrophin 3 (NTF3) TATAAGTTGACCTTTATTTATTAAACTTCGGCAACCCTTACAGTATATAAGCTTTTTTCT A_73_100248 A_73_100248 FALSE XM_609221 XM_609221 LOC530744 ref|XM_609221 unmapped Bos taurus similar to Homo sapiens cyclin K (CCNK) TCGGGACCAAGGGAAGCGAGGTGGAGAGCCTGTGTGGCGGAAAACTAGCCAACAGCGTCA A_73_100249 A_73_100249 FALSE NM_001015586 NM_001015586 DSTN ref|NM_001015586 unmapped Bos taurus destrin (actin depolymerizing factor) (DSTN) AAGTTCGGAAGTGCTCCACGCCAGAGGAAATCAAGAAAAGAAAGAAGGCTGTCATCTTCT A_73_100250 A_73_100250 FALSE CB443782 CB443782 gb|Bos taurus similar to Homo sapiens cell division cycle 26 (CDC26) unmapped Unknown ACGGATGCTTAACTTTCACTCTGAAAGCTGAAATTCAAACTCTGGTTTGTCTCTGAAAAA A_73_100251 A_73_100251 FALSE NM_001034691 NM_001034691 DRG1 ref|NM_001034691 unmapped Bos taurus similar to Homo sapiens developmentally regulated GTP binding protein 1 (DRG1) TTAACTTGGTGTCACCTTATATGTTGAGCTGCATAAAGGACCTGGTAGGCCAGCTGACTA A_73_100252 A_73_100252 FALSE NM_001035017 NM_001035017 PHGDH ref|NM_001035017 unmapped Bos taurus similar to Homo sapiens phosphoglycerate dehydrogenase (PHGDH) CTCTGACTCCTATCTTTCTGTGGTACAGCAATCACCTCCCAATAAAGAGCCTACCGCCTA A_73_100253 A_73_100253 FALSE XM_870588 XM_870588 LOC618258 ref|XM_870588 unmapped Bos taurus similar to Homo sapiens dipeptidase 3 (DPEP3) AGAGGCCCCCAAAAGCCTCCCTACAACTCGTTTTAGGCCTTGTGGCTGCTGTCACCTTCT A_73_100254 A_73_100254 FALSE XM_866626 XM_866626 LOC614960 ref|XM_866626 unmapped PREDICTED: Bos taurus similar to Tg737 protein isoform 1 (LOC614960) ATTGTTGTGAAACAGACCCCTAGAACTTTCCATTTTCCCAAACTGAGGCTCTATCCTCAC A_73_100255 A_73_100255 FALSE NM_183080 NM_183080 MCP ref|NM_183080 unmapped Bos taurus membrane cofactor protein (MCP) AAAGGGAAAGCAGAATGTAGCGCTACGTACACCACTTATCAGGATAAAGCAACCACTGCA A_73_100256 A_73_100256 FALSE XM_585968 XM_585968 LOC539259 ref|XM_585968 unmapped Bos taurus similar to Homo sapiens napsin A aspartic peptidase (NAPSA) ACGTCATCCAGATTACTCGGAGTGGCTTCAGTGTCTGTTTGTCCGGCTTCATGGCTCTGG A_73_100257 A_73_100257 FALSE XM_865095 XM_865095 LOC514788 ref|XM_865095 unmapped Bos taurus similar to Homo sapiens acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa GTGACCTGGGCACACACTGTACCGTATGTAGAGTTCAGCTTCACTAATAAAGCTACTGTT A_73_100258 A_73_100258 FALSE XM_864696 XM_864696 HOXC6 ref|XM_864696 unmapped Bos taurus similar to Homo sapiens homeobox C6 (HOXC6), transcript variant 1 GCTGTATTTGTGGTCTCTGTATTTATATTTATGTTTAGCACCGTCCGTGTTCCAATCCAA A_73_100259 A_73_100259 FALSE XM_585450 XM_585450 LOC539181 ref|XM_585450 unmapped Bos taurus similar to Homo sapiens forkhead box B1 (FOXB1) CCCCCATCTCCATGGCAAGTGGCGATTACAGCGCCTATGGCGTGCCACTGAAGCCTCTGT A_73_100260 A_73_100260 FALSE XM_583206 XM_583206 LOC506721 ref|XM_583206 unmapped Bos taurus similar to Homo sapiens paired-like homeodomain transcription factor 2 (PITX2), transcript variant 2 TGGTGGATGCAATGATGTTTCTGAAACTGCTATGTACAACCTACCCTGTGTATAACATTT A_73_100261 A_73_100261 FALSE XM_872596 XM_872596 LOC514759 ref|XM_872596 unmapped Bos taurus similar to Homo sapiens aldehyde dehydrogenase 18 family, member A1 (ALDH18A1), nuclear gene encoding mitochondrial protein, transcript variant 1 TAATACTTTGGATTCTTCACCCCTTTTTGAGAAATAAAGTTCTTATGAAAAGCCTGTGCG A_73_100262 A_73_100262 FALSE AW478214 AW478214 gb|Unidentified transcripts unmapped Unknown CCTGGTGTGGAATTGACTCCTGTGCAGTAGTTTTGCCAAGTGGCACCTTCTTTACTTTTT A_73_100263 A_73_100263 FALSE EE912709 EE912709 gb|Bos taurus similar to Homo sapiens neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant a unmapped Unknown AGTTTTGGAACAAGGATTTGTTTAAAGCAGATGAGAGGAGGGAAGCATTCCCCTCCCCTT A_73_100264 A_73_100264 FALSE XM_606511 XM_606511 LOC528100 ref|XM_606511 unmapped Bos taurus similar to Homo sapiens stress- associated endoplasmic reticulum protein 1 (SERP1) TTGGGGTGGTCTGCATTATCCAATTACTCTTTTGTAATTTAGCTATAACATATCAAGGAG A_73_100265 A_73_100265 FALSE NM_175825 NM_175825 GSTM1 ref|NM_175825 unmapped Bos taurus glutathione S-transferase M1 (GSTM1) TATTTTTGAGCAAAGTTCCTCCCCACCCCACATTATCCCTCCTGCATTAAAGTCACCGAG A_73_100266 A_73_100266 FALSE XM_593253 XM_593253 LOC515269 ref|XM_593253 unmapped Bos taurus similar to Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive) (SPG7), nuclear gene encoding mitochondrial protein, transcript variant 1 GGCCCAAGAAAAAGATCGCGCCGCAGAAGTGGAGCGATGCCCAGAGGGAGAAGCAGGACT A_73_100267 A_73_100267 FALSE NM_175810 NM_175810 NDUFS6 ref|NM_175810 unmapped Bos taurus NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) (NDUFS6) GTGTGTATTTAAGAGAGTAATGGCTATGATGTATTGTTCCACGAAAATAAATTCAGGAGG A_73_100268 A_73_100268 FALSE XM_592100 XM_592100 LOC514273 ref|XM_592100 unmapped Bos taurus similar to Homo sapiens adhesion molecule with Ig-like domain 2 (AMIGO2) TGGACATTTGATTTAATGTAAATACGTGTGTTCTGCGACTTGATGTGCTGTTTTATTTGG A_73_100269 A_73_100269 FALSE XM_605478 XM_605478 LOC527089 ref|XM_605478 unmapped Bos taurus similar to Homo sapiens layilin (LAYN) ACCTGTAAGAAGCATTGCCCAGGGGCTGGCACGTGGTAGAAAATAAATACCTGATTGTTA A_73_100270 A_73_100270 FALSE BI849045 BI849045 gb|Bos taurus similar to Homo sapiens zinc and ring finger 1 (ZNRF1) unmapped Unknown AAATGTTCAAAGCTGGGGGAAAAGGCTTTCTTCATTAGTCAAGGGGTTTTGATATGGTAT A_73_100271 A_73_100271 FALSE XM_871308 XM_871308 LOC618998 ref|XM_871308 unmapped PREDICTED: Bos taurus similar to obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (LOC618998), partial mRNA. AGTCCTCTGCAGTGTTTATCAAGGGGCAGCCAATGCATAAGGAGGTAAAGGCCGTGGCGG A_73_100272 A_73_100272 FALSE AW484625 AW484625 gb|Bos taurus similar to Homo sapiens interferon regulatory factor 2 (IRF2) unmapped Unknown AAGGGGAAAAAGCTTTTATGAGCTCATGTAGCAATCAAATTATCCTGGGGATTGATAATA A_73_100273 A_73_100273 FALSE XM_613426 XM_613426 LOC540850 ref|XM_613426 unmapped Bos taurus similar to Homo sapiens synaptotagmin VII (SYT7) GGATGGGCCCTGCTTTTTGTGGCAAGGCCCATTCTGATTAATAAAGGATCGTGAAAAAGT A_73_100274 A_73_100274 FALSE BM253370 BM253370 gb|Bos taurus similar to Homo sapiens NIPA-like domain containing 3 (NPAL3) unmapped Unknown ATGGCATGTTCTTATTTTTCAAAAAGGTGTGTGCTAGGTACAAATAACATTATGAAGTGG A_73_100275 A_73_100275 FALSE CB436300 CB436300 gb|Bos taurus similar to Homo sapiens euchromatic histone-lysine N-methyltransferase 1 (EHMT1) unmapped Unknown ACAGTTCTAAGAGCAGTCTTTTGGCTCAGACCATTTCTTGTTCTGTTTTCAATGAAATCA A_73_100276 A_73_100276 FALSE NM_001038534 NM_001038534 MGC134067 ref|NM_001038534 unmapped Bos taurus similar to Homo sapiens ribonuclease H2, large subunit (RNASEH2A) ACTGGGGATCCGAAGGGACCTGGGAAGATCAAGTCCTACTTCAGTGAAAGCCCCCAAACC A_73_100277 A_73_100277 FALSE CB533191 CB533191 gb|Bos taurus similar to PREDICTED: Homo sapiens KIAA0947 protein (KIAA0947) unmapped Unknown CTACCTGGCCCTCAGTGTTGGATGTCTTCGTTTAGCTAGAGATGCTCCCCTTAAAAAATT A_73_100278 A_73_100278 FALSE XM_613624 XM_613624 LOC534015 ref|XM_613624 unmapped PREDICTED: Bos taurus similar to T16G12.5 (LOC534015) CATTTCAGAGGATGGAGATGCAGTTGGTGGTAGGGAGGGAAAGGAATTTGTTACCAAAAC A_73_100279 A_73_100279 FALSE XM_590017 XM_590017 LOC512493 ref|XM_590017 unmapped PREDICTED: Bos taurus similar to REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (LOC512493) TGTGGATAGCACCTGTAGATCACAGTGGAAAAATATGTTGTGTTACACAATTTACCAAAA A_73_100280 A_73_100280 FALSE XM_584241 XM_584241 LOC507597 ref|XM_584241 unmapped Bos taurus similar to Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL) GAACAAAGATGTCCTAATTAATTTCCTAAAAGAAGTGGCTGCTGCTGCCCCTGCATTGCC A_73_100281 A_73_100281 FALSE NM_001015533 NM_001015533 SSR2 ref|NM_001015533 unmapped Bos taurus signal sequence receptor, beta (translocon-associated protein beta) (SSR2) TTGGAGGCTACCCAGTCTCTGTACTGGCTTAGAAAGTTCTTACCACATGGGGTTTTCTAA A_73_100282 A_73_100282 FALSE XM_610873 XM_610873 LOC532359 ref|XM_610873 unmapped Bos taurus similar to Homo sapiens forkhead box K2 (FOXK2) TGACTTTGTCCCTGGCATATTTTCCACTCTAAGTAAAACAAGTCTCCTACGTATTGTGTA A_73_100283 A_73_100283 FALSE NM_001035365 NM_001035365 TMEM15 ref|NM_001035365 unmapped Bos taurus similar to Homo sapiens transmembrane protein 15 (TMEM15) AGCAGCCAGCCACCTGGGCTTGAAGAGCCAAGATGAGAAGAAGCAGATTTAATTTTTCAA A_73_100284 A_73_100284 FALSE XM_584329 XM_584329 LOC507672 ref|XM_584329 unmapped PREDICTED: Bos taurus similar to Folate receptor beta precursor (FR-beta) (Folate receptor 2) (Folate receptor, fetal/placental) (Placental folate-binding protein) (FBP), transcript variant 1 (LOC507672) CTGCTACTCACTATGTGAAAATGAATCAGTTGCTTAACTTTTCTTAAACCAGTTTCCTTC A_73_100285 A_73_100285 FALSE XM_867033 XM_867033 DIABLO ref|XM_867033 unmapped Bos taurus similar to Homo sapiens diablo homolog (Drosophila) (DIABLO), nuclear gene encoding mitochondrial protein, transcript variant 1 GTGCTCACAACAGGACTTACTCCAACACACGCTTCTCATTTCCTTGTTTGCTTGGAGTTT A_73_100286 A_73_100286 FALSE BI849183 BI849183 gb|Unidentified transcripts on BTA9 position 21576525-21575860 unmapped Unknown CTGCAATGCTTAACTCAAAATAATTTATTTGTTGTAGATACTTTTTAGGCAGCATTTTGT A_73_100287 A_73_100287 FALSE NM_001040514 NM_001040514 THOC7 ref|NM_001040514 unmapped Bos taurus similar to Homo sapiens THO complex 7 homolog (Drosophila) (THOC7) GTGCTTAGAATTTGTTGCGCTCTCGAGATATGTAAAGTTTTGGCAATGAACTATTTTGCT A_73_100288 A_73_100288 FALSE NM_001034807 NM_001034807 MGC127723 ref|NM_001034807 unmapped Bos taurus similar to Apolipoprotein C-IV precursor (Apo-CIV) (ApoC-IV) (Apolipoprotein C2-linked) (ACL) (MGC127723) AATTAAAGCGTCACACCTTCTGCAATAAACAAGTTCTCCTGTGTGTGTCCCTGTCCCAGT A_73_100289 A_73_100289 FALSE XM_605448 XM_605448 LOC527061 ref|XM_605448 unmapped Bos taurus similar to Homo sapiens zinc finger protein 541 (ZNF541) GTCTCTCTGCATTCTAGATTCCGCCCCTAGGCTTGACGTGACTTGTACATTTTTAGGTTT A_73_100290 A_73_100290 FALSE XM_605438 XM_605438 LOC527051 ref|XM_605438 unmapped Bos taurus similar to Homo sapiens cell death- inducing DFFA-like effector a (CIDEA), transcript variant 1 AGGATCCAGGGGCTGCACAGTGCCTTCCGCTCCACAATAAACCCATCAGGAAAGCTGCTA A_73_100291 A_73_100291 FALSE XM_584183 XM_584183 LOC507549 ref|XM_584183 unmapped Bos taurus similar to Homo sapiens T-cell immunoglobulin and mucin domain containing 4 (TIMD4) TTTTCACACTGTGATGTGCCCCTTTTTCTTAGGACTGACGATGTGGGTATGACACGTGAA A_73_100292 A_73_100292 FALSE XM_604484 XM_604484 LOC526125 ref|XM_604484 unmapped Bos taurus similar to Homo sapiens gon-4-like (C.elegans) (GON4L), transcript variant 2 AGAGTTTATTGGAAAGTGATGTGGAAAGCACCGCTTCATCTCCACGTGGGGCAAAGAAAT A_73_100293 A_73_100293 FALSE XM_594456 XM_594456 LOC516303 ref|XM_594456 unmapped Bos taurus similar to Homo sapiens ERBB receptor feedback inhibitor 1 (ERRFI1) GAAGGTTAAAACATGCTTTAGAAAAAGGCACTGATTTCTGCATCTTTGTGTACAGTATTG A_73_100294 A_73_100294 FALSE XM_593474 XM_593474 LOC515450 ref|XM_593474 unmapped PREDICTED: Bos taurus similar to beta-carotene 9, 10-dioxygenase 2 (LOC515450) CTTAGGAAAACTGGGAAAGAGCTTGATCAGGTAGAATTCTCTGATTTGTCAAGAGTGGTC A_73_100295 A_73_100295 FALSE AW657053 AW657053 gb|Bos taurus similar to Homo sapiens interleukin 13 receptor, alpha 1 (IL13RA1) unmapped Unknown CACAGAAGGGATACATGAAACTATGTTAACATTTTTGGTAATGCCTTCAACTGGGGATCA A_73_100296 A_73_100296 FALSE XM_873862 XM_873862 LOC540933 ref|XM_873862 unmapped Bos taurus similar to Homo sapiens helicase, lymphoid-specific (HELLS) TTGGAGCTAAAAGAATGTCTTCAAAAAGTTCTTGTTCACATCTAGTGATCTGTATTGGTG A_73_100297 A_73_100297 FALSE XM_869817 XM_869817 IFN-tau-c1 ref|XM_869817 unmapped PREDICTED: Bos taurus interferon tau c1 (IFN- tau-c1) GCAGTAATAAGCAAGTAGATATAAAAGTATTTAGCCTAGGGGTATGAGTCCTTAAGTGAT A_73_100298 A_73_100298 FALSE XM_865283 XM_865283 LOC508317 ref|XM_865283 unmapped Bos taurus similar to Homo sapiens CDC-like kinase 1 (CLK1), transcript variant 1 CCCTTAAAAAAGCTACATAAATCTGTAATTGTACAGCTCCCTTGAGACCATATGGACTGT A_73_100299 A_73_100299 FALSE NM_001034656 NM_001034656 CKMT2 ref|NM_001034656 unmapped Bos taurus similar to Homo sapiens creatine kinase, mitochondrial 2 (sarcomeric) (CKMT2), nuclear gene encoding mitochondrial protein GTGAACTTTCCTTTCCCTGATTTATAAATAATCTGTCTGCTGGTATGACAGACAAAGAAA A_73_100300 A_73_100300 FALSE EE944066 EE944066 gb|Unidentified transcripts unmapped Unknown TACCATCTAACAGTCAAGTGTGTGGGAGAGAGAACATAGTCAACAGCTACCTGTCACTAT A_73_100301 A_73_100301 FALSE XM_615451 XM_615451 LOC535380 ref|XM_615451 unmapped PREDICTED: Bos taurus similar to UDP- glucuronosyltransferase 2B4 precursor (UDPGT) (Hyodeoxycholic acid) (HLUG25) (UDPGTh-1) (LOC535380) ATGGGGATCTCCGAGTTAAAGAGCTTGGACAACAATGCAGTGATGACCATTTCCATGTGT A_73_100302 A_73_100302 FALSE CB169199 CB169199 gb|Bos taurus similar to Homo sapiens DENN/MADD domain containing 1A (DENND1A), transcript variant 1 unmapped Unknown ACTCCACCTCGGGGAAACCTTCAGCATCTGCGTTTGTAGAGGTAGAGGCAGGACCCATGT A_73_100303 A_73_100303 FALSE XM_585877 XM_585877 LOC509003 ref|XM_585877 unmapped Bos taurus similar to Homo sapiens nucleobindin 2 (NUCB2) TTTACCTCCCTTCCTTCTCCTCTGCTCAATAAATATTTTAAAGCATATGTGGAATAAAGG A_73_100304 A_73_100304 FALSE BM255454 BM255454 gb|Unidentified transcripts on BTA19 position 38797685-38797130 unmapped Unknown TGTGCCCCCTAGAGAGAAAACAAAACAAAACCAAAATAAACCCAGCAAAGACAATCCAAC A_73_100305 A_73_100305 FALSE XM_882771 XM_882771 LOC507692 ref|XM_882771 unmapped Bos taurus similar to Homo sapiens hematopoietic signal peptide-containing (LOC284361), transcript variant HSM1 GCGACATCAGGCTCCACGGTGTGTGTATAGCAGTTTATTAAAGCGTCCCCTAAATATTCA A_73_100306 A_73_100306 FALSE NM_001014388 NM_001014388 TPT1 ref|NM_001014388 unmapped Bos taurus tumor protein, translationally- controlled 1 (TPT1) TTGACAGACTGGCTCGCCCACCACCTGTTTTGTGGCTAAGGTGGTGCTTATATTTTTTAA A_73_100307 A_73_100307 FALSE NM_001035113 NM_001035113 FEN1 ref|NM_001035113 unmapped Bos taurus similar to Homo sapiens flap structure-specific endonuclease 1 (FEN1) GAGTGGTTCTCACGGCCTTCCTGAAGCATTTGAGTTGAAACTTTGGGATAAGATGCTGTT A_73_100308 A_73_100308 FALSE NM_174584 NM_174584 PRKACA ref|NM_174584 unmapped Bos taurus protein kinase, cAMP-dependent, catalytic, alpha (PRKACA) TGTGTGCTGCGAAGGACGCAACTTCCTCTTGAACAGTGTGCTGTGTAACATATTGAAACT A_73_100309 A_73_100309 FALSE XM_596153 XM_596153 LOC517971 ref|XM_596153 unmapped PREDICTED: Bos taurus similar to OTU domain, ubiquitin aldehyde binding 1 (LOC517971) AGTGGCCAACCTGCTGGTCTCCTTCAGTGACCAGAGTACCTTGGACCACCTGGTGATCTA A_73_100310 A_73_100310 FALSE XM_865663 XM_865663 LOC614242 ref|XM_865663 unmapped PREDICTED: Bos taurus similar to Ras-related protein Rab-8B (LOC614242) TTTCACTTTGCACATCAGTGTTAGCCTTTCATTGTTACAGCACAATCTGAGATTCATATC A_73_100311 A_73_100311 FALSE CB451907 CB451907 gb|Unidentified transcripts on BTA23 position 10038267-10037258 unmapped Unknown ACTGAGCTTGCCCATAGACTCTTTTCCTCCTAATAAACGCTTTATTTTTTCCTCTAAAAA A_73_100312 A_73_100312 FALSE NM_001034604 NM_001034604 MGC127624 ref|NM_001034604 unmapped Bos taurus similar to Homo sapiens ribophorin II (RPN2) ATGGTGCCCCAGCAAGATGCTGTGAATATTCTGGCTTACCCACTTGTTGCATTGAAAAGT A_73_100313 A_73_100313 FALSE XM_602981 XM_602981 LOC524651 ref|XM_602981 unmapped Bos taurus similar to Homo sapiens sphingosine-1-phosphate phosphotase 2 (SGPP2) CATGTGGTGTTTCAGGGCCATATGCTCTGGTTTTCTATTTTGGAAACCTTCAGCTATCTT A_73_100314 A_73_100314 FALSE BP112294 BP112294 gb|Bos taurus similar to Homo sapiens RAB31, member RAS oncogene family (RAB31) unmapped Unknown ACCTACCTGTCCACCTTGTATTCTGTAGTAAAGCACTGCCTTCCACGTTGTCCAATTGTA A_73_100315 A_73_100315 FALSE XM_863917 XM_863917 LOC522269 ref|XM_863917 unmapped Bos taurus similar to Homo sapiens actinin, alpha 4 (ACTN4) GCTACCCCGCCCCCCCGCCACACCCCAAGAATCTCTTGGCAAAATTGAGCAAGAGCCCCC A_73_100316 A_73_100316 FALSE NM_001024521 NM_001024521 TRAF7 ref|NM_001024521 unmapped Bos taurus ring finger and WD repeat domain 1 isoform 1 (TRAF7) GACTGTACATAGATTTGATTACTTCTTGATTGAAATAAAAGTTGCACAGACTGTGAAAAA A_73_100317 A_73_100317 FALSE XM_865303 XM_865303 LOC614010 ref|XM_865303 unmapped PREDICTED: Bos taurus similar to fatty acid desaturase 2 (LOC614010) GAAGGCATTTGGAGATATTATCAGTTCCCTGGAGGATCCTTTGCTCATCAAATTAACAGC A_73_100318 A_73_100318 FALSE XM_614274 XM_614274 LOC534492 ref|XM_614274 unmapped Bos taurus similar to Homo sapiens mitogen- activated protein kinase 14 (MAPK14), transcript variant 2 CAAATCCAGTCTACCTACCACCTGTTGTGTAGCCCCCTAAAAGTGGGCTTTTTACAGTTT A_73_100319 A_73_100319 FALSE XM_870780 XM_870780 LOC618447 ref|XM_870780 unmapped PREDICTED: Bos taurus similar to Golgi apparatus protein 1 precursor (Golgi sialoglycoprotein MG-160) (E-selectin ligand 1) (ESL-1) (Cysteine-rich fibroblast growth factor receptor) (CFR-1) (LOC618447), partial mRNA. ACTTGGACCGGCATTTGTATTTTGCCTGCCGAGATGATCGGGAACGTTTTTGCGAAAATT A_73_100320 A_73_100320 FALSE XM_590926 XM_590926 LOC513265 ref|XM_590926 unmapped Bos taurus similar to Homo sapiens collaborates/cooperates with ARF (alternate reading frame) protein (CARF) TTATTCTGAAGTTGTTTGAAATTCACCATGATTTTGACCTCTGCAGATTCTTTAAGTGGG A_73_100321 A_73_100321 FALSE XM_581288 XM_581288 LOC505061 ref|XM_581288 unmapped Bos taurus similar to Homo sapiens Werner syndrome (WRN) AAACTCTTGTACGCATTTTAAAATGGTGCTAGTGGGCCAGACCAGTGAAAATGAAACGTT A_73_100322 A_73_100322 FALSE XM_882299 XM_882299 LOC508936 ref|XM_882299 unmapped Bos taurus similar to Homo sapiens oxysterol binding protein-like 7 (OSBPL7), transcript variant 2 AGAAGGATCGAGCAGCTTCAGCGAGACAGGCGCAAAGTGATGGAGGAGAACAACATTGTC A_73_100323 A_73_100323 FALSE XM_587621 XM_587621 LOC510480 ref|XM_587621 unmapped Bos taurus similar to Homo sapiens proapoptotic caspase adaptor protein (PACAP) CCTGGGACGTGGCCAGGGCCTTTCCCTCTGGACTCAAATAAAACCAGTGACCCGGAAAAA A_73_100324 A_73_100324 FALSE XM_596819 XM_596819 LOC518625 ref|XM_596819 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to amino acid transporter (LOC146167) CGGCATCAGCTCCTTCTTCATCTTCATCTTCCCAGAGACGAGTGTGGCTGTCACTGTTGC A_73_100325 A_73_100325 FALSE XM_600895 XM_600895 LOC522611 ref|XM_600895 unmapped Bos taurus similar to Homo sapiens C-type lectin domain family 11, member A (CLEC11A) GGAGGCGGTGGGCACGAGGATAGGTCCCGCGCCAATAAAACGTTGTGGAATCCCTAAAAA A_73_100326 A_73_100326 FALSE XM_587321 XM_587321 LOC510203 ref|XM_587321 unmapped Bos taurus similar to Homo sapiens protein kinase C, delta binding protein (PRKCDBP) AGCACCCTGTGTCCTCTATAAGAGCAGCCACTCACACCTGTTTACACTCACCATCAATAA A_73_100327 A_73_100327 FALSE XM_882680 XM_882680 LOC520302 ref|XM_882680 unmapped Bos taurus similar to Homo sapiens vaccinia related kinase 3 (VRK3), transcript variant 1 AGTGGGGACACTGCCATTGGCACCACTGCGCTTTGACAATAAATTGTTTCATTGGAACTT A_73_100328 A_73_100328 FALSE XM_874316 XM_874316 LOC506230 ref|XM_874316 unmapped PREDICTED: Bos taurus similar to transmembrane protein 9, transcript variant 5 (LOC506230) CACTTGTCCCTGAGTTTCAGCGTCCCTGTGCATGGAGACGCTGTCCTTCGGTTACTCACT A_73_100329 A_73_100329 FALSE NM_001034367 NM_001034367 MGC127936 ref|NM_001034367 unmapped Bos taurus similar to Homo sapiens S100 calcium binding protein A2 (S100A2) TGTGCTGAAAGTGAAAGACCCAAAGCTGCTTTTTGCTGTGAGCTGTCTTTGTCCCTTTCA A_73_100330 A_73_100330 FALSE NM_001035504 NM_001035504 MGC127104 ref|NM_001035504 unmapped Bos taurus similar to Homo sapiens vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 1 CACGACCACCCGTCTGTCTGTTCATGGCGTCTGGAGTCCCCTCTTCCCAATAAAGCTGTT A_73_100331 A_73_100331 FALSE NM_212448 NM_212448 PRP5 ref|NM_212448 unmapped Bos taurus prolactin-related protein 13 (PRP5) ATACCATCCAGGGTCTGAGACGGGTCATAATGATCTATCCCATAGCAAGCTTTTTAATGC A_73_100332 A_73_100332 FALSE XM_589631 XM_589631 LOC512176 ref|XM_589631 unmapped Bos taurus similar to Homo sapiens SEC14 and spectrin domains 1 (SESTD1) TCCCCAGGTGATGTAGTAAATTTAGACTATAGCTCAACTGTTATTAGTAGACAGTGGTGT A_73_100333 A_73_100333 FALSE NM_001034466 NM_001034466 APCS ref|NM_001034466 unmapped Bos taurus similar to Homo sapiens amyloid P component, serum (APCS) CTTCTTTGAATTTCCCATCTACAAGTATGCCTAATTAAAAAATGTATTATGCCACCTGCC A_73_100334 A_73_100334 FALSE XM_864430 XM_864430 LOC518974 ref|XM_864430 unmapped Bos taurus similar to Homo sapiens ATPase, H+ transporting, lysosomal V0 subunit a4 (ATP6V0A4), transcript variant 2 GGGCTAAACTTTACAGGATTAGGAACTTTCTCATGAATTTTCACTCCAGGTGAGGAAGAA A_73_100335 A_73_100335 FALSE NM_174588 NM_174588 PTGER2 ref|NM_174588 unmapped Bos taurus prostaglandin E receptor 2 (subtype EP2), 53kDa (PTGER2) AGCAAAATTCATGTCTGTATGTTTATCTGGGAAACATGGCTTGACTCATGCTCTATAGGA A_73_100336 A_73_100336 FALSE XM_607585 XM_607585 LOC529145 ref|XM_607585 unmapped Bos taurus similar to Homo sapiens tachykinin receptor 1 (TACR1), transcript variant long TCGTCCTTGGACCAGATCTCCAATGACCCCTCTCACAGCGACTCTAAGACCACAATGGAG A_73_100337 A_73_100337 FALSE NW_930665 NW_930665 gb|Putative orthologue of human miRNA hsa-mir-346 on chr 10, (-) strand. Mature length 23 nt, stem-loop length 86 nt. Source: NW_930665.1:253412-253497 unmapped Unknown TGTCTGCCCGCATGCCTGCCTCTTATCCTACTATACGTATCACAT A_73_100338 A_73_100338 FALSE XM_613342 XM_613342 LOC540832 ref|XM_613342 unmapped Bos taurus similar to Homo sapiens TGF-beta induced apoptosis protein 2 (TAIP-2) AGCCTTGCAGAAAAGAGTAGATTGCACGAAGAGTGCATCAAATCGCCTGTGGTCGAGACT A_73_100339 A_73_100339 FALSE NM_001035015 NM_001035015 TOM1 ref|NM_001035015 unmapped Bos taurus similar to Homo sapiens target of myb1 (chicken) (TOM1) CCCCCCACCTGTCGGTTGATCCTCTTGACTGGGAGAGGTGCCTTTCGTATCCCCAATAAA A_73_100340 A_73_100340 FALSE XM_872656 XM_872656 LOC613986 ref|XM_872656 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 145 (C6orf145) GGCGGCCTACGTCACCAACCTGTCTTACTATCACCTGGTACCCTTCGAGACGGACATTCT A_73_100341 A_73_100341 FALSE NM_001035475 NM_001035475 CHCHD3 ref|NM_001035475 unmapped Bos taurus similar to Homo sapiens coiled- coil-helix-coiled-coil-helix domain containing 3 (CHCHD3) TTTTTTATAAACATAAAGGCAACCTGGCTTCTGCAACCTCTCCTCTATCATGAAAACCGA A_73_100342 A_73_100342 FALSE XM_617976 XM_617976 LOC537792 ref|XM_617976 unmapped PREDICTED: Bos taurus similar to cubilin (LOC537792) TGTCAATTTTCCATAAACATCTCTAAATGCCTGCGCTCGATTTTCGTCCTCTCCCCCGCG A_73_100343 A_73_100343 FALSE XM_595874 XM_595874 LOC517699 ref|XM_595874 unmapped Bos taurus similar to Homo sapiens cation channel, sperm associated 2 (CATSPER2), transcript variant 1 AGTCTCCAGCCTCACAGTCTGTTTCTTTACAGTGCAGGCACTGATGAACTTTGAAGACAA A_73_100344 A_73_100344 FALSE NM_181027 NM_181027 AKR1C1 ref|NM_181027 unmapped Bos taurus aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) (AKR1C1) CTGTACACGTGCATTCTACCAGAACATCTTGCTTCTAGGGCTGTGAAGAGGATTTCTGTA A_73_100345 A_73_100345 FALSE XM_582254 XM_582254 LOC505890 ref|XM_582254 unmapped Bos taurus similar to Homo sapiens ADAM-like, decysin 1 (ADAMDEC1) AATTTGAAGAGGTCTGTATTGCTTACACTGTCATTTAGCCACCAAGAATTGCTTCATTTA A_73_100346 A_73_100346 FALSE XM_584287 XM_584287 LOC507639 ref|XM_584287 unmapped Bos taurus similar to Homo sapiens PRP18 pre- mRNA processing factor 18 homolog (S. cerevisiae) (PRPF18) TTCCTTGTCTGCAGATGGTGGTAGTCATTGTCCATGCCTCACAGCATCACTGTTTTAAGT A_73_100347 A_73_100347 FALSE XM_613661 XM_613661 LOC540912 ref|XM_613661 unmapped Bos taurus similar to Homo sapiens dynein heavy chain domain 1 (DNHD1) ATGGCAGCCACGGGTTACCTAGGGAGAGGGTGGGCATCAGATCTGGACCTGCTGATATTA A_73_100348 A_73_100348 FALSE AW315959 AW315959 gb|Unidentified transcripts on BTA19 position 15930490-15929640 unmapped Unknown CTTTTCTGCCCAGGTCATGTTTTAATATGGTCCATCTTAGTGCCATATAGAGGTTAAAGA A_73_100349 A_73_100349 FALSE XM_864188 XM_864188 LOC613431 ref|XM_864188 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 144 (GPR144) CCTCGTTTTCCTGTTTTATAAATTGAACTTCCACAAACAACTGCTCTTGAACAACAGCTT A_73_100350 A_73_100350 FALSE EE910961 EE910961 gb|Bos taurus similar to Homo sapiens ATPase, Ca++ transporting, plasma membrane 2 (ATP2B2), transcript variant 2 unmapped Unknown AAGAGCTTATTTAATTGGATTGCCAGCCTCTTAACTGCTAAGCACTTTGTGGGTATCAGC A_73_100351 A_73_100351 FALSE EE961433 EE961433 gb|Unidentified transcripts unmapped Unknown AAATGACTCAGGATTAATGAGGATTAGAAGGACACTGAGTTACCATTTCTCACTCGTCAG A_73_100352 A_73_100352 FALSE NM_174118 NM_174118 MYOC ref|NM_174118 unmapped Bos taurus myocilin, trabecular meshwork inducible glucocorticoid response (MYOC) ATAGTTGGCTTCTAATGCTTCAGGTGGATCCAGTTGTGTATGACAGAATCTTTGCCCCAT A_73_100353 A_73_100353 FALSE XM_593131 XM_593131 LOC515159 ref|XM_593131 unmapped Bos taurus similar to Homo sapiens guanine nucleotide binding protein (G protein) alpha 12 (GNA12) CGGGGACTCGTGACACTACTGAAAGTCCAGCGGTCACTTTGATGTTAACGTGTGACGCCC A_73_100354 A_73_100354 FALSE NM_001035391 NM_001035391 RAB11A ref|NM_001035391 unmapped Bos taurus RAB11A, member RAS oncogene family (RAB11A) CATTGTTGCCCGGATGCCTCGTTTCTCTCGCCCGGTTACTAAAATGTATAATTCGAACTT A_73_100355 A_73_100355 FALSE XM_605067 XM_605067 LOC526694 ref|XM_605067 unmapped PREDICTED: Bos taurus similar to snail homolog 3 (LOC526694) ACCCGAGTTACCGCACGGTGGAGTCTCCTGCACCTCTGCACCGCCACCTCTTCTAGTCTT A_73_100356 A_73_100356 FALSE NM_001017949 NM_001017949 HNT ref|NM_001017949 unmapped Bos taurus neurotrimin (HNT) AAACAAGACAGCCTGACAGCTACAACAATCCCACAATCAACAGTCACAAAAGATATTCTT A_73_100357 A_73_100357 FALSE CB429854 CB429854 gb|Unidentified transcripts on BTA17 position 26737300-26738241 unmapped Unknown GATCCACAAATGCATGAAAGGACACATTTGCATCTTCCTGTCAGTATTCAGCTTCCCTTT A_73_100358 A_73_100358 FALSE CB452251 CB452251 gb|Bos taurus similar to Homo sapiens AF4/FMR2 family, member 1 (AFF1) unmapped Unknown AAACGTGTAATTGACTTGTTCGTCTTCAGATTCTTTACTTTTCATTAGAGGATCGAGCTG A_73_100359 A_73_100359 FALSE XM_590488 XM_590488 LOC407169 ref|XM_590488 unmapped PREDICTED: Bos taurus 12-lipoxygenase, transcript variant 1 (LOC407169) ACCAATTCCAAACAGATCTGGAAAACTTGGAAAGGGAAATTACAGCCCGCAATGAGCAAC A_73_100360 A_73_100360 FALSE XM_615142 XM_615142 LOC541226 ref|XM_615142 unmapped Bos taurus similar to Homo sapiens zinc finger protein, subfamily 1A, 2 (Helios) (ZNFN1A2) ACTACAGGTAGTTAAGGACAGCTACAATACATCTGAGGTCCTATGATCTTATTTTTCTAA A_73_100361 A_73_100361 FALSE XM_591974 XM_591974 LOC514168 ref|XM_591974 unmapped Bos taurus similar to Homo sapiens pyridoxal (pyridoxine, vitamin B6) kinase (PDXK) GCCTCTCGCAGCGAGTCGGGGTTAGTGTTCATGTCCAAAAAGTGATGTAAATGTCTTTAT A_73_100362 A_73_100362 FALSE XM_581644 XM_581644 LOC505368 ref|XM_581644 unmapped Bos taurus similar to Homo sapiens transmembrane protein 41A (TMEM41A) CTTTAAACTGCTGGCCATTGCCCTGGTGGCCTTAGTTCCTGGAACCCTCATTAAAAAATT A_73_100363 A_73_100363 FALSE NM_174746 NM_174746 ACAS2L ref|NM_174746 unmapped Bos taurus acetyl-Coenzyme A synthetase 2 (AMP forming)-like (ACAS2L) GGCTGGAGGGTGCAATTTGGGTTACTGTTTGGCTTGTTGGAAATTTAAGTTGGAAATGTT A_73_100364 A_73_100364 FALSE XM_869360 XM_869360 LOC617161 ref|XM_869360 unmapped Bos taurus similar to Homo sapiens IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L) CAAATATTTGTAAAAGAGTAATTGGTTTGGAAGGAGACAAAATTCTCACCAGTAGTCCAG A_73_100365 A_73_100365 FALSE XM_869315 XM_869315 LOC617123 ref|XM_869315 unmapped Bos taurus similar to Homo sapiens glutamate receptor, ionotropic, kainate 4 (GRIK4) AAAGGCCAGAGGTCCAACTATGCCTTGAAAATCTTGCAGTTCACAAGGAATGGTTTCCGG A_73_100366 A_73_100366 FALSE XM_864856 XM_864856 LOC526006 ref|XM_864856 unmapped Bos taurus similar to Homo sapiens enolase 2 (gamma, neuronal) (ENO2) CCCCGTGCCATGTTTCACAGCTGCCAGCACCTCTGTGGCGCTGAAATGAACACTTCCATT A_73_100367 A_73_100367 FALSE XM_875524 XM_875524 LOC520739 ref|XM_875524 unmapped PREDICTED: Bos taurus similar to Sorting nexin-12 (SDP8 protein), transcript variant 5 (LOC520739) GCTTTCATTCAGCAAAATGTTCATTCTTCTGTCAGACAATGTCATATTCAACTCTGTTCA A_73_100368 A_73_100368 FALSE XM_614716 XM_614716 LOC534818 ref|XM_614716 unmapped PREDICTED: Bos taurus similar to protein phosphatase 2, regulatory subunit B, beta isoform 1 (LOC534818) TTCGACACCTTCTTCAACATCGAGAAGTACCTGGACCACGAGCAGAAAGAGCAGGCATCC A_73_100369 A_73_100369 FALSE XM_609807 XM_609807 LOC531315 ref|XM_609807 unmapped Bos taurus similar to Homo sapiens histone deacetylase 7A (HDAC7A), transcript variant 1 ATTCTGAAGAAACAACAGGCGGCCCTAGAGAGAACGGTTCATCCTAATAGCCCCAAAAAA A_73_100370 A_73_100370 FALSE XM_586014 XM_586014 LOC509120 ref|XM_586014 unmapped Bos taurus similar to Homo sapiens regulator of chromosome condensation 2 (RCC2) ACTGTCTTTTTTATATATATATTTCTCGGAGTAAACATTTTAAATAAACGGCATCGTTGT A_73_100371 A_73_100371 FALSE XM_583672 XM_583672 LOC507114 ref|XM_583672 unmapped Bos taurus similar to Homo sapiens KIAA1967 (KIAA1967), transcript variant 2 TTTGGGGTGGTGGATGAAGAAGTCTTTTTTCAGCTAAGTGTGGTGAAGGGCCGGCTGCCC A_73_100372 A_73_100372 FALSE CB220572 CB220572 gb|Bos taurus similar to Homo sapiens cyclin-dependent kinase 2 (CDK2), transcript variant 2 unmapped Unknown TTATATTTCAGTTTATAGTAGTTTTTTAAGTGGGAATGGGTGGGGATTTGTTGCCATGTG A_73_100373 A_73_100373 FALSE XM_606796 XM_606796 LOC528374 ref|XM_606796 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily B, member 6 (OR2B6) ATGCTGAATCCCCTGATATATGCACTTAGAAACAAAGAGGTAAAGGAGGCCTTTAAAAGC A_73_100374 A_73_100374 FALSE XM_866291 XM_866291 LOC614703 ref|XM_866291 unmapped Bos taurus similar to Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 8 (PSMA8), transcript variant 3 GTTTAGTGCCAAAGAAATTGAATTACAATACAGTCATCCGTTGGTGCCGGCCCCTTGTGA A_73_100375 A_73_100375 FALSE NM_001038690 NM_001038690 MGC134344 ref|NM_001038690 unmapped Bos taurus similar to Homo sapiens hypothetical protein BC008604 (LOC92691) CATTGTGGAGTTGCTTGAATCAGACAACATCTCAGGCAACCTGTCCAACAAGGATGCCAC A_73_100376 A_73_100376 FALSE NM_001035473 NM_001035473 MGC40579 ref|NM_001035473 unmapped Bos taurus similar to Homo sapiens hypothetical protein MGC40579 (MGC40579) GCTTGGAAGATTCTGAAGGAGTTTATTTTGTTCCATCTTTTAGTGGATTGCAGGCTCCAT A_73_100377 A_73_100377 FALSE XM_581065 XM_581065 LOC538551 ref|XM_581065 unmapped Bos taurus similar to Homo sapiens estrogen receptor binding site associated, antigen, 9 (EBAG9), transcript variant 1 AAAGCTTCCTGTTATAGCCCCAAGCTATATTTTCAGTTATGGTTATTAGCTTTTGCCAGT A_73_100378 A_73_100378 FALSE XM_864396 XM_864396 LOC506924 ref|XM_864396 unmapped Bos taurus similar to Homo sapiens fibroblast growth factor 13 (FGF13), transcript variant 1A AAATCTGTGTTCCAAAAGTGGACATAGCATGTACAGGCAGTTTTCTGTCCTGTGCACAAA A_73_100379 A_73_100379 FALSE XM_602010 XM_602010 LOC523707 ref|XM_602010 unmapped PREDICTED: Bos taurus similar to Nuclear receptor coactivator 3 (NCoA-3) (Thyroid hormone receptor activator molecule 1) (TRAM-1) (ACTR) (Receptor-associated coactivator 3) (RAC-3) (Amplified in breast cancer-1 protein) (AIB-1) (Steroid receptor... TTTGAGCAGGACTGAATTTTAACCTGAAGTGTGATATCTGCCTGTTTTCTTTCCCTCCTC A_73_100380 A_73_100380 FALSE XM_597774 XM_597774 LOC519551 ref|XM_597774 unmapped Bos taurus similar to Homo sapiens nephronophthisis 4 (NPHP4) AAAGATGGGGACATGGACTGTGCCCTGCTGGTACTGGTGCCAGTGGCACAGTTGACTTCA A_73_100381 A_73_100381 FALSE XM_879312 XM_879312 LOC534839 ref|XM_879312 unmapped Bos taurus similar to Homo sapiens signal- induced proliferation-associated 1 like 1 (SIPA1L1) CCCTTTTGGGGAGTGCACAGCCTGACAATTGCAGATCAACAATCATTATCTGCCTTTTGT A_73_100382 A_73_100382 FALSE CB451804 CB451804 gb|Bos taurus similar to Homo sapiens period homolog 3 (Drosophila) (PER3) unmapped Unknown CATGCTGTGTGAATGGAATCATTTTACAATTAAGTGCAACTTCATCATAACTCGAAAGGT A_73_100383 A_73_100383 FALSE CB537396 CB537396 gb|Unidentified transcripts on BTAX position 14672133-14673237 unmapped Unknown CAATAAACAAGAGAGTCCTCCAGATCATTCCTGGATAACGTCATCTCTCTCTCCTGGCTT A_73_100384 A_73_100384 FALSE NM_001024535 NM_001024535 KIAA0141 ref|NM_001024535 unmapped Bos taurus KIAA0141 protein (KIAA0141) AGTGTAGATTTCGAGATCCTCGTTTGTGAAAGGTTTGTATCAGAAATGGATGGGAGTTTA A_73_100385 A_73_100385 FALSE NM_001034774 NM_001034774 MGC127860 ref|NM_001034774 unmapped Bos taurus similar to Homo sapiens brain specific protein (CGI-38) TGCTCTGGCCAAGTGCCTAATTCTTTCCTGGACCTCAATAAAGACACCTTTTGTACCAAT A_73_100386 A_73_100386 FALSE XM_864308 XM_864308 LOC514194 ref|XM_864308 unmapped Bos taurus similar to Homo sapiens ceruloplasmin (ferroxidase) (CP) ATTTACCATTCCCACATTGATGCTCCAAAAGACATCGCCTCAGGACTCATTGGGCCTTTA A_73_100387 A_73_100387 FALSE XM_592853 XM_592853 LOC514934 ref|XM_592853 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 94 (CCDC94) GAGGAATCAAGGAAAAGAAGACTCCTTGAAGACTCTGACTCAGAGGAGGACACCAGCCCC A_73_100388 A_73_100388 FALSE XM_867772 XM_867772 LOC615851 ref|XM_867772 unmapped Bos taurus similar to Homo sapiens homeobox A7 (HOXA7) TTCCAGAACCGCCGCATGAAGTGGAAGAAAGAACATAAGGAGGAGACCGCCGCCGCCGCC A_73_100389 A_73_100389 FALSE XM_613971 XM_613971 LOC534262 ref|XM_613971 unmapped Bos taurus similar to Homo sapiens ubiquitin specific peptidase 38 (USP38) TTCTGTATGTGCCTTGCAGTACTGTAATTCAAAAATAAGAATCTTTGGCTGCGGAAAAGG A_73_100390 A_73_100390 FALSE NM_001001141 NM_001001141 LOC407176 ref|NM_001001141 unmapped Bos taurus calcium activated potassium channel beta subunit (LOC407176) ACAGAGGGAAAGTAAACACAGATGGGGATTCATGGTTTTCAGTGTAGATTAAATACAAGG A_73_100391 A_73_100391 FALSE XM_599586 XM_599586 LOC521326 ref|XM_599586 unmapped Bos taurus similar to Homo sapiens hemicentin 1 (HMCN1) TAAAGAGCTGTCATATTCTCTTTTCTTAGTTATAGGTTTTCCTGTTGGACAGATTTTGCG A_73_100392 A_73_100392 FALSE CB443730 CB443730 gb|Unidentified transcripts on BTA21 position 47573620-47574504 unmapped Unknown TGGCTTCTCCTTTAAGAAATCTTAACACCAGAACTCTCAATCTTTAGCTTGTCAGCACAA A_73_100393 A_73_100393 FALSE CB166827 CB166827 gb|Unidentified transcripts on BTA16 position 37783839-37785410 unmapped Unknown TAGGCCTTAGATTTATGTTTACACTCACTTCTCTACTGTGTACTTTTTGTTCTCTTGGGG A_73_100394 A_73_100394 FALSE XM_592203 XM_592203 LOC514366 ref|XM_592203 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 4, subfamily D, member 9 (OR4D9) CAGGAGATGAAGGCAGCCATGCAGAGACTGAAGAAACAGCTAGGGCATTCAGAAAGGGTT A_73_100395 A_73_100395 FALSE XM_615852 XM_615852 LOC535742 ref|XM_615852 unmapped Bos taurus similar to Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC), transcript variant 1 TCCGGAAGCTGCCCTCTATGGCCGGTTCACCATCAAATCAGACGTGTGGTCCTTTGGGAT A_73_100396 A_73_100396 FALSE XM_585990 XM_585990 PROC ref|XM_585990 unmapped PREDICTED: Bos taurus protein C (inactivator of coagulation factors Va and VIIIa) (PROC) CTGGATTGTTGAATGGCAAGATGGTGGACATTAAAAAAGGGCTTGCTGCAAGCACACCAA A_73_100397 A_73_100397 FALSE XM_865504 XM_865504 LOC614134 ref|XM_865504 unmapped Bos taurus similar to Homo sapiens ring finger protein 41 (RNF41), transcript variant 1 TTTTTTAAAGAAAGGCCTGATTATGGCTACCCCACTTTTCTAGCCCAGCCACGTTGTTGG A_73_100398 A_73_100398 FALSE XM_610926 XM_610926 LOC532409 ref|XM_610926 unmapped PREDICTED: Bos taurus similar to high-mobility group box 3 (LOC532409) ACATGGCCTTTTTTCTGTGTTAACAATCAAACGAGGGAGGCAGACAATAAACAAGAGGTC A_73_100399 A_73_100399 FALSE AW660169 AW660169 gb|Bos taurus similar to Homo sapiens F-box and leucine-rich repeat protein 2 (FBXL2) unmapped Unknown CATCTCTCACAGAATTTGGGGGGCCTTAAAAAGAATTTAGGGCTCAAGTTATCTATAATC A_73_100400 A_73_100400 FALSE NM_001034373 NM_001034373 MGC127339 ref|NM_001034373 unmapped Bos taurus similar to Homo sapiens lipoma HMGIC fusion partner-like 5 (LHFPL5) TAACCTGGAAATTCTCTGAAACTGTGTCAGAGTTGTAACTGAGAAATATGTCATCTTTTG A_73_100401 A_73_100401 FALSE XM_882485 XM_882485 LOC511339 ref|XM_882485 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 2 (C1orf2), transcript variant 1 GCTACGAGGAGACAGTCAGGCCACTCTGTTTGATCCTCAGCTGCATGATGGCTCCTGCAT A_73_100402 A_73_100402 FALSE XM_610096 XM_610096 LOC531597 ref|XM_610096 unmapped PREDICTED: Bos taurus similar to rad and gem related GTP binding protein 2 (LOC531597) CGCGCAACGCCAAGTTCTTTAAGCAGCGCTCCAGATCGTGCCACGACCTCTCCGTGCTCT A_73_100403 A_73_100403 FALSE XM_864132 XM_864132 LOC613396 ref|XM_864132 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ38482 (FLJ38482) AGTTAGAACTCAAGTTCTGATGGGATATCTGTATAATCACCAACATGCTTTTCTAAACAG A_73_100404 A_73_100404 FALSE CB447065 CB447065 gb|Bos taurus similar to Homo sapiens KIAA0367 (KIAA0367) unmapped Unknown CAGTTATGGTACTGATTTTGCAACTCTCATCTAATTAATCATAATGCCTCTGTAGTTTGC A_73_100405 A_73_100405 FALSE XM_581026 XM_581026 LOC504845 ref|XM_581026 unmapped Bos taurus similar to Homo sapiens ring finger protein 39 (RNF39), transcript variant 2 TGAGCTCCCTGAAGATTACCCAGTGGTCAAAAACATGCTTCACAGACTGACGGCCGACCT A_73_100406 A_73_100406 FALSE XM_613663 XM_613663 LOC534041 ref|XM_613663 unmapped Bos taurus similar to Homo sapiens microtubule associated monoxygenase, calponin and LIM domain containing 2 (MICAL2) CCACGTGGAACCCTGTATTTTGCACACAGCGAAAAATGTTTAGCTTTATTTATGGTATTT A_73_100407 A_73_100407 FALSE XM_588780 XM_588780 LOC539690 ref|XM_588780 unmapped Bos taurus similar to Homo sapiens CD93 molecule (CD93) TAGGGTTAGAAGGCAGGGTTTGTTTCAAAACTACGTGAGTCAATTTGTCTCAATAAATGT A_73_100408 A_73_100408 FALSE XM_588310 XM_588310 LOC511054 ref|XM_588310 unmapped Bos taurus similar to Homo sapiens zinc finger, FYVE domain containing 19 (ZFYVE19) TGTGCCCTTTCTTAAGCCTCCGTTCCTGGAAGGAGGAAGGATTCTCCATTGGAGACAATG A_73_100409 A_73_100409 FALSE NM_001014850 NM_001014850 COMMD5 ref|NM_001014850 unmapped Bos taurus hypertension-related calcium- regulated gene (COMMD5) TGAAGTAGACAGCTGTGTCTTTCCCTGTTTTTGGAAGTAAAGCAACTGTATACGGACGCG A_73_100410 A_73_100410 FALSE XM_882152 XM_882152 LOC504323 ref|XM_882152 unmapped Bos taurus similar to Homo sapiens thrombospondin 3 (THBS3) CCTTCAACGGTGTGGACTTTGAAGGCACCTTCCATGTGAACACTGTGACGGACGATGACT A_73_100411 A_73_100411 FALSE NM_174645 NM_174645 IL12RB2 ref|NM_174645 unmapped Bos taurus interleukin 12 receptor, beta 2 (IL12RB2) GAAAGGCAAGAGTAGAAACCAAAACTCTTACTAGCAATGGCAAACAGTGCAGAGGACCAT A_73_100412 A_73_100412 FALSE XM_584026 XM_584026 LOC507428 ref|XM_584026 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 52, subfamily N, member 2 (OR52N2) GATTCGTGAGGGTGTGATCAAATTTTTACTTGGAGAGAAGGTTGTTTTTACCCAAGACAC A_73_100413 A_73_100413 FALSE XM_587964 XM_587964 LOC539539 ref|XM_587964 unmapped Bos taurus similar to Homo sapiens RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 1 AGGCCCCGAGAACTCAGGAATTTTTGTAGGGGATTGAAGCCAGAGCTAGTTGAATCCCAG A_73_100414 A_73_100414 FALSE NM_001024503 NM_001024503 ZNF297B ref|NM_001024503 unmapped Bos taurus zinc finger protein 297B (ZNF297B) ATACTTAGGTAATGTGGGTTTGTTTTGGTAGCTGCTTCACTGAATGAAATGCTCCTTATG A_73_100415 A_73_100415 FALSE XM_589979 XM_589979 LOC512459 ref|XM_589979 unmapped Bos taurus similar to Homo sapiens glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2) AATAACCTAGCTCACTAAGCTGTTTCAATTCTCTAGGTAGACAATTAAGTTGTCACAAAC A_73_100416 A_73_100416 FALSE XM_881332 XM_881332 BRG1 ref|XM_881332 unmapped Bos taurus similar to Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) TACCGAAAACTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACA A_73_100417 A_73_100417 FALSE AW462963 AW462963 gb|Bos taurus similar to Homo sapiens hypothetical protein FLJ13576 (FLJ13576) unmapped Unknown TTTCAGATCTCCATTAGTGGTAACACTTTTTTCTATTTGAGGTCAAAGGATTGGAAACAG A_73_100418 A_73_100418 FALSE XM_865043 XM_865043 LOC613861 ref|XM_865043 unmapped PREDICTED: Bos taurus similar to Glycine cleavage system H protein, mitochondrial precursor (LOC613861) AGCCCTGCTCTGTTGCTGGTGCAGAAATTCACAGAAAACACGAATGGGTAACAACAGAAA A_73_100419 A_73_100419 FALSE NM_177500 NM_177500 FUT2 ref|NM_177500 unmapped Bos taurus fucosyltransferase 2 (secretor status included) (FUT2) ACTGGTTCCGTGCTCGCTACAGCGCCCCCATCTTTGTGGTCTCCAGCAATGGCATGGCCT A_73_100420 A_73_100420 FALSE XM_613670 XM_613670 LOC534045 ref|XM_613670 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ90709 (FLJ90709) TCTACAATGTTAATACAGACCCCATGGTTGTGAAACTTATACAAAATAAAGGAACTAGGG A_73_100421 A_73_100421 FALSE XM_592575 XM_592575 LOC540239 ref|XM_592575 unmapped Bos taurus similar to Homo sapiens eve, even- skipped homeobox homolog 1 (Drosophila) (EVX1) ATCCAGGCCTCGGAGATGTGAGCTGGCGGCTGCCCTAAACCTGCCGGAAACCACAATCAA A_73_100422 A_73_100422 FALSE BM089961 BM089961 gb|Unidentified transcripts on BTA13 position 42750542-42753235 unmapped Unknown CGAGCTGTTATCTCCATGGTATTACTTGCTAAATGCACTGATTTCATAAGTATGTGGAAT A_73_100423 A_73_100423 FALSE XM_599849 XM_599849 LOC521584 ref|XM_599849 unmapped PREDICTED: Bos taurus similar to protein phosphatase 2, regulatory subunit B, alpha isoform 1 (LOC521584) TGCAGATTTTGTTTGGTTTTTGATCTCTGAGGAAGACAAAAGGAACCCCACCAGGTATGA A_73_100424 A_73_100424 FALSE XM_867487 XM_867487 LOC536763 ref|XM_867487 unmapped Bos taurus similar to Homo sapiens egl nine homolog 2 (C. elegans) (EGLN2), transcript variant 1 ATTGTGCTGGGAGGCTGGGCAGCTACGTCATCAATGGGCGCACCAAGGCCATGGTGGCAT A_73_100425 A_73_100425 FALSE EE909212 EE909212 gb|Unidentified transcripts on BTA12 position 772429-773402 unmapped Unknown AAACATGAATCTGGCTTTTCTTTCTGTAGAGTGAGTCAGAGAAAGCGTTAGGAAGAAGCC A_73_100426 A_73_100426 FALSE XM_587873 XM_587873 LOC510698 ref|XM_587873 unmapped Bos taurus similar to Homo sapiens vesicle amine transport protein 1 homolog (T californica) (VAT1) ATTACCGAAGCTGCCTTTGTGTTTGTGTCAATAAAACACCAAACCCTGAAACCCACGCGT A_73_100427 A_73_100427 FALSE XM_586433 XM_586433 LOC509469 ref|XM_586433 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 6 GCAACAGTTTTCCTGGTTTTAGCCAGGCACTCAAGCCTTTAACAGCCCATACACAATTGA A_73_100428 A_73_100428 FALSE NM_001034511 NM_001034511 MGC127475 ref|NM_001034511 unmapped Bos taurus similar to Homo sapiens adaptor- related protein complex 1, mu 2 subunit (AP1M2) TGAACCCAGAGGCCCCACTGGCCCATTTCTGAGTTTTAGGATGGCATTAAAAAGATGAAT A_73_100429 A_73_100429 FALSE NM_001034288 NM_001034288 MGC127815 ref|NM_001034288 unmapped Bos taurus similar to Homo sapiens saccharopine dehydrogenase (putative) (SCCPDH) TTGCTGTTTTAGCCTAGTTTTTCACCCATCTACACTGACTGATTTTGGACTCTTACCTAA A_73_100430 A_73_100430 FALSE XM_613495 XM_613495 LOC533928 ref|XM_613495 unmapped Bos taurus similar to Homo sapiens torsin family 1, member B (torsin B) (TOR1B) CCTCCTCACCCCGAGTAAGACGTAGATGAGTTTGGACTGACCTACTGAATGTCAAATAAT A_73_100431 A_73_100431 FALSE XM_603605 XM_603605 LOC525256 ref|XM_603605 unmapped Bos taurus similar to Homo sapiens prolactin regulatory element binding (PREB) TGCCCTAGCCTTGAGGAAAGGGAAAAGGAACTTCAGCCCATTTGGCATGAAAAGTTGATA A_73_100432 A_73_100432 FALSE AW345309 AW345309 gb|Unidentified transcripts on BTA10 position 1882863-1884411 unmapped Unknown TGTCATTGTTCATCTACAAACTCAAAACATAATCATTTTACGTACCTTGGGAGTGTGTAG A_73_100433 A_73_100433 FALSE NM_001035318 NM_001035318 PPT2 ref|NM_001035318 unmapped Bos taurus similar to Homo sapiens palmitoyl- protein thioesterase 2 (PPT2), transcript variant 2 ACCCTGGAATGGGTGTGTTACTATCCCTGTATTTATGAAAATAAAGTTGCATTTACTCCC A_73_100434 A_73_100434 FALSE EE959717 EE959717 gb|Unidentified transcripts unmapped Unknown CCCTAATCCTCTTTCTCAAAATTAACCACTGTTAACAGCTTCATACATTCTTTCAGGCTT A_73_100435 A_73_100435 FALSE NM_001038212 NM_001038212 MGC134238 ref|NM_001038212 unmapped Bos taurus similar to Homo sapiens polyamine- modulated factor 1 (PMF1) ACGACGTTCAGATTCCTCCCTGTTTTCTCCTAACTTGAGGACTCTTGGCCAGCTCCTGCC A_73_100436 A_73_100436 FALSE NM_001035425 NM_001035425 MGC128480 ref|NM_001035425 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 32 (C6orf32) ATGAACAGTTGGACAAATTTCCTCGAGACTGTGTAAAAGTTGGAGGTCGTCTTGCAAGTG A_73_100437 A_73_100437 FALSE XM_866121 XM_866121 LOC614573 ref|XM_866121 unmapped Bos taurus similar to Homo sapiens solute carrier family 16, member 7 (monocarboxylic acid transporter 2) (SLC16A7) GGAGTGTTAGCAGTGTCCTCTTTGAAACGCTCATGGACCTTGTTGGTGCTCAAAGATTTT A_73_100438 A_73_100438 FALSE NM_181029 NM_181029 CSN1S1 ref|NM_181029 unmapped Bos taurus casein alpha-S1 (CSN1S1) AAAGCCTTTGAATCACTTCTCCTGTAAGTGCCATCATATCAAATAATTGTGTGCATTAAC A_73_100439 A_73_100439 FALSE XM_868939 XM_868939 LOC616823 ref|XM_868939 unmapped PREDICTED: Bos taurus similar to phosphorylase kinase beta (LOC616823), partial mRNA. CAACGCCTTCAAGTTTTCCTCAACACATATGGTATTCAGACTCAAACTCCTCAACAGGTG A_73_100440 A_73_100440 FALSE XM_615736 XM_615736 LOC535628 ref|XM_615736 unmapped Bos taurus similar to Homo sapiens zinc finger protein 750 (ZNF750) ACCTGGCCCTCACTTTTCTCGTCTGGTCATTTTGACAACTCGAGTAGTCTTCTTCACAAA A_73_100441 A_73_100441 FALSE NM_181000 NM_181000 SAG ref|NM_181000 unmapped Bos taurus S-antigen; retina and pineal gland (arrestin) (SAG) CTTACCAGATCAAGGTGAAGCTCACGGTGTCAGGCCTTCTGGGAGAGCTCACATCCAGTG A_73_100442 A_73_100442 FALSE NW_931072 NW_931072 gb|Putative orthologue of human miRNA hsa-mir-197 on chr 1, (+) strand. Mature length 22 nt, stem-loop length 75 nt. Source: NW_931072.1:c749380-749306 unmapped Unknown TTCACCACCTTCTCCACCCAGCTATCCTACTATACGTATCACATA A_73_100443 A_73_100443 FALSE BI849974 BI849974 gb|Unidentified transcripts on BTA14 position 24809116-24808474 unmapped Unknown GTGTCCACACACATGCATTTAAATGCACTTGTAACTGGTTAACTACCATGAAGTCTAACT A_73_100444 A_73_100444 FALSE XM_584116 XM_584116 LOC507498 ref|XM_584116 unmapped Bos taurus similar to Homo sapiens cytoskeleton associated protein 2-like (CKAP2L) ACCTAAGCCCCAGAGACTCCCCATTTGCCTTTCCCAATCAGAATCAGTGTAAATATAATG A_73_100445 A_73_100445 FALSE XM_866295 XM_866295 LOC614708 ref|XM_866295 unmapped Bos taurus similar to Homo sapiens WD repeat domain 40C (WDR40C) TGCCTTGGGCGAGTTGCCCAATGCTCTCTACACCCATTGCTACAACTGGCCGGAGATGAA A_73_100446 A_73_100446 FALSE XM_582243 XM_582243 LOC505879 ref|XM_582243 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, subfamily F, member 1 (KCNF1) AGAACTCTGGAGGCCCCCTTGGGCACCTCTGATGAGTCTGGGGTAAGATTCCCTTTGTGT A_73_100447 A_73_100447 FALSE XM_611679 XM_611679 LOC532564 ref|XM_611679 unmapped Bos taurus similar to Homo sapiens leishmanolysin-like (metallopeptidase M8 family) (LMLN) CTGTGAGTATTCAGATGAATGGGTGGATTCATGATGGAAACCTGCTCTGCCCATCATGTT A_73_100448 A_73_100448 FALSE XM_616563 XM_616563 LOC536432 ref|XM_616563 unmapped PREDICTED: Bos taurus similar to thyroid adenoma associated isoform 1 (LOC536432) TTCTCCAAATTCCTGTCTTTACCGAGATTGGCTTATACCCTGGTTGCAAAAAGGAAGTCA A_73_100449 A_73_100449 FALSE CB448386 CB448386 gb|Unidentified transcripts on BTA17 position 4550761-4551513 unmapped Unknown TGCTAAGGGTTGTAAAACCAACGCACATAGCTCAGCTATTGCTGATGAAGTGAAAACACA A_73_100450 A_73_100450 FALSE XM_611761 XM_611761 LOC540503 ref|XM_611761 unmapped Bos taurus similar to Homo sapiens KIAA1414 protein (KIAA1414) TTGGAGTTTCGGTCATTGACGCTTCCGTGGCTCTTTTTGGTGTAGTGTTTCCTCATGTTT A_73_100451 A_73_100451 FALSE XM_864860 XM_864860 LOC614128 ref|XM_864860 unmapped Bos taurus similar to Homo sapiens Sec61 alpha 2 subunit (S. cerevisiae) (SEC61A2) GGTGAACGACGAGTAATTCATGCTAGGAATTTGTGTATGTTGTTGTACTTTACAGCAGCA A_73_100452 A_73_100452 FALSE XM_613350 XM_613350 LOC533821 ref|XM_613350 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein DKFZp761P0423 (DKFZp761P0423) TACCCCTTTCCCCGTGCCCTGCCTTGCCTTGGAAACATCCGTGTCTCTTGGGAAATGGTA A_73_100453 A_73_100453 FALSE CB425035 CB425035 gb|Unidentified transcripts on BTA3 position 67518200-67519048 unmapped Unknown AAACTATTCGTTGGAAAATAAAGCACAAGTGTAGAAAACACACAAAATAAATATAGGACT A_73_100454 A_73_100454 FALSE XM_606421 XM_606421 LOC528013 ref|XM_606421 unmapped Bos taurus similar to Homo sapiens smoothelin (SMTN), transcript variant 2 ACCTGCTGCCCTGTCTGTCGCGGCACCTTCCCACTGCAAACACGCAGCGTTTTGATAAAT A_73_100455 A_73_100455 FALSE BI975785 BI975785 gb|Unidentified transcripts on BTA10 position 27711494-27712513 unmapped Unknown TCTTCTTGGGGGATGGCTACTTCTTACTAATTGCTTCGTCTGCATCTCAACAAGGGAAAA A_73_100456 A_73_100456 FALSE XM_592449 XM_592449 LOC540226 ref|XM_592449 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ31438 (FLJ31438) GTTCTACATCTTAACCAGTTGAGGGAGCCTATATAACATTTTATGTATATTCATTGGGCA A_73_100457 A_73_100457 FALSE XM_615355 XM_615355 LOC535308 ref|XM_615355 unmapped PREDICTED: Bos taurus similar to Low-density lipoprotein receptor-related protein 1 precursor (LRP) (Alpha-2-macroglobulin receptor) (A2MR) (Apolipoprotein E receptor) (APOER) (CD91) (LOC535308), partial mRNA. CAGACGTGACAACCCAGGGCAGCATGATCCGCAGGATGCACCTGAATGGGAGTAACGTGC A_73_100458 A_73_100458 FALSE XM_589159 XM_589159 LOC511762 ref|XM_589159 unmapped Bos taurus similar to Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 7 (ABCA7), transcript variant 1 TATTTCCAGTCGCCCCTGCGTTGGGAGGTGGTCGGCAAGAACCTCTTGGCCATGTTCATA A_73_100459 A_73_100459 FALSE XM_611136 XM_611136 LOC505854 ref|XM_611136 unmapped Bos taurus similar to Homo sapiens chromosome 10 open reading frame 57 (C10orf57) GTCCTTGGTTGCACTGACATTCTCCCTGTCACCTGCTTTAAGCCACATACTAAGTTTGAT A_73_100460 A_73_100460 FALSE XM_604832 XM_604832 LOC526461 ref|XM_604832 unmapped Bos taurus similar to Homo sapiens interferon induced transmembrane protein 5 (IFITM5) TGGCCCTCAGGCCAGCTCCTTCCTCCCCACTCACCAGCCTCGGCTGTTCAATTAAAAAGA A_73_100461 A_73_100461 FALSE EE890884 EE890884 gb|Unidentified transcripts on BTA6 position 37650172-37649094 unmapped Unknown ATTGGTTTCTCACTGGAAAATCAGAGTAGATGTTTGGGGGTCAGCTCACGGCTTGGATAT A_73_100462 A_73_100462 FALSE XM_871033 XM_871033 LOC618708 ref|XM_871033 unmapped PREDICTED: Bos taurus similar to interleukin 11 precursor (LOC618708) AGACCTGTTCTCCTACCTGAGGCATGTGCAGTGGCTGCGACGTTCAGGAGGCCCTTCCCT A_73_100463 A_73_100463 FALSE XM_869847 XM_869847 LOC512756 ref|XM_869847 unmapped Bos taurus similar to Homo sapiens COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) AGCTGTCAAGGGGAGGGGTGCTACACTCCCTTGAGAGAAACCTGTCACTAATAAAAGGGG A_73_100464 A_73_100464 FALSE NM_001025316 NM_001025316 RPS28 ref|NM_001025316 unmapped Bos taurus similar to Homo sapiens ribosomal protein S28 (RPS28) GTGCGCGAGGGCGACGTGCTCACCCTGTTGGAGTCAGAGCGAGAGGCTCGGAGGCTGCGC A_73_100465 A_73_100465 FALSE NM_174503 NM_174503 APELIN ref|NM_174503 unmapped Bos taurus apelin; peptide ligand for APJ receptor (APELIN) GGAGCGGCCCAGGCCCCTGGCAGGGAGGTCGGAGGAAGTTCCGGCGCCAGCGGCCACGCC A_73_100466 A_73_100466 FALSE EE935851 EE935851 gb|Unidentified transcripts on BTA2 position 42775167-42774666 unmapped Unknown ATCGGGGAGTGTTTGGTTTTGCCCGAAGAGGGAAACACTCATTTTAGAAAATGGCTGTGT A_73_100467 A_73_100467 FALSE CB450547 CB450547 gb|Bos taurus similar to PREDICTED: Homo sapiens similar to RIKEN cDNA A230079K17 (LOC127602) unmapped Unknown TTATCAAATATAAAAAGTATTCTTTACGAAGAAATTTGTCATTCTGTATGTCTCTTCCTG A_73_100468 A_73_100468 FALSE XM_597011 XM_597011 LOC518810 ref|XM_597011 unmapped Bos taurus similar to Homo sapiens spermatogenesis and oogenesis specific basic helix-loop-helix 2 (SOHLH2) CTTAGTTTCATACATACTTGGATCTCCCCAACCAAGGTGCTCTAAGAACAAATGGCCTAG A_73_100469 A_73_100469 FALSE XM_866719 XM_866719 LOC615030 ref|XM_866719 unmapped PREDICTED: Bos taurus similar to interleukin 15 receptor, alpha isoform 1 precursor (LOC615030), partial mRNA. CATGGGAGAGCCTCCTGTTTCATCCTTCCTAGAGACCAAAGCTCTGGATTCCGCCAGGGT A_73_100470 A_73_100470 FALSE XM_588510 XM_588510 LOC539641 ref|XM_588510 unmapped Bos taurus similar to Homo sapiens UTP6, small subunit (SSU) processome component, homolog (yeast) (UTP6) GAAGCAGTTGTTTGAGTTGTATATCCTTCAACGTAACATGATGTTACTGGGAGAAGCATT A_73_100471 A_73_100471 FALSE NM_174274 NM_174274 CIP29 ref|NM_174274 unmapped Bos taurus cytokine induced protein 29 kDa (CIP29) GCCCTTTTTCTCATTTGAGAATCTTTTCCTTCCTAAGTGTTAGAGTAAAGGGCACCTCCT A_73_100472 A_73_100472 FALSE NM_001034611 NM_001034611 PDZK1 ref|NM_001034611 unmapped Bos taurus similar to Homo sapiens PDZ domain containing 1 (PDZK1) AGGTATCTGAGCAGATAAGCCTATTAAAACTATGCTTTCATAAGAATGTTGTTGTTGCTG A_73_100473 A_73_100473 FALSE M15886 M15886 gb|Bos taurus endozepine (putative ligand of benzodiazepine receptor) mRNA, complete cds unmapped Unknown CTCAAGACAGCCCAGGATATGACTAACAGATTAGGAGCTGAAACGGTTACTAATCCTTGC A_73_100474 A_73_100474 FALSE XM_611754 XM_611754 LOC532622 ref|XM_611754 unmapped Bos taurus similar to Homo sapiens SET domain containing (lysine methyltransferase) 8 (SETD8) GCTTTTTCTTTTTCCACCCTTGGTTTGCTTCTGTAGAAGAGATATGAGATGGTACACTAT A_73_100475 A_73_100475 FALSE XM_868723 XM_868723 LOC616645 ref|XM_868723 unmapped PREDICTED: Bos taurus similar to protein phosphatase 1 (formerly 2C)-like (LOC616645) CACCCCTCTATCTTCGGGATCTTCGACGGGCACGGGGGCGAGACTTCAGGTGAAAATTTT A_73_100476 A_73_100476 FALSE XM_599421 XM_599421 LOC521163 ref|XM_599421 unmapped Bos taurus similar to Homo sapiens ATPase, H+/K+ exchanging, alpha polypeptide (ATP4A) CGTGGACCAGGTTAACCGGAAGGATGCCCGTGCCTGTGTGATTAATGGCATGCAGCTGAA A_73_100477 A_73_100477 FALSE XM_592271 XM_592271 LOC540202 ref|XM_592271 unmapped Bos taurus similar to Homo sapiens chromosome 14 open reading frame 102 (C14orf102), transcript variant 2 AGCACTGCAGAATTGTCCTTGGGCAAAGGCGCTGTACATGGATGCCGTCGAGTACTTCCC A_73_100478 A_73_100478 FALSE XM_586074 XM_586074 LOC509172 ref|XM_586074 unmapped Bos taurus similar to Homo sapiens sterile alpha motif domain containing 4B (SAMD4B) CGTCCTCAAATCCCTGGAGAAGGATGTGCTGGAAGGCGGAAATCTGCGAAACGCTCTGCA A_73_100479 A_73_100479 FALSE XM_874882 XM_874882 LOC613927 ref|XM_874882 unmapped Bos taurus similar to Homo sapiens protein disulfide isomerase family A, member 6 (PDIA6) TTGAAGCGTTTTTCTCTCCCTCTGACTTGCTGCTTGGATGTTCTTGGAGGCTGTTTCTTA A_73_100480 A_73_100480 FALSE EE893810 EE893810 gb|Bos taurus similar to Homo sapiens immunoglobulin superfamily containing leucine-rich repeat 2 (ISLR2) unmapped Unknown CCTGGAGCCCGCGCCCTTTTCTAAAGGCGTCTGTATGATGTAAACAGTCAATAAAACAAT A_73_100481 A_73_100481 FALSE NM_001035047 NM_001035047 YKT6 ref|NM_001035047 unmapped Bos taurus similar to Homo sapiens YKT6 v-SNARE homolog (S. cerevisiae) (YKT6) TTTCTCTGTGTTCTGTTTGGAAGGTTCCTATGTGGATAAAGTTGTCTTTTGAAGTGCCAA A_73_100482 A_73_100482 FALSE EE910255 EE910255 gb|Unidentified transcripts unmapped Unknown TTGGCTAAACAGTAATTAATTTATTTTTGTGAAAAATGCCCCTGTCCTAGGGATTTTTGA A_73_100483 A_73_100483 FALSE XM_590243 XM_590243 LOC539904 ref|XM_590243 unmapped Bos taurus similar to Homo sapiens ring finger and KH domain containing 3 (RKHD3) GAGCGAGCCCGAGTGCCCGGTCTGCCACACCGCGGTCACTCAGGCCATCCGCATCTTTTC A_73_100484 A_73_100484 FALSE XM_864447 XM_864447 LOC524515 ref|XM_864447 unmapped PREDICTED: Bos taurus similar to rai-like protein (LOC524515) CAGACACTTTGTGCAGCACCTGTTGGGGCTGGGCATGAACTACTATGTGAGGGGAGCAGT A_73_100485 A_73_100485 FALSE XM_596556 XM_596556 LOC518366 ref|XM_596556 unmapped Bos taurus similar to Homo sapiens tumor necrosis factor receptor superfamily, member 17 (TNFRSF17) TGTTGGGAGCTTAACTCTGGAAACTTCCTTGGTTTCATGATTAAATTGACTCACTGAAAA A_73_100486 A_73_100486 FALSE XM_866416 XM_866416 LOC614791 ref|XM_866416 unmapped Bos taurus similar to Homo sapiens hypothetical protein MGC10471 (MGC10471) CGCCTGGAAGGACGACTTCGCCCTCAACAGCATGCTTCGGAAAAGGTTCCGGGAAAAGAA A_73_100487 A_73_100487 FALSE CB456838 CB456838 gb|Unidentified transcripts unmapped Unknown TGAGGCTTTGCCCAAGTCCCAAAGAGCAAACGTAATCAGAGAAGTGCGAAAATGCTGAAA A_73_100488 A_73_100488 FALSE XM_617206 XM_617206 LOC537051 ref|XM_617206 unmapped Bos taurus similar to Homo sapiens a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 (ADAMTS9), transcript variant 3 GCTAGTGCTTGTGTTTATGTTAAAAGCAAGCCTTAGCTTCAATCTCGATCCCATATTCGG A_73_100489 A_73_100489 FALSE XM_600128 XM_600128 LOC521857 ref|XM_600128 unmapped Bos taurus similar to Homo sapiens tribbles homolog 1 (Drosophila) (TRIB1) GAATGATCATTGGCAATATTACCTTGACAGAATCATGGGACTTGGAGAAGGAGGACAGAG A_73_100490 A_73_100490 FALSE XM_613307 XM_613307 LOC540823 ref|XM_613307 unmapped Bos taurus similar to Homo sapiens zinc finger protein 367 (ZNF367) CATTCATTGGAAGCAGTTCTCACAGAAAGCACTTTCTGAATAAGACACTTGTATGCGCGA A_73_100491 A_73_100491 FALSE XM_580419 XM_580419 LOC538451 ref|XM_580419 unmapped PREDICTED: Bos taurus similar to PI-3-kinase- related kinase SMG-1 (LOC538451), partial mRNA. GTGACATGGTTATTACATATGGATTAGATCAACTGGAGAATTGCCAGACTTGTGGTACAG A_73_100492 A_73_100492 FALSE NM_001025332 NM_001025332 FABP2 ref|NM_001025332 unmapped Bos taurus similar to Homo sapiens fatty acid binding protein 2, intestinal (FABP2) TGATTGATTAGATCTTTCATAAGCATTGGTCAATGGCTTATATTTCCAGTCTCACCAAAG A_73_100493 A_73_100493 FALSE XM_875700 XM_875700 LOC614253 ref|XM_875700 unmapped Bos taurus similar to Homo sapiens interferon regulatory factor 6 (IRF6) TCATTCTATTTGTACAAGGCAAAACTGCCTAGAACAGAACCCTTCTGCCTTGTTCTTGCG A_73_100494 A_73_100494 FALSE XM_582754 XM_582754 LOC506324 ref|XM_582754 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, subfamily G, member 2 (KCNG2) ACGCTCCTTGGGACAGTCTCCTCTCGGAAGGACAGCTCCTCAGAGGAACATGGGAGCTGC A_73_100495 A_73_100495 FALSE XM_583512 XM_583512 LOC506978 ref|XM_583512 unmapped Bos taurus similar to Homo sapiens HEAT repeat containing 1 (HEATR1) GTAGGGGTACACTGGAAGAGCCTCATGGTTTCCATTACTTCCAAAAAACTAAATGTTGTG A_73_100496 A_73_100496 FALSE EE895712 EE895712 gb|Unidentified transcripts on BTA25 position 26997544-26996877 unmapped Unknown TCACTGGTACAATTAGTGATCCCAGGAGCAGATGAAGAAGCAGTTCCCAATTTACTAGCA A_73_100497 A_73_100497 FALSE NW_928278 NW_928278 gb|Putative orthologue of human miRNA hsa-mir-217 on chr 2, (-) strand. Mature length 24 nt, stem-loop length 110 nt. Source: NW_928278.1:c623023-622916 unmapped Unknown TACTGCATCAGGAACTGATTGGATTATCCTACTATACGTATCACA A_73_100498 A_73_100498 FALSE XM_590109 XM_590109 LOC512571 ref|XM_590109 unmapped Bos taurus similar to Homo sapiens pyruvate kinase, muscle (PKM2), transcript variant 1 TTCCATTTCCCCCACTACTGCAGCTGCCTCCAGGCTTGTTGCTATAGAGCCTACCTGTAT A_73_100499 A_73_100499 FALSE AU278579 AU278579 gb|Bos taurus similar to Homo sapiens inositol 1,3,4-triphosphate 5/6 kinase (ITPK1) unmapped Unknown TCCGGGGGAAGCAGGAAGCGTGGCCGGCCTCTTGCACTGCTTTGTCTCCAAAATAAACTA A_73_100500 A_73_100500 FALSE XM_867091 XM_867091 LOC615314 ref|XM_867091 unmapped PREDICTED: Bos taurus similar to cytoplasmic polyadenylation element binding protein 2 isoform A (LOC615314) TTTCCAGCCCAACCATCAAGGACAAACCTGTTCAGATCCGTCCTTGGAATTTGAGTGATA A_73_100501 A_73_100501 FALSE XM_868319 XM_868319 LOC616323 ref|XM_868319 unmapped PREDICTED: Bos taurus similar to granulysin isoform NKG5 (LOC616323) CTCAATCGCATCTCTAAGGACATCATGGCTAGGAAGACACCTCAGGCCATCTGTGTGGAC A_73_100502 A_73_100502 FALSE CB456675 CB456675 gb|Unidentified transcripts on BTA5 position 29165000-29164282 unmapped Unknown AACAATCTATATAGTGTCATAAACACCTTCCCACTAGTGAATAAAACTGCTATTTGCTGC A_73_100503 A_73_100503 FALSE NM_001034594 NM_001034594 MGC129029 ref|NM_001034594 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 113 (C6orf113) CTCAAGTCTTTACAGCTGAGAAGATCCCTTGAAGAAGTCAGCATTTCAGTGATTGTGGAA A_73_100504 A_73_100504 FALSE AW655471 AW655471 gb|Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein LOC646431 (LOC646431) unmapped Unknown GAAACATCTGGGCTTTATTCTTCAAGCGTTGGAGGTTGATGTGTCCTGTCAAGGGGTAAA A_73_100505 A_73_100505 FALSE NM_175715 NM_175715 ADCYAP1R1 ref|NM_175715 unmapped Bos taurus adenylate cyclase activating polypeptide 1 (pituitary) receptor type I (ADCYAP1R1) TTGGCCCAAGAAAAAACTGCCAAGATCCAGAAAAGTGGATCTGAGTGGAATTTAGATGCA A_73_100506 A_73_100506 FALSE XM_589281 XM_589281 LOC511863 ref|XM_589281 unmapped Bos taurus similar to Homo sapiens dihydropyrimidinase-like 4 (DPYSL4) CTGCCCAGCGGCCCCAATCCCATGGAACCAGCTTGATTAAAGGCATCTGGACTGGAAGCC A_73_100507 A_73_100507 FALSE CB167234 CB167234 gb|Bos taurus similar to Homo sapiens praja 1 (PJA1), transcript variant 1 unmapped Unknown TTTGTCCAAGAGGCATCATCATTTCTGTTGCATGTTATGGGTTAATGTTCCTGTAATTGC A_73_100508 A_73_100508 FALSE NM_001034546 NM_001034546 MGC128494 ref|NM_001034546 unmapped Bos taurus similar to Homo sapiens TGF beta- inducible nuclear protein 1 (TINP1) ACTACACACCAATTGGGAAACCGTTACTCTGATATTTCTGAATACTACCAACCAACCTTA A_73_100509 A_73_100509 FALSE XM_592227 XM_592227 LOC540196 ref|XM_592227 unmapped Bos taurus similar to Homo sapiens paired box gene 9 (PAX9) CATCGCTGGCGTTCAAGGGAATGCAGGCAGCCCGAGAAGGTAGCCACTCTGTCACAGCTT A_73_100510 A_73_100510 FALSE XM_589799 XM_589799 LOC539843 ref|XM_589799 unmapped Region on BTA1 3' of LOC539843 (similar to Zinc finger and BTB domain-containing protein 38) AGCCTCAAGTTCAGCTTCCAGAGACTGTTCAGCCCCCAACAGTCCCCAGTTCATGATCAG A_73_100511 A_73_100511 FALSE XM_593586 XM_593586 LOC515551 ref|XM_593586 unmapped Bos taurus similar to Homo sapiens regulatory solute carrier protein, family 1, member 1 (RSC1A1) TCAATCAGACTTCTGAGCAAACTGAGTCCTCATCACCCGCTTGCATCCTGGTTAAAGATT A_73_100512 A_73_100512 FALSE XM_586530 XM_586530 LOC509545 ref|XM_586530 unmapped Bos taurus similar to Homo sapiens piwi-like 4 (Drosophila) (PIWIL4) CAAGCTGACCTTCCTGGTGGCACAAAGCCTTCATAAAGAACCAAGTTTGGAATTAGCCAA A_73_100513 A_73_100513 FALSE XM_606815 XM_606815 LOC528393 ref|XM_606815 unmapped PREDICTED: Bos taurus similar to retinal degeneration B beta (LOC528393) AGATTTGACCACTTGATAGATCTGTCCCAGGTGAATGCCAACTCCAGAGTTCCTGAAACT A_73_100514 A_73_100514 FALSE XM_875494 XM_875494 LOC511108 ref|XM_875494 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ13611 (FLJ13611) GATTTGCCCTTAAATTGAAGAGGTAATTAATGAAACGTCCGTGCAAAATAAAGTGCAAGC A_73_100515 A_73_100515 FALSE NM_001024553 NM_001024553 KCND1 ref|NM_001024553 unmapped Bos taurus voltage-gated shal-type potassium channel member 1 (KCND1) TCAGGTTCCCTGTCCCCAGCACTGTCCCTGTGGAGGTGGTGGCTGACAAAGATGTAGTTT A_73_100516 A_73_100516 FALSE XM_864841 XM_864841 LOC613759 ref|XM_864841 unmapped Bos taurus similar to Homo sapiens ubiquitin- like, containing PHD and RING finger domains, 2 (UHRF2), transcript variant 2 TTGAGGACTGGGCTGACTTTTTGAGAGGATTGAAATTGCTTCATATTGTGATCCTAAATT A_73_100517 A_73_100517 FALSE XM_616648 XM_616648 LOC536516 ref|XM_616648 unmapped Bos taurus similar to Homo sapiens tudor domain containing 1 (TDRD1) CGAAGCTACAGAAACAAGTTGAAAAGCATGAGCAAATTCTTCTCTTCCTTTTAAACAATC A_73_100518 A_73_100518 FALSE XM_878997 XM_878997 LOC524222 ref|XM_878997 unmapped Bos taurus similar to Homo sapiens extracellular matrix protein 1 (ECM1), transcript variant 1 ACTAGCTCAGCAGAAATCTTTCCACTGGCTAAGTTGGGACCACAACTAAACGGCTTAACA A_73_100519 A_73_100519 FALSE XM_870878 XM_870878 LOC618548 ref|XM_870878 unmapped PREDICTED: Bos taurus similar to EEA1 (Early Endosome Antigen, Rab effector) homolog family member (eea-1) (LOC618548), partial mRNA. ATGAAAGAAAGGTCGCAGAGCTGAAATCGAAACTGGATTCCGCAGAAAGATTCCTGAGAA A_73_100520 A_73_100520 FALSE XM_865788 XM_865788 LOC614328 ref|XM_865788 unmapped PREDICTED: Bos taurus similar to bone morphogenetic protein 8A (LOC614328) AGGGTGGCGGTGCTTTGAGAAACAATGGTGTTGGACACCCCAAGGGTGAGCCTGAAGTCT A_73_100521 A_73_100521 FALSE NM_001040594 NM_001040594 LOC616641 ref|NM_001040594 unmapped Bos taurus similar to Homo sapiens transmembrane protein 55A (TMEM55A) GTTTAGTGTACCTTCAAAGACTTGACATTCTTGTCAGATAAAGACCATTTCTAGATACTG A_73_100522 A_73_100522 FALSE EE913420 EE913420 gb|Unidentified transcripts on BTA3 position 60873483-60874091 unmapped Unknown ACCTTGTGCGGATTATTGGGAACATTGTAGCTGTTTCTGTGTTTTTTCTTACCTTGTAGT A_73_100523 A_73_100523 FALSE XM_866011 XM_866011 LOC615037 ref|XM_866011 unmapped Bos taurus similar to Homo sapiens bone morphogenetic protein 2 (BMP2) ATAGCAGTTTCCATCACCGAATTAATATTTATGAAATTATAAAACCTGCCACAGACAGGC A_73_100524 A_73_100524 FALSE NM_174498 NM_174498 ADRA1A ref|NM_174498 unmapped Bos taurus adrenergic, alpha 1A, receptor (ADRA1A) TTACTCCACAGCCTTTTCAACATGGCATAGAAAGGCTTTTCTTGGCAAATCACTTACCTT A_73_100525 A_73_100525 FALSE XM_867503 XM_867503 LOC615641 ref|XM_867503 unmapped Bos taurus similar to Homo sapiens chromosome 14 open reading frame 147 (C14orf147) TGGGTGCTGCAAATGCATTTGCACATTGCAATATGATGAGATGAATTGTTAAAACGTATA A_73_100526 A_73_100526 FALSE BI975824 BI975824 gb|Bos taurus similar to Homo sapiens ADP-dependent glucokinase (ADPGK) unmapped Unknown GATCATGTATATTTTACAGTGATACATCACATCTGTTAAAGAGTTCAACCTCCTAAGAGC A_73_100527 A_73_100527 FALSE XM_865625 XM_865625 LOC614226 ref|XM_865625 unmapped PREDICTED: Bos taurus similar to heat shock 70kD protein binding protein (LOC614226) TCAAGCATAATGCCCTTCTGACATAAAGCCCTGCTGGAGGAAAAGCAACTTAGATCACCT A_73_100528 A_73_100528 FALSE XM_863965 XM_863965 LOC613430 ref|XM_863965 unmapped Bos taurus similar to Homo sapiens death- inducing-protein (DIP) ATGTCTGAAGCTTGAGTCTATTTTCAATCTGTAAATGCTCCTTACCAGTAACTTTTGTTC A_73_100529 A_73_100529 FALSE NM_001013597 NM_001013597 MOCS1 ref|NM_001013597 unmapped Bos taurus molybdenum cofactor synthesis 1 (MOCS1) AGAGACACTTCAGTTCCCACCTGGACTCAGATGCCAACCCAAAGTGCCTTAGCCCAACAG A_73_100530 A_73_100530 FALSE XM_588865 XM_588865 LOC511517 ref|XM_588865 unmapped PREDICTED: Bos taurus similar to Taste receptor type 1 member 3 precursor (Sweet taste receptor T1R3) (LOC511517) TGCCTAAGTGCTACCTGCTGCTGTGGCGGCCAGACCTCAACACCCCCGAGTTCTTCTTGG A_73_100531 A_73_100531 FALSE XM_871669 XM_871669 LOC613293 ref|XM_871669 unmapped Bos taurus similar to Homo sapiens leucyl-tRNA synthetase 2, mitochondrial (LARS2), nuclear gene encoding mitochondrial protein ATTTGTTCCCCGATGCCTTTTTCTGAAGTAGGCTCAAATGTGGCCCCCTGCAGTTCAGCA A_73_100532 A_73_100532 FALSE XM_601269 XM_601269 LOC522979 ref|XM_601269 unmapped Bos taurus similar to Homo sapiens membrane frizzled-related protein (MFRP) AGGTGGTGGAGGTCCTCAGAGGTTACAAGAGCCTGACAAGCCTGCCCTGCTACCAGAATT A_73_100533 A_73_100533 FALSE XM_867432 XM_867432 LOC525346 ref|XM_867432 unmapped Bos taurus similar to Homo sapiens nuclear receptor coactivator 1 (NCOA1), transcript variant 3 AGAATCCCTGGGGCCTCTTCTTTTAGAGGCTTTGGATGGATTTTTCTTTGTTGTGAACTG A_73_100534 A_73_100534 FALSE NM_176640 NM_176640 SLC35A2 ref|NM_176640 unmapped Bos taurus solute carrier family 35 member A2 (SLC35A2) GGTTTGTTTTTTAAGGGACTGTAATGAACAAATGTCAGGATACCCAATGCCAAATAAAGA A_73_100535 A_73_100535 FALSE XM_596577 XM_596577 LOC518385 ref|XM_596577 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 123 (GPR123) TGCCGCCCCCTTCGGCTCAGACAGCACAGGCAACATCCGCACGGGGCCCTGGAGGAACGA A_73_100536 A_73_100536 FALSE NM_001034252 NM_001034252 MGC128882 ref|NM_001034252 unmapped Bos taurus similar to Homo sapiens F-box and leucine-rich repeat protein 21 (FBXL21) GGTGAAATTCACACTGAAGTCTCCAAATACCTGGGAAGAATATGGTTTCCTGATGTCATG A_73_100537 A_73_100537 FALSE NW_990550 NW_990550 gb|Putative orthologue of human miRNA hsa-mir-185 on chr 22, (+) strand. Mature length 18 nt, stem-loop length 82 nt. Source: NW_990550.1:7423-7501 unmapped Unknown TGGAGAGAAAGGCAGTTCTATCCTACTATACGTATCACATAGCGT A_73_100538 A_73_100538 FALSE XM_867132 XM_867132 LOC615346 ref|XM_867132 unmapped PREDICTED: Bos taurus similar to DHHC- containing protein 20 (LOC615346) TTGAGGGAAGGTTTTGAAACAAACATGTCCACTTTCAAGAAAGTTGTTTCGTACTTGTGA A_73_100539 A_73_100539 FALSE CB532597 CB532597 gb|Unidentified transcripts on BTA5 position 21575461-21576430 unmapped Unknown AAATCAGAGTCAGGTTACCAACCCAACTGTCTCCTTATGTCAGGAATTCTAAACTGGGGT A_73_100540 A_73_100540 FALSE XM_585636 XM_585636 LOC508805 ref|XM_585636 unmapped Bos taurus similar to Homo sapiens golgi autoantigen, golgin subfamily a, 2 (GOLGA2) GGACGGGTTTGTGCCCGGGTGATTCGACTCCTGTTTCGTTTCACTTTTTATTTCTGAATA A_73_100541 A_73_100541 FALSE NM_174483 NM_174483 VAMP2 ref|NM_174483 unmapped Bos taurus vesicle-associated membrane protein 2 (synaptobrevin 2) (VAMP2) TGCGCCATCATCCTCATTATCATCATCGTTTACTTCAGCTCTTAAACCCCTGAGGAGCCT A_73_100542 A_73_100542 FALSE XM_877162 XM_877162 LOC504520 ref|XM_877162 unmapped PREDICTED: Bos taurus similar to heterogeneous nuclear ribonucleoprotein L isoform a, transcript variant 4 (LOC504520) GTAGATTCCATGGGCCTCCAAGACAATAGGATCCTCTCCATTCCTCGCCATGTGGGTTTG A_73_100543 A_73_100543 FALSE XM_580279 XM_580279 LOC538430 ref|XM_580279 unmapped Bos taurus similar to Homo sapiens synaptic vesicle glycoprotein 2C (SV2C) ATCAGTTGTTTCTTCCTTTGGTTTGGCACCAGCGAATCCATGATGATAGGCATGCTGTGT A_73_100544 A_73_100544 FALSE XM_583142 XM_583142 LOC506660 ref|XM_583142 unmapped Bos taurus similar to Homo sapiens neurotrophin 5 (neurotrophin 4/5) (NTF5) GATGAACTTGAGGGTAAAAATGATGATGATGATAGCCAATATTTTCTGAGTGCCTACTGT A_73_100545 A_73_100545 FALSE CB434788 CB434788 gb|Bos taurus similar to Homo sapiens leucine rich repeat neuronal 5 (LRRN5), transcript variant 2 unmapped Unknown TGCTCCTGTTTTGTAAAAAATAAAAATAAATAAGAATAACAACAATAAGGGGAGAGGAAG A_73_100546 A_73_100546 FALSE BF600764 BF600764 gb|Bos taurus similar to Homo sapiens SERTA domain containing 3 (SERTAD3), transcript variant 2 unmapped Unknown CGGACCACGTGCAATAGGGTGGAAACCAAACTGCTCCATGCCGCATTATTTAAAAGAAAA A_73_100547 A_73_100547 FALSE BM446241 BM446241 gb|Unidentified transcripts on BTA10 position 41252590-41253139 unmapped Unknown GTGCAGTGACTTGTTCTCTGCTGTGAGAGGTGGTTCCCATTCTTTTCCTGCTGAATATTT A_73_100548 A_73_100548 FALSE NM_173991 NM_173991 APOE ref|NM_173991 unmapped Bos taurus apolipoprotein E (APOE) AGCTGTCCTCCTGGTGGGCCCTAGCTTAATAAAGATTTCTCAAGCTTCATGGCGAAAAAA A_73_100549 A_73_100549 FALSE XM_581228 XM_581228 LOC505009 ref|XM_581228 unmapped PREDICTED: Bos taurus similar to CG30392-PA (LOC505009) GCTGTCTTGAGCCTTCTATATCAGCTAGCTGACCCCAGAACAGGGAGAAAACCCCTGGGC A_73_100550 A_73_100550 FALSE XM_586303 XM_586303 LOC509362 ref|XM_586303 unmapped PREDICTED: Bos taurus similar to C-type lectin domain family 2, member h (LOC509362) GGTCACAGAGTCAGACTCGACTGAGCTACTTCACTTTCACTTTCACTTTCATCCCTAAGA A_73_100551 A_73_100551 FALSE XM_868034 XM_868034 LOC616066 ref|XM_868034 unmapped Bos taurus similar to Homo sapiens death- associated protein (DAP) GGGCTTCTGATCATTGAAAGCAAATTGTTCCCCTGAATGAATTTATCAATGGTTAACTTC A_73_100552 A_73_100552 FALSE XM_610492 XM_610492 LOC531987 ref|XM_610492 unmapped PREDICTED: Bos taurus similar to High affinity immunoglobulin epsilon receptor beta-subunit (FcERI) (IgE Fc receptor, beta-subunit) (Fc epsilon receptor I beta-chain) (LOC531987) GGCAGGGAGGAAAGACATGAGACAGAGAAATGTAATGAGCACTTGTCTTCCGGATCAAAA A_73_100553 A_73_100553 FALSE XM_593541 XM_593541 LOC515509 ref|XM_593541 unmapped Bos taurus similar to Homo sapiens SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) (SUGT1) CATTTATGGAGTCTGGTGGTACAGTTTTGAGTACCAACTGGTCTGATGTAGGTAAAAGAA A_73_100554 A_73_100554 FALSE XM_588271 XM_588271 LOC539595 ref|XM_588271 unmapped PREDICTED: Bos taurus similar to Apolipoprotein F precursor (Apo-F) (Lipid transfer inhibitor protein) (LTIP) (LOC539595) GTCTAGTCTCGGTTCCACCGAGTGGGTTCTGATTCTCGGAAATCAGCTGTTTCAGTCCTG A_73_100555 A_73_100555 FALSE NM_001037611 NM_001037611 G3BP ref|NM_001037611 unmapped Bos taurus similar to Homo sapiens Ras-GTPase- activating protein SH3-domain-binding protein (G3BP), transcript variant 1 TTTTTAATCATAGCCATATGGTAAATTTTCTGTTTTGTTATGGTTCCCTTTCCCTGGTGG A_73_100556 A_73_100556 FALSE NM_001034277 NM_001034277 MGC127028 ref|NM_001034277 unmapped Bos taurus similar to Homo sapiens splicing factor, arginine/serine-rich 7, 35kDa (SFRS7), transcript variant 2 TTAAATAGTTTTGAGATTTGGTTTCAGCAGAGGCACACAGACTCTAAAAGGAGTTGCCAT A_73_100557 A_73_100557 FALSE XM_605828 XM_605828 LOC527437 ref|XM_605828 unmapped PREDICTED: Bos taurus similar to Tubulin tyrosine ligase-like protein 11 (LOC527437) ATACAAGGGAGACCCTCGGTGGACCCCCAGATCTCGGTGGATCTCTCTTTGTGCAGAAGT A_73_100558 A_73_100558 FALSE XM_591948 XM_591948 LOC514145 ref|XM_591948 unmapped Bos taurus similar to Homo sapiens lipase, endothelial (LIPG) CTCCTTTGGCTTGAGCATCGGCATTCAAATGCCCGGGGGTCACATCGACATCTACCCCAA A_73_100559 A_73_100559 FALSE XM_606080 XM_606080 LOC527683 ref|XM_606080 unmapped PREDICTED: Bos taurus similar to Probable ubiquitin carboxyl-terminal hydrolase FAF-X (Ubiquitin thiolesterase FAF-X) (Ubiquitin-specific processing protease FAF-X) (Deubiquitinating enzyme FAF-X) (Fat facets protein related, X-linked)... AGTGAAGCAGACAACATCTTATTGGCAGGACACTTACGGCTCATCAAGACCCTTCTTTCA A_73_100560 A_73_100560 FALSE NM_001015672 NM_001015672 FLJ20152 ref|NM_001015672 unmapped Bos taurus hypothetical protein FLJ20152 (FLJ20152) GTGGGTTTGCGAGGAATATCCCTGACTTCTGTTTCAGCAAGAGTTTCTGGACATGAAGAA A_73_100561 A_73_100561 FALSE XM_617332 XM_617332 LOC537176 ref|XM_617332 unmapped Bos taurus similar to Homo sapiens deleted in colorectal carcinoma (DCC) ATTGGCCAGTTGATACGAATTTGATTGATAGAAGCACTCTGAATGAACCACCCATTGGCA A_73_100562 A_73_100562 FALSE AW654393 AW654393 gb|Bos taurus similar to Homo sapiens polymerase (DNA directed) sigma (POLS) unmapped Unknown TTTTTTGTGCGTGGACAACAATGTGGAAGCTAAAATTGACATATTTTTATGTGAAGTTTT A_73_100563 A_73_100563 FALSE XM_615425 XM_615425 LOC541274 ref|XM_615425 unmapped Bos taurus similar to Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 4 (DNAJB4) AATGATGTTGCTACTACTTGTTATGCATATAAATATTTTACTTTTTCATATGTATAGATT A_73_100564 A_73_100564 FALSE XM_612629 XM_612629 LOC540682 ref|XM_612629 unmapped Bos taurus similar to Homo sapiens phosphorylase kinase, gamma 1 (muscle) (PHKG1) GGGCAAGTTCAAGGTGATCTGCCTGACGGTGCTGGCTTCCGTGCGCATTTACTACCAGTA A_73_100565 A_73_100565 FALSE XM_613388 XM_613388 LOC540841 ref|XM_613388 unmapped Bos taurus similar to Homo sapiens solute carrier family 10 (sodium/bile acid cotransporter family), member 6 (SLC10A6) GGAAGAAATCCACTTCTCCTAAAGAGACCACTGCTTTCTTGGAGGTGAATGAAGAAGCCA A_73_100566 A_73_100566 FALSE BM089836 BM089836 gb|Unidentified transcripts unmapped Unknown AGTCCAAAATGAAAGGCCAGGTTATTTCATGATCCTAAGAGTCTCCTGTGAATTTTTAAG A_73_100567 A_73_100567 FALSE NM_001038097 NM_001038097 WDR61 ref|NM_001038097 unmapped Bos taurus similar to Homo sapiens WD repeat domain 61 (WDR61) TTCACATCTATGATTGTCCCATTTAAACATCAACATTTTCCAGGCTAATGCTACAGAGAG A_73_100568 A_73_100568 FALSE NM_001014895 NM_001014895 ALAD ref|NM_001014895 unmapped Bos taurus delta-aminolevulinic acid dehydratase isoform b (ALAD) CCATTCCTGAGCCTTGGAGAAGTGAAAACCAAAGTAAACGATGCTTTTAGAACGGTGAAA A_73_100569 A_73_100569 FALSE NM_174783 NM_174783 PIK4CB ref|NM_174783 unmapped Bos taurus phosphatidylinositol 4-kinase, catalytic, beta polypeptide (PIK4CB) GCTTTGGCATAGGGTTCTGCACTTGCTGAGGTCCCCCATCCCAGAAGTGAGGAAGGGAAT A_73_100570 A_73_100570 FALSE XM_598414 XM_598414 LOC520178 ref|XM_598414 unmapped Bos taurus similar to Homo sapiens protein tyrosine phosphatase, non-receptor type 21 (PTPN21) TCTGTGTTGCGCGACATAAATTTTACAGACTAAATCAGTGCAGCCTGCAAACTCAGACCG A_73_100571 A_73_100571 FALSE XM_869189 XM_869189 LOC521224 ref|XM_869189 unmapped Bos taurus similar to Homo sapiens RAS p21 protein activator 4 (RASA4) CACCCCCTTTGCTCCCAGCCGCCACCCCCCCTGCTCCTGGGCTGTGCCCCCCGGGAGAGC A_73_100572 A_73_100572 FALSE XM_867213 XM_867213 LOC615411 ref|XM_867213 unmapped Bos taurus similar to Homo sapiens chemokine- like receptor 1 (CMKLR1) CGGAAATCCCCCAGTGGATGCTCCCAACCTTGGAGGAGGCTCAAAGCTACAGCTTCTTGA A_73_100573 A_73_100573 FALSE XM_592691 XM_592691 LOC514786 ref|XM_592691 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 107 (CCDC107) AGACCATCCACCAGCTGTTACAAGACAGCAAACCGAACAAGGGTGTGGAGGTTCCAGAAC A_73_100574 A_73_100574 FALSE XM_868731 XM_868731 LOC616654 ref|XM_868731 unmapped Bos taurus similar to Homo sapiens ankyrin repeat and SOCS box-containing 17 (ASB17) ATGCTCCCAAATGGAATATTTTCACTTCTAATCCCTGTTTGTCTACAGAACTATCTGAAT A_73_100575 A_73_100575 FALSE XM_869882 XM_869882 LOC617594 ref|XM_869882 unmapped Bos taurus similar to Homo sapiens transmembrane protein 149 (TMEM149) TGCTGTCCAAACTTGGCTCATCAGGGGCTTGCCTGGCCTAGTATTCAATAAAGTTTCTAT A_73_100576 A_73_100576 FALSE XM_603142 XM_603142 LOC524808 ref|XM_603142 unmapped PREDICTED: Bos taurus similar to histone 1, H2ad (LOC524808) ATGTCTGGGCGAGGGAAGCAAGGAGGAAAAACCCGAGCAAAAGCGAAGACCCGCTCTTCG A_73_100577 A_73_100577 FALSE XM_609541 XM_609541 LOC531057 ref|XM_609541 unmapped Bos taurus similar to Homo sapiens keratin 72 (KRT72) TGGAGGCAGCGAGCTTAAGGATGCTCCTGCCAAAACCTCAGGCAGTAGCTGTGCAACCAA A_73_100578 A_73_100578 FALSE XM_587746 XM_587746 LOC539503 ref|XM_587746 unmapped Bos taurus similar to Homo sapiens zinc finger protein 342 (ZNF342) GGAGAAGAACCAGAAGATGTCACCCAAGAAGACGCTGAAGCCAGCAGGCAAGAACCGGGG A_73_100579 A_73_100579 FALSE NM_174054 NM_174054 FECH ref|NM_174054 unmapped Bos taurus ferrochelatase (FECH) GAGTTTTAAAAATGTATCTTCTGAAATGCATACACATTCTCAGTACCGATTTGGGTTTGG A_73_100580 A_73_100580 FALSE BM288548 BM288548 gb|Bos taurus similar to Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant alpha unmapped Unknown ATCACCACTGTTTCATCTTTGTTTAATGTTTGGGTACTGATGATATCAATATGGAAGTCG A_73_100581 A_73_100581 FALSE BI899130 BI899130 gb|Bos taurus similar to Homo sapiens cytochrome b5 type B (outer mitochondrial membrane) (CYB5B) unmapped Unknown GTCTGCTGGAATGTGCACACAGTGAGTGTTTGTTTAGAACGACACACAATAAAGATACTG A_73_100582 A_73_100582 FALSE EE911373 EE911373 gb|Unidentified transcripts on BTA13 position 61753929-61753260 unmapped Unknown CTCCTCTTGTTCTCGTGACCACCTTCGGGGTCGGCACCATCATTATCCCCATTTTACAGA A_73_100583 A_73_100583 FALSE XM_598098 XM_598098 LOC519867 ref|XM_598098 unmapped Bos taurus similar to Homo sapiens erythrocyte membrane protein band 4.1 like 4A (EPB41L4A) AAATGCATGGCTGAGGGATCACTTTCACACTGCAGATATTTTTATTCACATTAATGTTCT A_73_100584 A_73_100584 FALSE XM_584164 XM_584164 LOC507534 ref|XM_584164 unmapped Bos taurus similar to Homo sapiens KIAA0513 (KIAA0513) ACAGCAGTGGCTTTTCAGAAGAAAACACTTTTTTCTGGGGTCAAATAGTCGTTCTCCCCA A_73_100585 A_73_100585 FALSE CB435668 CB435668 gb|Bos taurus similar to Homo sapiens v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) (AKT3), transcript variant 1 unmapped Unknown ACACGCGACATTTTTGTTTTTGCATGAAATTGTATCTCAGTCTAAGGTCTCATGCTGTTG A_73_100586 A_73_100586 FALSE NM_001001169 NM_001001169 LOC408001 ref|NM_001001169 unmapped Bos taurus similar to Homo sapiens microtubule-associated protein 1 light chain 3 beta (MAP1LC3B) AAATACCGTGCTGAGAGGGCTGACTTAACTTATATCCCACATTAATGGGTGGTCACTCTA A_73_100587 A_73_100587 FALSE CB419348 CB419348 gb|Unidentified transcripts unmapped Unknown CTGACAACTGGACTTCTACCTCAAGATTTACTTTACAGATCATTTTGAAAACACCAACTG A_73_100588 A_73_100588 FALSE AW670454 AW670454 gb|Unidentified transcripts on BTA24 position 879767-880509 unmapped Unknown ATGAGAAATTATATACTGTAGTATGGAGAACAGTTACCATCTAAAATATGGCCTGGCTTC A_73_100589 A_73_100589 FALSE NM_001035465 NM_001035465 IRF5 ref|NM_001035465 unmapped Bos taurus similar to Homo sapiens interferon regulatory factor 5 (IRF5), transcript variant 2 TCTGGCAGCTACCTCCCTTGAGAAACTAAGAACCTGGGATAGAAAGGGGACATTTATGTA A_73_100590 A_73_100590 FALSE XM_869967 XM_869967 LOC617666 ref|XM_869967 unmapped PREDICTED: Bos taurus similar to FRAS1-related extracellular matrix protein 3 precursor (LOC617666) GGGTAGAACCACAAAAAGATCAATTCACCTTTTATTGCTCTGATGGCATCAACTTCTCCC A_73_100591 A_73_100591 FALSE XM_870980 XM_870980 LOC618651 ref|XM_870980 unmapped PREDICTED: Bos taurus similar to tubulointerstitial nephritis antigen (LOC618651) TGACATTGAAAAGTTGATTATCGCAGCTTGGGGCCAGCTGACAAGTGCAGATGAACCATA A_73_100592 A_73_100592 FALSE NM_001037613 NM_001037613 FBXO39 ref|NM_001037613 unmapped Bos taurus similar to Homo sapiens F-box protein 39 (FBXO39) GTACAGAAAGCTGATCGATTCAGAGCTTAACTATTTTGTCATCGCTTACCCCATGATGTA A_73_100593 A_73_100593 FALSE BM090211 BM090211 gb|Unidentified transcripts on BTA6 position 50549064-50548366 unmapped Unknown TTTGGAGACTGGGTACTGCTCACACATGATGTATAGGGCTAAATACATGCTTGTTTCCTT A_73_100594 A_73_100594 FALSE XM_612199 XM_612199 LOC540583 ref|XM_612199 unmapped Bos taurus similar to Homo sapiens RAB30, member RAS oncogene family (RAB30) ACCATTTTCTTCTTCCATTCTCCCATCTTTCCTGCCTCTCAAGTAAATGAAAAAGTTTGA A_73_100595 A_73_100595 FALSE NM_183082 NM_183082 AIP ref|NM_183082 unmapped Bos taurus aryl hydrocarbon receptor interacting protein (AIP) CTCTCTGGGCTTGCCAAACTGATCCACTGGGAAAGCTGGGGTCATTGCCCCTCATTTCCT A_73_100596 A_73_100596 FALSE XM_603441 XM_603441 LOC525095 ref|XM_603441 unmapped Bos taurus similar to Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class N (PIGN), transcript variant 2 ACATGTGGAATTCTGAATTTACAGGTTATCTGGAATAAAAGAGCTTCCATTTTCTTGAGG A_73_100597 A_73_100597 FALSE NM_001038514 NM_001038514 CALR3 ref|NM_001038514 unmapped Bos taurus similar to Homo sapiens calreticulin 3 (CALR3) AGGTTCAGGGGGCGAGAAAATAGCTTCAAAGGATTCCACAGAAGGAACGAGTTTTAGTCA A_73_100598 A_73_100598 FALSE XM_612717 XM_612717 LOC533339 ref|XM_612717 unmapped Bos taurus similar to Homo sapiens mucin and cadherin-like (MUCDHL), transcript variant 1 CTTCTAACGCCACCTCCCCCCAGAGTCTGGACCCCGAGAGTCGGCTTGGTGGCTGTCCCC A_73_100599 A_73_100599 FALSE XM_613922 XM_613922 LOC534230 ref|XM_613922 unmapped Bos taurus similar to PREDICTED: Homo sapiens microtubule associated serine/threonine kinase 3 (MAST3) TGCCTGGTGTTGGAGCTAGATCAAGGCTGTGCATGACTTTTGCTCCCGCCTTCCATCCTG A_73_100600 A_73_100600 FALSE XM_590746 XM_590746 LOC539995 ref|XM_590746 unmapped Bos taurus similar to Homo sapiens transmembrane protein 74 (TMEM74) ACAAGCACTAACGAAAACACCCTGGAACTGTCGCTGGTGGAGGAAGATGCTCTCGCTGTA A_73_100601 A_73_100601 FALSE XM_598002 XM_598002 LOC519777 ref|XM_598002 unmapped Bos taurus similar to Homo sapiens suppressor of variegation 4-20 homolog 2 (Drosophila) (SUV420H2) CTTCTCCCCACCCAAGCGCCTGCGGCTTGTGGTCAGCCATGGCTCCATTGACTTGGATGT A_73_100602 A_73_100602 FALSE AU232331 AU232331 gb|Unidentified transcripts on BTA3 position 3145347-3144937 unmapped Unknown ATTTTATTTCCATTCACAAGCCGCCCAAAACCATTCTGCTGGACTGTAAACTCCTTGAGA A_73_100603 A_73_100603 FALSE XM_586426 XM_586426 LOC509464 ref|XM_586426 unmapped Bos taurus similar to Homo sapiens cytoplasmic FMR1 interacting protein 1 (CYFIP1), transcript variant 1 CCCTTTTTGTGTCTTTCAAAAAGTAGTGAACTTGATTTCTCTGTTTCTACTAAATCCAGC A_73_100604 A_73_100604 FALSE XM_606422 XM_606422 LOC528014 ref|XM_606422 unmapped PREDICTED: Bos taurus similar to Potassium voltage-gated channel subfamily E member 1 (IKs producing slow voltage-gated potassium channel beta subunit Mink) (Minimal potassium channel) (Delayed rectifier potassium channel subunit IsK) (LOC528014) ATTGTCAGTCATTCCCCAGTATCCGTGACTGCCTTGTTAATTGCAGCAAAATCCCTGCAA A_73_100605 A_73_100605 FALSE XM_866884 XM_866884 LOC615152 ref|XM_866884 unmapped Bos taurus similar to Homo sapiens chromosome 8 open reading frame 34 (C8orf34) CCCACCCCATCTGTAACAGAAGAAGATATTGATAATGAAGATGATGCAATGGAATTGCTG A_73_100606 A_73_100606 FALSE BM088357 BM088357 gb|Unidentified transcripts unmapped Unknown CATGATCTTGAGCAGTCATTCCAAAGATACATATGTGTGCATTTTTCATTCATGTTGGGC A_73_100607 A_73_100607 FALSE XM_867507 XM_867507 LOC615645 ref|XM_867507 unmapped Bos taurus similar to Homo sapiens zinc and ring finger 2 (ZNRF2) TGTATTTGATTTGTTTTGGTTTTTAGTTTGGGGACCTTTACTTTCCCAACATGATGTTCC A_73_100608 A_73_100608 FALSE CB172759 CB172759 gb|Unidentified transcripts on BTA16 position 34605418-34607030 unmapped Unknown GTGGGGCAGGTTTGCATATTTATTTGTCTGTTCGTTAGGCTTCTGTGTCTGGGATCTTGT A_73_100609 A_73_100609 FALSE XM_871229 XM_871229 LOC618914 ref|XM_871229 unmapped PREDICTED: Bos taurus similar to Transcription factor MafK (Erythroid transcription factor NF-E2 p18 subunit) (LOC618914) GGCTGGCCACACCTAATTTATTGCTGTACATCTCTGCTGTGACGCTTTTGTACCTTTCAA A_73_100610 A_73_100610 FALSE NM_001038072 NM_001038072 PCGF4 ref|NM_001038072 unmapped Bos taurus similar to Homo sapiens B lymphoma Mo-MLV insertion region (mouse) (BMI1) AGAGGAATTTTCCCCCAGTCAATGTGAAAATTGCTTGAGCTTTAAAGGCTATTTCAGCTA A_73_100611 A_73_100611 FALSE NM_174162 NM_174162 RAB7 ref|NM_174162 unmapped Bos taurus RAB7, member RAS oncogene family (RAB7) GTTTTCTGCATTCTGTATAGAAACATATCGAACTAAATAAAAGCAGTGTCTTTATTACAT A_73_100612 A_73_100612 FALSE NM_177945 NM_177945 PPARGC1A ref|NM_177945 unmapped Bos taurus peroxisome proliferator activated receptor gamma coactivator 1 alpha (PPARGC1A) CTGGAGGCAAATTTCAGCATAGATCTGTAAGATTTTTAGATGACCCTGGGCCATTGCCTT A_73_100613 A_73_100613 FALSE BI776188 BI776188 gb|Bos taurus similar to Homo sapiens inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IPPK) unmapped Unknown ATTCTATGGTAGGTTGTATAGATTATTTATATCATCATTTTGAGGGACTAATGAAGGCTT A_73_100614 A_73_100614 FALSE NM_001035036 NM_001035036 TMIGD ref|NM_001035036 unmapped Bos taurus similar to Homo sapiens transmembrane and immunoglobulin domain containing 1 (TMIGD1) CAACAGACAAGCAAGTACTTTCAATTGTCGATCACCAAAGTCAAGAAATCCGACAATGGG A_73_100615 A_73_100615 FALSE XM_584581 XM_584581 LOC507890 ref|XM_584581 unmapped PREDICTED: Bos taurus similar to PR-domain zinc finger protein 8 (LOC507890) ACCTCTCCAGGCATATGACCTCGCATAATTGACACGGAAAGGACCTCCGCTTTCCGCTCG A_73_100616 A_73_100616 FALSE XM_866021 XM_866021 LOC530230 ref|XM_866021 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 91 (CCDC91) TGTTTCCTGAAATGCTTCTACTTTCATTGGCTTTGTACTTTTCTGGGATTTCTTGGTGTA A_73_100617 A_73_100617 FALSE NM_001031764 NM_001031764 RHEB ref|NM_001031764 unmapped Bos taurus similar to Homo sapiens Ras homolog enriched in brain (RHEB) CCCTCCTTTCAGATTATGTTCAACTCTGACTCTGTCCAAATGAGTTCACTTCCATTTTCA A_73_100618 A_73_100618 FALSE XM_592596 XM_592596 LOC514702 ref|XM_592596 unmapped PREDICTED: Bos taurus similar to Olfactory receptor 2AE1 (LOC514702) TCCTTTTGATCTCTTTTCAAATGGAATCTTGCCCAAACATGCCCCCCTGATGAGCCTATT A_73_100619 A_73_100619 FALSE XM_608366 XM_608366 LOC529904 ref|XM_608366 unmapped Bos taurus similar to Homo sapiens glutamate receptor, ionotrophic, AMPA 4 (GRIA4) ACTGCCCTAAGGCTGTACACACTGGAACTACAATTAGACAAAGTTCAGGATTGGCTGTCA A_73_100620 A_73_100620 FALSE XM_615064 XM_615064 LOC541211 ref|XM_615064 unmapped PREDICTED: Bos taurus similar to DIX domain containing 1 (LOC541211) ACTGTCAAGGAAGAGGTTTTCCACGATGATGATGCCATTCCTGGATGGGAAGGGAAAATT A_73_100621 A_73_100621 FALSE XM_589483 XM_589483 LOC512045 ref|XM_589483 unmapped Bos taurus similar to Homo sapiens complement component 5 (C5) TTTTTTCCCCAACATTCACAGCTGGTCTTATTTGGAAAGTTCATTCTACTTAGAATGGGG A_73_100622 A_73_100622 FALSE NM_001024511 NM_001024511 TADA3L ref|NM_001024511 unmapped Bos taurus transcriptional adaptor 3-like isoform b (TADA3L) TCCACCCCTCACCCTCAAGGACTTCTCCATTGTGGTTTTGTAAAGTGCAGACTTAAGAAT A_73_100623 A_73_100623 FALSE XM_587248 XM_587248 LOC510141 ref|XM_587248 unmapped Bos taurus similar to Homo sapiens calcium and integrin binding 1 (calmyrin) (CIB1) ACGTCAGGGCCTTTCCCCTTCTCACTGTCATCGCTCTATTTGTGTTTCTACTAATCAATA A_73_100624 A_73_100624 FALSE XM_584034 XM_584034 LOC507436 ref|XM_584034 unmapped Bos taurus similar to Homo sapiens G0/G1switch 2 (G0S2) CGTCCAAAGCTAGGTACCTTCGAGCCACCTGAGTGCATCTGGCATTTTGCACGAGGGTGA A_73_100625 A_73_100625 FALSE XM_592949 XM_592949 LOC540288 ref|XM_592949 unmapped Bos taurus similar to Homo sapiens Sp6 transcription factor (SP6) TGCGCAGCGACCACCTGGCCAAACACATGAAAACCCACGAGGGCACCAAAGAGGAGGCAG A_73_100626 A_73_100626 FALSE XM_605932 XM_605932 LOC527539 ref|XM_605932 unmapped Bos taurus similar to Homo sapiens leucine rich repeat containing 48 (LRRC48) TGGAGTGTGGGGACCTCCTAGACTAGGGCTGCCCTCCCCCACTACAGGTAGAGAAATAAA A_73_100627 A_73_100627 FALSE XM_612459 XM_612459 LOC533149 ref|XM_612459 unmapped Bos taurus similar to Homo sapiens EH domain binding protein 1 (EHBP1) TCTAGCTTGGTTCCCACATTTTGTTGGGTCTCAAAATTGGCTCAAGAATGCTGTTATTAT A_73_100628 A_73_100628 FALSE XM_867500 XM_867500 LOC511624 ref|XM_867500 unmapped Bos taurus similar to Homo sapiens coenzyme Q6 homolog, monooxygenase (S. cerevisiae) (COQ6), transcript variant 1 TGAAGCCCAAATAATGAGTGATAATTTATGGTGAGGAGGGCATATCAACCAAGCCAAGGG A_73_100629 A_73_100629 FALSE NM_001038081 NM_001038081 MGC134547 ref|NM_001038081 unmapped Bos taurus similar to Homo sapiens peptidylprolyl isomerase (cyclophilin)-like 2 (PPIL2), transcript variant 1 CATTTGTCCTTGAAGCCACTCACGGTCAGTTTGTTTGGTTTTGAAAGGAGCTCGGGTTTT A_73_100630 A_73_100630 FALSE BI534683 BI534683 gb|Bos taurus similar to Homo sapiens KIAA0256 gene product (KIAA0256) unmapped Unknown ATCACATTTTAGAGGGTAATAACAGCTTTTTTGCACTATGTAAATACTAGTGGAGATTCT A_73_100631 A_73_100631 FALSE XM_868718 XM_868718 LOC616643 ref|XM_868718 unmapped Bos taurus similar to Homo sapiens steroid 5 alpha-reductase 2-like 2 (SRD5A2L2) GAGTATCCAGATGTCTCTGTGGGCAAAAAAGAAACATAAGATTTATCTGAAGAAATTCAG A_73_100632 A_73_100632 FALSE XM_592284 XM_592284 LOC540205 ref|XM_592284 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 12, subfamily D, member 3 (OR12D3) TATACACTCTTAGGAATAAAGAAGTGAGGCTGGCGCTGAAGGAAATCTTCAGGAGCAAGT A_73_100633 A_73_100633 FALSE XM_866481 XM_866481 LOC509326 ref|XM_866481 unmapped Bos taurus similar to Homo sapiens thromboxane A synthase 1 (platelet, cytochrome P450, family 5, subfamily A) (TBXAS1), transcript variant TXS-II AGGAAATCCTTGTGTGGAAATGTGGATTTTTGTTAAAACACCACCGAAGCAGTTGAAAGC A_73_100634 A_73_100634 FALSE XM_588754 XM_588754 LOC511421 ref|XM_588754 unmapped Bos taurus similar to Homo sapiens cartilage acidic protein 1 (CRTAC1) GTTTGAACTTGCTAAGTCTTCCAGTCTCTTTCTGAACAAATTATACCAATAAACTCTCTG A_73_100635 A_73_100635 FALSE XM_611961 XM_611961 LOC532785 ref|XM_611961 unmapped Bos taurus similar to Homo sapiens L-3 -hydroxyacyl-Coenzyme A dehydrogenase, short chain (HADHSC), nuclear gene encoding mitochondrial protein TTTATGTACAGCCTGCCTGTAGCTGTCACTCCGGATTTCTTACCAGGAAAGCCAGTAATA A_73_100636 A_73_100636 FALSE XM_591907 XM_591907 LOC514108 ref|XM_591907 unmapped Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 4E nuclear import factor 1 (EIF4ENIF1) CAGGAAGCCAACTGTTGACTTTTGCCCCAGTAAACGTGACAAAGGACCATATACCTGATT A_73_100637 A_73_100637 FALSE BP108821 BP108821 gb|Unidentified transcripts on BTA10 position 33053778-33054516 unmapped Unknown GACTTAAGTCCTCCTCTCTGGGTTCTTCAATTATGTTCAGTAATAGGGGAGAGGCTGGAT A_73_100638 A_73_100638 FALSE CB417742 CB417742 gb|Bos taurus similar to Homo sapiens WD repeat domain 5B (WDR5B) unmapped Unknown AACTTAACTAAAGAGGACAGCTGACACAAAATGATGATATAAATTCTTGCTGCATGGTAG A_73_100639 A_73_100639 FALSE XM_600528 XM_600528 LOC522252 ref|XM_600528 unmapped PREDICTED: Bos taurus similar to CD109 (LOC522252) TAAGCCTTATAAAACCTTTTTAAACATTCTAATTAAGGTGGATGGTTTTGTGGGCACAGC A_73_100640 A_73_100640 FALSE XM_605364 XM_605364 LOC526979 ref|XM_605364 unmapped PREDICTED: Bos taurus similar to UDP glycosyltransferase 2 family, polypeptide B17 (LOC526979) AATAGCAGCAGCAGCAGCAGGCATAGTAACTTAATGAGCCATCCCAAAACCAGAGCTTTT A_73_100641 A_73_100641 FALSE XM_616021 XM_616021 LOC535907 ref|XM_616021 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, subfamily H (eag-related), member 4 (KCNH4) CCCCGGGACCTCACCTTCAACCTGCGTCACGGCTCTGAGACCAACGTATGTAGACCCCTA A_73_100642 A_73_100642 FALSE XM_597628 XM_597628 LOC519409 ref|XM_597628 unmapped Bos taurus similar to Homo sapiens origin recognition complex, subunit 5-like (yeast) (ORC5L), transcript variant 1 GTCACTCTGGCAATAAACTACTCAACATAGCTTTTTAATCTGCATAATGGTTTTCTTTCC A_73_100643 A_73_100643 FALSE XM_585447 XM_585447 LOC508641 ref|XM_585447 unmapped Bos taurus similar to Homo sapiens RAN binding protein 3 (RANBP3), transcript variant RANBP3-d TCTCTGTAAAGGGTCGCTTACGGTCTCTGTTGCACTTTTTTAAACATAAAACAGCTTTGA A_73_100644 A_73_100644 FALSE NM_001038063 NM_001038063 TMCC3 ref|NM_001038063 unmapped Bos taurus similar to Homo sapiens transmembrane and coiled-coil domain family 3 (TMCC3) CCCTCTCAGGATGTGTTTCGTTTTCTGTGATTCATTTTATTCAGTCTGTGAGGGCTGGCA A_73_100645 A_73_100645 FALSE NM_001035064 NM_001035064 MGC128969 ref|NM_001035064 unmapped Bos taurus similar to Homo sapiens syntaxin 4 (STX4) GTCACAGTGCCTGGGGGCAGGCCTGCAGTGTCCTGTTTGGCAGAGACATGTAGTTTTGTA A_73_100646 A_73_100646 FALSE XM_603761 XM_603761 LOC525408 ref|XM_603761 unmapped Bos taurus similar to Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1 CTCCCACCCCAGCGTCAAAACCGCTCCCTGACGACCCCATCTGACTTAACTGTTAATAGT A_73_100647 A_73_100647 FALSE CB166997 CB166997 gb|Unidentified transcripts on BTA10 position 36894356-36893683 unmapped Unknown TGCTTAATCCTCAAGACCTACACACAATTAGAATCAGCATTTCATGTGGTCTTTGAAAAT A_73_100648 A_73_100648 FALSE NM_174567 NM_174567 OPN1SW ref|NM_174567 unmapped Bos taurus opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan) (OPN1SW) AGCTGTCTAGCTCCCAGAAAACCGAAGTGTCTACTGTCTCTTCTAGCCAAGTTGGCCCCA A_73_100649 A_73_100649 FALSE XM_591847 XM_591847 LOC514057 ref|XM_591847 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 8, subfamily K, member 3 (OR8K3) TCCAGTCATTCCTTTGACACTGATAAAGTGGCATCTATATTTTACACCCTTGTTATTCCT A_73_100650 A_73_100650 FALSE XM_586374 XM_586374 LOC539308 ref|XM_586374 unmapped Bos taurus similar to Homo sapiens smoothened homolog (Drosophila) (SMO) AAGGCCACACTGCTCATCTGGAGGCGCACCTGGTGCAGGTTGACGGGGCAGAGTGATGAT A_73_100651 A_73_100651 FALSE NM_177946 NM_177946 PC ref|NM_177946 unmapped Bos taurus pyruvate carboxylase (PC) GGTCGACAGTCGCTCACGTATTCATCTCCTGCCAAATAAAGGTCCCCTCCTTGCTGGAGA A_73_100652 A_73_100652 FALSE EE909903 EE909903 gb|Unidentified transcripts on BTA14 position 41245597-41246305 unmapped Unknown CTGTATTTATAGTTTATAGATTCCCCCTCTCCCATTTACAAAACTATTAAGTTACATTTG A_73_100653 A_73_100653 FALSE EE985392 EE985392 gb|Unidentified transcripts on BTA11 position 1983267-1983773 unmapped Unknown AGGAAAGGCTGAGTTGGTTTTCTGAGAGATTTTGTAGGTGAAAGAGCCTCAGTCTCAGCA A_73_100654 A_73_100654 FALSE XM_592255 XM_592255 LOC514409 ref|XM_592255 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, subfamily H (eag-related), member 3 (KCNH3) GCCCAGGAGGGGTTCTGCTATCCCCTGCATGTGCCCCTGCCTCACCTGTCACCATGTTTT A_73_100655 A_73_100655 FALSE XM_587002 XM_587002 HTR1D ref|XM_587002 unmapped Bos taurus similar to Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1D (HTR1D) ACTATGTTTAACGAAGAGTTTCGGCAAGCGTTTCAGAAAGTTGTCCGTTTCAGGAAAACC A_73_100656 A_73_100656 FALSE NM_174807 NM_174807 CRYBB2 ref|NM_174807 unmapped Bos taurus crystallin, beta B2 (CRYBB2) GCTGGCCTCTGCCCAGCATCCCACCAGACATCCTGGAGAGTGAATAAAGTGTGACTTGCA A_73_100657 A_73_100657 FALSE CB457235 CB457235 gb|Unidentified transcripts on BTA21 position 8039059-8039718 unmapped Unknown CACTACCTGCGTCATCAAGAATTATTCAACTACTTTTATTTTATTTTCAGGCTATGCAGC A_73_100658 A_73_100658 FALSE NM_001037615 NM_001037615 TUBG2 ref|NM_001037615 unmapped Bos taurus similar to Homo sapiens tubulin, gamma 2 (TUBG2) AGCCCAAGAGTGGGCCTTGCTTCTTCCTTTTGATGCCTTCACCCTTGATATGCTTATTTA A_73_100659 A_73_100659 FALSE XM_614878 XM_614878 LOC534934 ref|XM_614878 unmapped Bos taurus similar to Homo sapiens breast carcinoma amplified sequence 3 (BCAS3) GATCCTGTACTGTTCAGTGAAGGAAACCGTGGTTTCTGAGGCCCTGTCAAAAAGTGCACG A_73_100660 A_73_100660 FALSE XM_598571 XM_598571 LOC520332 ref|XM_598571 unmapped Bos taurus similar to Homo sapiens S1 RNA binding domain 1 (SRBD1) AAATCAGGCCCTTTGGATTCGACTTGTTATTTTTCTCTTGCCTAGCAAACCAAAATATAC A_73_100661 A_73_100661 FALSE XM_870726 XM_870726 LOC618395 ref|XM_870726 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily G, member 6 (OR2G6) CTATACTCTGAGAAACAAAGATGTGAAAGGGGCCATGAGGACACTGTCCAAGATTCTATG A_73_100662 A_73_100662 FALSE NM_001025082 NM_001025082 LPXN ref|NM_001025082 unmapped Bos taurus similar to Homo sapiens leupaxin (LPXN) TTCCCGGTGTAACCTCAGCTGAGCCCACACGCGCCCTCTTCCGATCTGCTGGAAAATTTA A_73_100663 A_73_100663 FALSE XM_588484 XM_588484 LOC511199 ref|XM_588484 unmapped Bos taurus similar to Homo sapiens low density lipoprotein receptor adaptor protein 1 (LDLRAP1) CAACAGCAGTCAGTGTGCTCCCTGTGTGTCTTACTTGGTGTTGCTGTAAAGGAATTCTAA A_73_100664 A_73_100664 FALSE NM_001038206 NM_001038206 MGC134367 ref|NM_001038206 unmapped Bos taurus similar to Homo sapiens chromosome 13 open reading frame 1 (C13orf1) TAAGTGGTGGTTGACTGGTGACCGTGTACACAGCAGACGTTTAGAATAGTATGATGCCTT A_73_100665 A_73_100665 FALSE XM_868515 XM_868515 LOC616484 ref|XM_868515 unmapped PREDICTED: Bos taurus similar to tetratricopeptide repeat domain 7B (LOC616484) TCTGTTTCCTTACATAGACAGCTAGGTCGCCTCTCCTCTACCCAGGGACAAGTAGGGGTG A_73_100666 A_73_100666 FALSE XM_586611 XM_586611 LOC509610 ref|XM_586611 unmapped Bos taurus similar to Homo sapiens N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits (GNPTAB) TGAAGACCAGATTCCATGGGTCCTTTTTGAACTCTTGACAGGTATTTTAGATCATGATCT A_73_100667 A_73_100667 FALSE XM_582199 XM_582199 LOC505842 ref|XM_582199 unmapped Bos taurus similar to Homo sapiens acetoacetyl-CoA synthetase (AACS) CTTTCTTGAACCCTTTTTCTCTTGTGGATTATAAAAACAGGGCAGATTGCTACGAGGCAT A_73_100668 A_73_100668 FALSE NM_001035096 NM_001035096 FBXL2 ref|NM_001035096 unmapped Bos taurus similar to Homo sapiens F-box and leucine-rich repeat protein 20 (FBXL20) CAACGCACCACAATCTTAGGTCATCTTCTACATGATCCAGGCTGTGAAAAGGCTTGTTTT A_73_100669 A_73_100669 FALSE XM_869937 XM_869937 LOC617639 ref|XM_869937 unmapped Bos taurus similar to Homo sapiens formin binding protein 4 (FNBP4) TAGCTCAGTCATTGCACATACTAGGTGACATATATAAATCCAGTATAGGGCAGCAGCAGC A_73_100670 A_73_100670 FALSE XM_584916 XM_584916 LOC539114 ref|XM_584916 unmapped Bos taurus similar to Homo sapiens cerebellin 4 precursor (CBLN4) CCTGTCTGCAAGGTTTATTCTGAATTTAATTTCCTGAAATCACTGAATTTGTTGCAGATG A_73_100671 A_73_100671 FALSE XM_580885 XM_580885 LOC538521 ref|XM_580885 unmapped Bos taurus similar to Homo sapiens transglutaminase 7 (TGM7) CAACGAGATCAAAGAGATCAAGGGATACAAGGACATCTTTGTTGCTGCAGCCAGGGCTCC A_73_100672 A_73_100672 FALSE BM252047 BM252047 gb|Unidentified transcripts unmapped Unknown ACCGGGAGGGACTGTGCTGTGCCGTTCTGTCTTTGTAACATAAATACAGATTTTTATACC A_73_100673 A_73_100673 FALSE XM_588138 XM_588138 LOC510912 ref|XM_588138 unmapped PREDICTED: Bos taurus similar to Neuralized- like protein 1 (m-neuralized 1) (m-neu1) (LOC510912) GGACACATGTGTCTGTGCCACGGCTGTGGCCTGCGGCTCAAGAGGCAGGCCCGGGCCTGC A_73_100674 A_73_100674 FALSE BM445641 BM445641 gb|Unidentified transcripts on BTA6 position 41994725-41994185 unmapped Unknown CCCAAATATGCCTTATACTTCAGTTTACATTTCTGCACCCATCCCAAACATACATATTAA A_73_100675 A_73_100675 FALSE XM_866326 XM_866326 LOC533525 ref|XM_866326 unmapped PREDICTED: Bos taurus similar to Trophinin (MAGE-D3 antigen) (LOC533525) GCTTTGGAGGCACACTCAGTACCACTTCTGGTTTCAGTGATGCACTCATTACGAGCACCA A_73_100676 A_73_100676 FALSE XM_589002 XM_589002 LOC511627 ref|XM_589002 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 82 (CCDC82) ACAGTGCCTTTATATCAAAGTTGTGAGAATGCTGATGCTGACTTTTCATGTGAAGAGTGC A_73_100677 A_73_100677 FALSE NM_001034319 NM_001034319 MGC128200 ref|NM_001034319 unmapped Bos taurus similar to Homo sapiens acetyl- Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase) (ACAA1), nuclear gene encoding mitochondrial protein AGTGCCACACCACAGGAGGGATAGCAAGTCAAGACACCCGAGCTGCTGTGAGCACACAAA A_73_100678 A_73_100678 FALSE NM_174517 NM_174517 CHRNB4 ref|NM_174517 unmapped Bos taurus cholinergic receptor, nicotinic, beta polypeptide 4 (CHRNB4) GCCCAGCACATGAAGAGTGATGATCTGGACCAGAGTGTCATCGAGGACTGGAAGTACGTG A_73_100679 A_73_100679 FALSE XM_583430 XM_583430 LOC506913 ref|XM_583430 unmapped Bos taurus similar to Homo sapiens trinucleotide repeat containing 15 (TNRC15) AAGAGGGACAGTTAAGATGTTTACAGAACTTTAAGCTCCCTCGGAACTTTTGCCAGTGTG A_73_100680 A_73_100680 FALSE XM_613331 XM_613331 LOC540826 ref|XM_613331 unmapped Bos taurus similar to Homo sapiens SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) GGTACAAGTCACATTTCATTTTGAATACATGATTTTGAACAGCTCCTGTACTTGCTCTTT A_73_100681 A_73_100681 FALSE XM_880337 XM_880337 LOC527819 ref|XM_880337 unmapped Bos taurus similar to Homo sapiens keratin 4 (KRT4) AGCGACACATTCCGTGGGTCTCTCCATGGCAACAACCGCAATCTGGACCTGGACAAGCAT A_73_100682 A_73_100682 FALSE XM_590768 XM_590768 LOC539997 ref|XM_590768 unmapped Bos taurus similar to PREDICTED: Homo sapiens macrophage expressed gene 1, transcript variant 1 (MPEG1) CAGGATGAGAAGCAGAGTTTGGCTGCAGGCGCTGCTGTGAATGGAGATGCCCTTGACCAA A_73_100683 A_73_100683 FALSE XM_877874 XM_877874 LOC613998 ref|XM_877874 unmapped Bos taurus similar to Homo sapiens ATX1 antioxidant protein 1 homolog (yeast) (ATOX1) GGCAATCCTGCTCAGCAATGGTAGTTCCTGCGGAGACCCTCATTTGTCCTGCTCCTCTGT A_73_100684 A_73_100684 FALSE XM_868793 XM_868793 LOC616699 ref|XM_868793 unmapped Bos taurus similar to Homo sapiens LIM homeobox 1 (LHX1) AGTCGCGCACGGCCCGCGGAGCTCGCGGTTGTACAGAAATGAACCTTCTATTTAAGGGAA A_73_100685 A_73_100685 FALSE NM_175815 NM_175815 NDUFA2 ref|NM_175815 unmapped Bos taurus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa (NDUFA2) GATTCGCATCCCACCAACTACCCATTATTGTGCAACCATCTGAGGGAAAGCAGTTGAATA A_73_100686 A_73_100686 FALSE XM_612937 XM_612937 LOC533508 ref|XM_612937 unmapped Bos taurus similar to Homo sapiens outer dense fiber of sperm tails 2-like (ODF2L), transcript variant 1 AGTGATTTTTCCTACCCCTTCCCATGGCCAACTCACATGGGATGATCAAAATAAACACTT A_73_100687 A_73_100687 FALSE CB424565 CB424565 gb|Unidentified transcripts on BTA19 position 27946702-27944745 unmapped Unknown GAAGCTGCTTATTGCTTAGAAATGATGTCACATTTTCCACTTTGACTATTTTCAGTGGCA A_73_100688 A_73_100688 FALSE XM_604148 XM_604148 LOC525792 ref|XM_604148 unmapped PREDICTED: Bos taurus similar to GTPase activating Rap/RanGAP domain-like 3 (LOC525792) AACAAGAGAAGGTTTCTCTGAGGCAGCGACACCTCATGATTCCTGAACATGGCAATGTAA A_73_100689 A_73_100689 FALSE BM031053 BM031053 gb|Bos taurus similar to Homo sapiens vacuolar protein sorting 13 homolog A (S. cerevisiae) (VPS13A), transcript variant A unmapped Unknown AGTCCCTCTCAAAACTTCAAAGCCTTAGAAATACTTCCTCAAGCCAGCATCTTGAGATCT A_73_100690 A_73_100690 FALSE XM_870541 XM_870541 LOC618214 ref|XM_870541 unmapped Bos taurus similar to Homo sapiens homeo box B3 (HOXB3) AGACAAGATGGCTAGGCCATCACCAGCCAACCAACCAACTTACCTTTCATGTGGTTAATT A_73_100691 A_73_100691 FALSE XM_591299 XM_591299 LOC540063 ref|XM_591299 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 44, member B (FAM44B) TCTGTCCAGGGCTTCTTCCTGTCCTGCAAGGGCTAGTGAGTTGGGTGTATTTATTTTATT A_73_100692 A_73_100692 FALSE XM_585911 XM_585911 LOC509032 ref|XM_585911 unmapped Bos taurus similar to Homo sapiens ankyrin repeat and MYND domain containing 2 (ANKMY2) GGAGACTTTCAGGAAAAGAAAAATTTTATAGCCACAGAGATGGGTAGTTAGAATCATAAC A_73_100693 A_73_100693 FALSE BM362463 BM362463 gb|Bos taurus similar to Homo sapiens ataxin 7 (ATXN7) unmapped Unknown GTGGACACTTTGGACGACAAGTTACACCTCCACTCAGCACTCTGGATTCCACGACACCTT A_73_100694 A_73_100694 FALSE XM_605061 XM_605061 LOC526688 ref|XM_605061 unmapped Bos taurus similar to Homo sapiens acyl-CoA synthetase bubblegum family member 2 (ACSBG2) TGGCGGAGAGCTAGGTCCGACGACAAAGATTAAACGACATTTCATCCTCCAGAAATACAA A_73_100695 A_73_100695 FALSE XM_877090 XM_877090 LOC527471 ref|XM_877090 unmapped Bos taurus similar to Homo sapiens heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRPD), transcript variant 3 GTCCGTCCAGATACACCTGAAGAGAAAATAAGGGAGTACTTTGGTGGTTTTGGTGAGGTT A_73_100696 A_73_100696 FALSE XM_870879 XM_870879 LOC618550 ref|XM_870879 unmapped Bos taurus similar to Homo sapiens heme binding protein 1 (HEBP1) ATCCACGAAGAAGTGTGATTTACGCGTGATCTTTCATATGTAATTTTTAGAAGAGCTTTC A_73_100697 A_73_100697 FALSE BM432301 BM432301 gb|Unidentified transcripts on BTA24 position 35370085-35368563 unmapped Unknown TGTGGGTTTAAATATTACAGTTGAGAACTGTATTCAGTGATTGTTTCCGCACACTTTTCA A_73_100698 A_73_100698 FALSE XM_608625 XM_608625 LOC530160 ref|XM_608625 unmapped PREDICTED: Bos taurus similar to Copine-3 (Copine III) (LOC530160) ATCAGCCCCAATGGTGTTAATGAGTATTTGACTGCAATCTGGTCTGTGGGACTGGTCATT A_73_100699 A_73_100699 FALSE NM_183365 NM_183365 NCR1 ref|NM_183365 unmapped Bos taurus natural cytotoxicity triggering receptor 1 (NCR1) TTCACAGGAGAAAGTCTCAAGAGAGAGCCCATAGGGCTTCACGTCGGGGGTGCAGGAGAA A_73_100700 A_73_100700 FALSE XM_608624 XM_608624 LOC530159 ref|XM_608624 unmapped PREDICTED: Bos taurus similar to CDK5 regulatory subunit associated protein 1-like 1 (LOC530159) CCAAACTCGGGGTCAAAAAGCCTTCTTCAAAAAAGCATTTGTCCTGGTGTTACAAACGTT A_73_100701 A_73_100701 FALSE CB466167 CB466167 gb|Unidentified transcripts unmapped Unknown TGGGTGATTTATGTTTACCAATCTACAAAATGATGATATAAAGGAGAATTCATGGTCGCC A_73_100702 A_73_100702 FALSE XM_586763 XM_586763 LOC539379 ref|XM_586763 unmapped Bos taurus similar to Homo sapiens actin- binding Rho activating protein (ABRA) GACCCACTCTTGTCTTAATGCTAAATGCTAACGTAGTGAGAAAGTAAAATGCAAACTGCT A_73_100703 A_73_100703 FALSE XM_864320 XM_864320 LOC534586 ref|XM_864320 unmapped Bos taurus similar to Homo sapiens transformer-2 alpha (TRA2A) TCAAGTTTGTCTGGGGTGGCATGGAACAGTCAAATAGTCGACGTGTAGAAAGTTTGAAGC A_73_100704 A_73_100704 FALSE XM_867863 XM_867863 LOC615922 ref|XM_867863 unmapped Bos taurus similar to Homo sapiens hypothetical protein DKFZp434G156 (NAG6) TGAGGAGACTTTATACCTTACTATTAGAACCATAATCACATCCTGTCATTCATGAAGAAC A_73_100705 A_73_100705 FALSE XM_591153 XM_591153 LOC513469 ref|XM_591153 unmapped Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family B (evectins) member 2 (PLEKHB2), transcript variant 2 TCGTGGCGGCACTGGCTCATTCGAGGGGTTTCCTTATAAAACTCTCGCAATACTTTATTT A_73_100706 A_73_100706 FALSE XM_618238 XM_618238 LOC538046 ref|XM_618238 unmapped Bos taurus similar to Homo sapiens zinc finger protein 452 (ZNF452) AGCATTGTCATCAATCCAACCTAGATTAGACAAATTAACGAGCAAGAAGCAAGCTCACTT A_73_100707 A_73_100707 FALSE CB463375 CB463375 gb|Unidentified transcripts on BTAX position 34435587-34436555 unmapped Unknown AGTACTGTACCTAGACATTAAATACAGTTGGTCAGAAATTAAAACTTATCTCTGTGTGGG A_73_100708 A_73_100708 FALSE NM_001034270 NM_001034270 TSPAN1 ref|NM_001034270 unmapped Bos taurus similar to Homo sapiens tetraspanin 1 (TSPAN1) GTAAGATAGAACGGTACCTTTCCCCCATACTGTTGCTATGACAGTGTCAATAACTCGTTC A_73_100709 A_73_100709 FALSE XM_580371 XM_580371 LOC504277 ref|XM_580371 unmapped PREDICTED: Bos taurus similar to SORCS receptor 1 isoform b (LOC504277), partial mRNA. TGAACTCAGGCGGCCTGGCCAGCTGATAGATGAGAAGGTGGAGTCCCAGCTCATAGGTAA A_73_100710 A_73_100710 FALSE XM_588111 XM_588111 LOC539570 ref|XM_588111 unmapped PREDICTED: Bos taurus similar to SNF1-like kinase 2, transcript variant 1 (LOC539570) AGACTTCCGGTTTGGGGCAGTTGGTCTGTAGGGAACCTCGTGTCTCTTTTAAAAATGTAA A_73_100711 A_73_100711 FALSE XM_581149 XM_581149 LOC504951 ref|XM_581149 unmapped Bos taurus similar to Homo sapiens UDP-N -acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9) AGGGTCAGCAAATGATAACCCATGGCCCTTTGCCTATTTTTATAAATAAAGTTTTATTGG A_73_100712 A_73_100712 FALSE NM_174199 NM_174199 TNP1 ref|NM_174199 unmapped Bos taurus transition protein 1 (during histone to protamine replacement) (TNP1) ATGTGGATAAAATGCCAATCATGACAAAATGAGGCATGTATATGTTGGCTGTTTCTCCCT A_73_100713 A_73_100713 FALSE XM_601740 XM_601740 LOC523441 ref|XM_601740 unmapped PREDICTED: Bos taurus similar to CLIP- associating protein 1 (LOC523441) CTGAACGCAGGATGCAGAACCTTCAAGAAACAGCTCTTCATTAAAAGAGGACCCAGAAGA A_73_100714 A_73_100714 FALSE XM_617134 XM_617134 LOC536981 ref|XM_617134 unmapped Bos taurus similar to Homo sapiens nucleolar protein 4 (NOL4) AAATAGTTCAAGGTCCAGCTGAAATATTAGTGGAATTTGCTACTGACTTACTGGACTGAA A_73_100715 A_73_100715 FALSE XM_614499 XM_614499 LOC534657 ref|XM_614499 unmapped Bos taurus similar to Homo sapiens suppression of tumorigenicity 7 like (ST7L), transcript variant 4 AACACAAGCTCCTAGCAGTGTCTGAGAATAAGTAATTATCCATTTGAAAGTTGAAGCTTC A_73_100716 A_73_100716 FALSE NM_176649 NM_176649 ATP5G1 ref|NM_176649 unmapped Bos taurus ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 5), isoform 1 (ATP5G1) AGGCCATGCCCGGTGCTGGAGTGTGCTAACCTTTACCATTAAACACAATGTTTCTCTAAA A_73_100717 A_73_100717 FALSE XM_601446 XM_601446 LOC523151 ref|XM_601446 unmapped Bos taurus similar to Homo sapiens transcription factor 20 (AR1) (TCF20), transcript variant 2 GGCAAGTGGGCCAGTTACCGGAACATGGGCGACCTCTTTGGACCCTTTTACCCCCAAAAA A_73_100718 A_73_100718 FALSE NM_001003907 NM_001003907 ApoN ref|NM_001003907 unmapped Bos taurus ovarian and testicular apolipoprotein N (ApoN) TCCTTCTTTTAAATAAGTCCTAGTCTCTATTTTTCCCCAATTCTCTTTGCAGGTCTGGGG A_73_100719 A_73_100719 FALSE XM_606439 XM_606439 LOC528030 ref|XM_606439 unmapped Bos taurus similar to Homo sapiens sialidase 4 (NEU4) GCTAGGGGGAGTGCACCCCGGCCCTGGAGACAAGCCTGGAGACAAGCCTGCGGGGCGCTG A_73_100720 A_73_100720 FALSE XM_869600 XM_869600 LOC617355 ref|XM_869600 unmapped PREDICTED: Bos taurus similar to Cathepsin G precursor (CG) (LOC617355) ATCCAAACAACAATGAGACAGTACAAATGTGCCCAGGGGGCAACAGAAGAGAATCCAGAT A_73_100721 A_73_100721 FALSE XM_594818 XM_594818 LOC516661 ref|XM_594818 unmapped Bos taurus similar to Homo sapiens leucine- rich repeat LGI family, member 3 (LGI3) TGGACAGCCAGCTGTATGTGGTGGTGGCCCAGCTGTTTGGGGGCTCTTACATTTACCACT A_73_100722 A_73_100722 FALSE XM_877224 XM_877224 LOC506020 ref|XM_877224 unmapped Bos taurus similar to Homo sapiens SEH1-like (S. cerevisiae) (SEH1L), transcript variant 2 ATGGTTTGTCATACTGGTTAATGTGAAAGCATATCATAAAGTTCATCTTGCCTTTGAGAC A_73_100723 A_73_100723 FALSE XM_587828 XM_587828 LOC510660 ref|XM_587828 unmapped Bos taurus similar to PREDICTED: Homo sapiens KIAA0841, transcript variant 1 (KIAA0841) GCTACACAGGTGTACGGATTTGTCAGAACTAATCTCGCTGTACTCGTTAGGTCTGTGTAT A_73_100724 A_73_100724 FALSE XM_878816 XM_878816 AP2B1 ref|XM_878816 unmapped Bos taurus similar to Homo sapiens adaptor-related protein complex 2, beta 1 subunit (AP2B1), transcript variant 2 CTAAAAAGGAAAAAGATAAAAGACAAACAGGACGTTACCGCCTGAGGACTGTTGACTGTT A_73_100725 A_73_100725 FALSE XM_591424 XM_591424 LOC540091 ref|XM_591424 unmapped Bos taurus similar to Homo sapiens plexin A4, B (PLXNA4B) ATCCTTAAGCAAATCAACGACCGCATTAAAGAGCGGCTGCAGTCCTGCTACCGGGGCGAG A_73_100726 A_73_100726 FALSE XM_616213 XM_616213 LOC536093 ref|XM_616213 unmapped Bos taurus similar to Homo sapiens DEAH (Asp- Glu-Ala-His) box polypeptide 8 (DHX8) TCCTTCATACTCCTGTCCCGCCCCTGTCCTTTTGCTTAACCTCCTGCAAATATTTATTTT A_73_100727 A_73_100727 FALSE CB439167 CB439167 gb|Unidentified transcripts on BTA26 position 10867012-10867771 unmapped Unknown GAAAAAGAATCCCCAAAACCTTTACCTTAAAGAAGAAGATTGGATATCTGTCTGTTTTGC A_73_100728 A_73_100728 FALSE EE896174 EE896174 gb|Unidentified transcripts unmapped Unknown CCCAGCTCTTAAGAATATAACTATTAACTGGAAGAGAAGACCAAAGCAAACTCTCCCAAG A_73_100729 A_73_100729 FALSE AW483072 AW483072 gb|Unidentified transcripts unmapped Unknown AACTTTAATAAGAATCTAATGTGAATGGCTGCTGAACTCTTCCTGCGCTCCGGACGGGCC A_73_100730 A_73_100730 FALSE XM_581879 XM_581879 LOC505572 ref|XM_581879 unmapped Bos taurus similar to Homo sapiens dedicator of cytokinesis 5 (DOCK5) AATGGTTTGGTGGCCCCCCATCTGCAACCTGATTTTATCCTGGAGAATACAGTGCAATAT A_73_100731 A_73_100731 FALSE NM_001013595 NM_001013595 CRYGC ref|NM_001013595 unmapped Bos taurus crystallin, gamma C (CRYGC) CCCATAGGCTGCGGCTGTATGAGAGAGAGGACCAGAAAGGCCTCATTGCGGAGCTGAGCG A_73_100732 A_73_100732 FALSE XM_609975 XM_609975 LOC531478 ref|XM_609975 unmapped PREDICTED: Bos taurus similar to Protein kinase C-binding protein NELL2 precursor (NEL-like protein 2) (Nel- related protein 2) (LOC531478), partial mRNA. ACGACCGGAGTGCGCCAGGTCCCCGGGCTGCACAATGGGACGAAAGCCTTTCTCTTTCAA A_73_100733 A_73_100733 FALSE NC_006853 gb|Bos taurus NADH dehydrogenase subunit 4L (ND4L) unmapped Unknown GCAGCCCTAGGTCTATCTCTACTAGTAATAGTATCAAATACATATGGTACTGATTATGTA A_73_100734 A_73_100734 FALSE XM_864027 XM_864027 LOC538561 ref|XM_864027 unmapped Bos taurus similar to Homo sapiens meningioma expressed antigen 5 (hyaluronidase) (MGEA5) GTTCCTGTAGAAAACGAACTGTAAAACTATCTGAAGACCATACAAGAGGCAAAATAAAAC A_73_100735 A_73_100735 FALSE BG690958 BG690958 gb|Unidentified transcripts on BTA1 position 43155797-43154246 unmapped Unknown TTATGGAACGGATATGAGTGTTTAATATCTCAAGGAGTGCTAGAACTGTGCAGAGGCTGA A_73_100736 A_73_100736 FALSE XM_603718 XM_603718 LOC525365 ref|XM_603718 unmapped Bos taurus similar to Homo sapiens ankyrin repeat domain 23 (ANKRD23) TTCCTGAAGGCAGCTGCTGAGAACCAGGAGGCCTTGATTGACAAGTACCTGGCAGACGGA A_73_100737 A_73_100737 FALSE XM_592088 XM_592088 LOC540182 ref|XM_592088 unmapped Bos taurus similar to Homo sapiens RNA binding motif protein 16 (RBM16) ACAGTATGGCAGTTCTTTTTTAGTACAGTGAAGCATGAAGTCAGATTTAGCATGGAGCCG A_73_100738 A_73_100738 FALSE BM366469 BM366469 gb|Unidentified transcripts unmapped Unknown TCTGCTCCTTGAACAATGTAAGACTCCTCAAACCCCTCCAGGACCAGAAATAAATGCTTT A_73_100739 A_73_100739 FALSE NM_001038073 NM_001038073 MGC134004 ref|NM_001038073 unmapped Bos taurus similar to Homo sapiens alanyl-tRNA synthetase domain containing 1 (AARSD1) GTGTTCCAGTGTGCTTATGCAGTCAGTATCTTTGTGAATAAACAGCTTTCTTCCTTTTTT A_73_100740 A_73_100740 FALSE XM_614932 XM_614932 LOC541184 ref|XM_614932 unmapped PREDICTED: Bos taurus similar to Transcription factor E2F3 (E2F-3) (LOC541184) CCTTCCGCCCTTCTTCCTCCAAGATAGTATCATGAAGTAAACTACAGACTTCAGAACAAA A_73_100741 A_73_100741 FALSE XM_881818 XM_881818 LOC508634 ref|XM_881818 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 32, member A (FAM32A) AACAAATATTGGGTTTGGGGACTGCCACATGTGGAATGCAGAATAAAACAAAAAAGTTAT A_73_100742 A_73_100742 FALSE NM_001034585 NM_001034585 ACTC ref|NM_001034585 unmapped Bos taurus similar to Homo sapiens actin, alpha, cardiac muscle (ACTC) CACCCTCCCTCATCTCTCATCAATCATTGTACAGTTTGTTTACACACGTGCAATTTATTT A_73_100743 A_73_100743 FALSE XM_590942 XM_590942 LOC513279 ref|XM_590942 unmapped Bos taurus similar to Homo sapiens peroxisome proliferative activated receptor, gamma, coactivator-related 1 (PPRC1) TGTGTAAGATGGATGGGGTTGAGGGGTTCCCCCAGTGCAGACTAATAAACATTACTAGTA A_73_100744 A_73_100744 FALSE CB466252 CB466252 gb|Bos taurus similar to PREDICTED: Homo sapiens similar to butyrate-induced transcript 1 (LOC652500) unmapped Unknown TTCTGGTGTCTTCTCAACTGACTTTCTATGTGTAATTGGGCAGATCAGCTTTACAGTAGA A_73_100745 A_73_100745 FALSE CB167273 CB167273 gb|Unidentified transcripts unmapped Unknown GAATTGCCAAACGTTCCTCCAGTAGCCAAAAATATAGTTGTTTCTCTGCCTTTTCAGCTT A_73_100746 A_73_100746 FALSE XM_607367 XM_607367 LOC528930 ref|XM_607367 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 6, subfamily A, member 2 (OR6A2) CTGCCTGCGCAACCAAGAAGTAAAGAGAGCCTTACGCCATACTCTACACCTGCACCAGGG A_73_100747 A_73_100747 FALSE XM_590470 XM_590470 LOC512873 ref|XM_590470 unmapped Bos taurus similar to Homo sapiens deltex homolog 1 (Drosophila) (DTX1) GGACGCCAGCGATTGCTCTTTTGAAAATTTACCAGTCCCACTGTGGGTGGAGAAATAAAT A_73_100748 A_73_100748 FALSE XM_611818 XM_611818 LOC532671 ref|XM_611818 unmapped Bos taurus similar to Homo sapiens mucolipin 2 (MCOLN2) TCCACTGTGGTGGGAAGTTACCCTTGTCAAGCAAGGAAGGTGGTATTTTTCCCCAAAATA A_73_100749 A_73_100749 FALSE XM_584528 XM_584528 LOC507844 ref|XM_584528 unmapped Bos taurus similar to Homo sapiens acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 1 GGAAGAGAATTTGGAGGTAACTTAAGGAAGTCTGAAAGAAAAAGCAGTTACTTTTCATCA A_73_100750 A_73_100750 FALSE XM_617648 XM_617648 LOC537480 ref|XM_617648 unmapped PREDICTED: Bos taurus similar to protein tyrosine phosphatase, receptor type, sigma isoform 2 precursor (LOC537480) TCCCACCTCTGTGTATGTAGATATATCGACTTTGTATTAAAGGAAGATCGTCTGACCCCG A_73_100751 A_73_100751 FALSE NM_174311 NM_174311 EPB41 ref|NM_174311 unmapped Bos taurus erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) (EPB41) AGACATAAGACGTTGCTTCAGACATATCTGATACTGTGAATGTTTGACTGTATCCGTGGC A_73_100752 A_73_100752 FALSE NM_001001175 NM_001001175 ApoC3 ref|NM_001001175 unmapped Bos taurus apolipoprotein C-III (ApoC3) CAGACCTGGCCCACCCCAATGTGCTGGCCTTCCAATAAAGCTGGATGAGAAACCGCCAAA A_73_100753 A_73_100753 FALSE XM_867914 XM_867914 LOC615969 ref|XM_867914 unmapped Bos taurus similar to Homo sapiens proliferation-inducing protein 38 (PIG38) AAATAAAAGATGAACTAGTGCTCCTGTCTTGTACTTGGTATGTAACATTCAGGTTTATGC A_73_100754 A_73_100754 FALSE NM_001034518 NM_001034518 CYB5R1 ref|NM_001034518 unmapped Bos taurus similar to Homo sapiens cytochrome b5 reductase 1 (CYB5R1) ACCCTGTTTAATGGGTTTCATTTAATATTTGGTGCTTAACCCGTAGCAGACTGTGTATCG A_73_100755 A_73_100755 FALSE NM_001034574 NM_001034574 TRIM38 ref|NM_001034574 unmapped Bos taurus similar to Homo sapiens tripartite motif-containing 38 (TRIM38) GTGATTTTGCTTTGTCCTCTCCATCCCTCTTCAATGGGTTCAGAGCTTTGATTTCTAGAG A_73_100756 A_73_100756 FALSE CB429936 CB429936 gb|Bos taurus similar to Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 10 (ABCB10), nuclear gene encoding mitochondrial protein unmapped Unknown CAAGGTTGGATCTGAAGGAAATCTCTTTGTGCCATAGTATTTACAAAATTGAATGTGATC A_73_100757 A_73_100757 FALSE XM_601658 XM_601658 LOC523362 ref|XM_601658 unmapped Bos taurus similar to Homo sapiens polymerase (DNA directed) nu (POLN) CTGCTGTTTGAAGTGGAGGATTCACAGGTTCCTGAGTTCACAGCCCTTGTCCAGGGAACC A_73_100758 A_73_100758 FALSE XM_606328 XM_606328 LOC527921 ref|XM_606328 unmapped Bos taurus similar to Homo sapiens RASD family, member 2 (RASD2) GCCAAGAAGAACACCAACGTGGACGAGATGTTCTACGTGCTGTTCAGCATGGCCAAGCTG A_73_100759 A_73_100759 FALSE XM_590001 XM_590001 LOC512479 ref|XM_590001 unmapped Bos taurus similar to Homo sapiens heterogeneous nuclear ribonucleoprotein R (HNRPR) TTTGAAACCTGCCCTACAAAATTTGTTTGGCTTAAACGTCAAAGCCGTGACAATTTGTTC A_73_100760 A_73_100760 FALSE NM_173967 NM_173967 TTR ref|NM_173967 unmapped Bos taurus transthyretin (TTR) GGTGCCTGCCTCGGCGGACCTGAAGGATGAAGGACAGGATTTGGTGTAACCGAGAGTATT A_73_100761 A_73_100761 FALSE XM_876162 XM_876162 LOC520842 ref|XM_876162 unmapped Bos taurus similar to Homo sapiens Kruppel- like factor 4 (gut) (KLF4) TTATGCACTGTGGTTTCAGATGTGCAATAATTTGTACAATGGTTTATTCCCAAGTATGCC A_73_100762 A_73_100762 FALSE XM_867961 XM_867961 LOC616008 ref|XM_867961 unmapped Bos taurus similar to Homo sapiens interleukin 13 receptor, alpha 2 (IL13RA2) ATAGCATTCTGTCACTCCCTGTTTTTTGATTGCCTGCTGGAAATGTCGCCATGTCCCTTT A_73_100763 A_73_100763 FALSE NM_001038087 NM_001038087 ZMYND12 ref|NM_001038087 unmapped Bos taurus similar to Homo sapiens zinc finger, MYND-type containing 12 (ZMYND12) GAAGCCCGCTATCATCTGGCCAATGATATTTATTTTGCCAGTTGTGCATTTGGAACAGAG A_73_100764 A_73_100764 FALSE XM_606561 XM_606561 LOC528149 ref|XM_606561 unmapped Bos taurus similar to Homo sapiens chondroitin sulfate synthase 3 (CSS3) AGAAGCTTTATGAAACAATGTCCTTCATTTGCTGGCAAGAAGATAAAATATGACAGAACC A_73_100765 A_73_100765 FALSE XM_865984 XM_865984 LOC614466 ref|XM_865984 unmapped Bos taurus similar to Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10) ACTTCATTTTCAAGGGATTTTCTACTTGAGTTAGAAATATGGCTTGCCAAGGAAAAACAC A_73_100766 A_73_100766 FALSE EE891332 EE891332 gb|Unidentified transcripts on BTA11 position 77325449-77326234 unmapped Unknown TTTTTTCCTTTCTGAAAATTGGCAATCTGCTCTCAGGTTTGAGCAAAGAAAGGATCGGCC A_73_100767 A_73_100767 FALSE NM_001037490 NM_001037490 ZNF474 ref|NM_001037490 unmapped Bos taurus zinc finger protein 474 (ZNF474) TCCTGCCAGACAGACTGATTGTTCACCAACGATCCTGTAAACCAAAAGTCGCCAAGTAAA A_73_100768 A_73_100768 FALSE CB426496 CB426496 gb|Bos taurus similar to Homo sapiens SFRS protein kinase 1 (SRPK1) unmapped Unknown CCCCAAACACATTTTTATTCTTTCTACTGGGTGCATTGTCTGTTTTCTTTGTAAATGCAG A_73_100769 A_73_100769 FALSE XM_867716 XM_867716 LOC615809 ref|XM_867716 unmapped Bos taurus similar to Homo sapiens CAAX box 1 (CXX1) CCCCAACTCAGCACTACTTGGAGAAAAGTCTTTCTTATTTTCAATAAATGTCAGACACTA A_73_100770 A_73_100770 FALSE XM_590614 XM_590614 LOC539972 ref|XM_590614 unmapped Bos taurus similar to Homo sapiens transmembrane and tetratricopeptide repeat containing 4 (TMTC4) AAACGCAAGAGGTAAACTTCCTCTCAAAAGGAACCACATTTGAGGAGTTTGTGATCTTTT A_73_100771 A_73_100771 FALSE BP110264 BP110264 gb|Bos taurus similar to Homo sapiens zinc finger and BTB domain containing 7A (ZBTB7A) unmapped Unknown AAACAACAAGACAACCAACCACAAATAGGAGTCTTGGCACTTTGTAACAGAACGGGTACT A_73_100772 A_73_100772 FALSE XM_602927 XM_602927 LOC524599 ref|XM_602927 unmapped Bos taurus similar to Homo sapiens calcyphosine 2 (CAPS2) TGAAGGTCTAAGTATAGGGATAGTAGATGATGAAGATTTTGTCAATGTCTTATGTACTCC A_73_100773 A_73_100773 FALSE EE945150 EE945150 gb|Unidentified transcripts unmapped Unknown TCTGGACTTCAAATCCTCCTTTGCTAAGGTGCATTTATGTGATACAAGGCCTAAGCAAAC A_73_100774 A_73_100774 FALSE XM_595913 XM_595913 LOC517737 ref|XM_595913 unmapped PREDICTED: Bos taurus similar to preferentially expressed antigen in melanoma (LOC517737) AAAGAACCATGAATGAATTCCTCACTTACCTCCTGAAGTGGGTAGAGGAGAGAGACCCTT A_73_100775 A_73_100775 FALSE XM_597007 XM_597007 LOC518806 ref|XM_597007 unmapped Bos taurus similar to Homo sapiens annexin A5 (ANXA5) CCCAAACATTCCTGATGTGAAAGTCACTCGGAGAAAAGTCATATGAATAAAACATGTTAC A_73_100776 A_73_100776 FALSE XM_594158 XM_594158 LOC540456 ref|XM_594158 unmapped Bos taurus similar to Homo sapiens chromosome 18 open reading frame 10 (C18orf10) TTGGAGCCCCTGAAGTATTTCTGCATCAGTTCTGGCCCAATTCTGGATTTCACAAATGAA A_73_100777 A_73_100777 FALSE XM_877976 XM_877976 LOC538523 ref|XM_877976 unmapped PREDICTED: Bos taurus similar to nuclear factor of activated T-cells 5 isoform b, transcript variant 4 (LOC538523) CTGGCTGCAAAAGAGCACACCTTGGCTACCTATTGCAGTGATTAACCACCATTGTTAACA A_73_100778 A_73_100778 FALSE NM_181813 NM_181813 DNMT3B ref|NM_181813 unmapped Bos taurus DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) GACATCTCTCGGTTTTTGGAGTGTAACCCAGTGATGATTGATGCCATCAAAGTGTCTGCT A_73_100779 A_73_100779 FALSE XM_867376 XM_867376 LOC615535 ref|XM_867376 unmapped Bos taurus similar to Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) CTCTTCTACTTCTCTTAAGGGCAGAAGGAGCTGTGAACATTCTCTGGACACCAGATGTTT A_73_100780 A_73_100780 FALSE CB464394 CB464394 gb|Unidentified transcripts unmapped Unknown ACTTTATGTTCTTCCCTACAAAATCATAAAACTGAGCAAATACAATAAAGCTCTTCCCCC A_73_100781 A_73_100781 FALSE EE965702 EE965702 gb|Unidentified transcripts unmapped Unknown TAAAAAAGCAAAACAGTAAATCAAGAGTTGTAGTTTTCCAGTGTTAACTCCAGGTCAGAC A_73_100782 A_73_100782 FALSE NM_001014953 NM_001014953 LMAN2L ref|NM_001014953 unmapped Bos taurus lectin, mannose-binding 2-like (LMAN2L) GCTCCCCAAAGAGGAACTCTTGCTTCTCTTCCTTAAGTGATAAGAAACGGTGGTTGTAAA A_73_100783 A_73_100783 FALSE XM_590121 XM_590121 LOC512582 ref|XM_590121 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 62 (C2 domain containing) member B (FAM62B) GTGTTACCTCGCTTGTGATTTATTCTTCCTTTGTCTTTTGAAGTAAAATGTTTAGTGTGG A_73_100784 A_73_100784 FALSE XM_870708 XM_870708 LOC618374 ref|XM_870708 unmapped PREDICTED: Bos taurus similar to phosphatidylinositol 4-kinase type-II beta (LOC618374), partial mRNA. TGCAATTGACCGTGCAAAATCTAGAGGCAAAAAGTATGCTTTAGAAAAAGTGCCAAAAGT A_73_100785 A_73_100785 FALSE XM_580952 XM_580952 LOC538532 ref|XM_580952 unmapped PREDICTED: Bos taurus similar to golgi phosphoprotein 4, transcript variant 2 (LOC538532) ATTGACCCTCATGACTTTTCTGTTTGCTGGGATTAGGTCTGCATTATATCCATGGATACA A_73_100786 A_73_100786 FALSE XM_871049 XM_871049 LOC618726 ref|XM_871049 unmapped Bos taurus similar to Homo sapiens neural proliferation, differentiation and control, 1 (NPDC1) CCCCCCAGTCGAGGGGAGGAGGAGAACCCTAGAGACCAGGCATGGATTGGTAATACCGGA A_73_100787 A_73_100787 FALSE NM_001034683 NM_001034683 MGC127308 ref|NM_001034683 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 56 (CCDC56) CAGCTCTGTGCAGTGTTGGAGCCTAAAGTGGGAAAGATGGGGTCAGGTTGAAAATAATAA A_73_100788 A_73_100788 FALSE XM_594323 XM_594323 LOC516179 ref|XM_594323 unmapped PREDICTED: Bos taurus similar to NK6 transcription factor related, locus 2 (LOC516179) ACTCCAAAGACATCATTTAAAAGCATACTTCGGGGCCGCGGCCGCCTTTGCGCGTGGCTA A_73_100789 A_73_100789 FALSE NM_001034554 NM_001034554 MGC128443 ref|NM_001034554 unmapped Bos taurus similar to Homo sapiens proline rich 3 (PRR3) ATGGACCCCAGGTTATGGAAGACAAATCTGACCGCCCCGTCTGCCGACACTTCGCCAAAA A_73_100790 A_73_100790 FALSE XM_595703 XM_595703 LOC517531 ref|XM_595703 unmapped Bos taurus similar to Homo sapiens mitochondrial intermediate peptidase (MIPEP), nuclear gene encoding mitochondrial protein AGTGCTGCGGCTACAAACATTTGTTTCCGAGTTCTGTATTCACTTCTGTGATAACTTGTG A_73_100791 A_73_100791 FALSE XM_591226 XM_591226 LOC513532 ref|XM_591226 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 52, subfamily E, member 5 (OR52E5) TAACCCTATCATCTATGGGGTTAGGACAAAGCAGATAAGACAGCGAGTGCTTAGGATGCT A_73_100792 A_73_100792 FALSE EE892165 EE892165 gb|Unidentified transcripts unmapped Unknown AAAGAATGAGATGAGCTATCTGAAGATATTTTCCCAAGAGCGACACACCCAAAATTTGAA A_73_100793 A_73_100793 FALSE XM_614418 XM_614418 LOC541071 ref|XM_614418 unmapped PREDICTED: Bos taurus similar to nuclear receptor coactivator 7 (LOC541071) CCTCACAGCTATGCCTAACAGGAAGTGTGTGTTTGCTCGAAATCCTAATTTGGGTGTGTT A_73_100794 A_73_100794 FALSE XM_609116 XM_609116 LOC530641 ref|XM_609116 unmapped PREDICTED: Bos taurus similar to ciliary rootlet coiled-coil, rootletin (LOC530641) AAGGTGGAAAGGGAGAAGCTCCGCAGTCACGAGGACACGGTGCGTCTGAACGTGGAGAAG A_73_100795 A_73_100795 FALSE XM_609847 XM_609847 LOC531355 ref|XM_609847 unmapped Bos taurus similar to Homo sapiens zinc finger protein 169 (ZNF169) AAGTCTCACCTCCACAGGCATAGGAAAACCAAGTCTGGCCATCACCTCCTGCCACAGGAA A_73_100796 A_73_100796 FALSE BF604070 BF604070 gb|Unidentified transcripts unmapped Unknown TAAGGCACTTGGCCTTCCTTTGTGACTTCCGTGTCTATTAAAGCATGAGTTCCCTTGGTT A_73_100797 A_73_100797 FALSE CB441455 CB441455 gb|Unidentified transcripts on BTA2 position 26493477-26494343 unmapped Unknown GAGTCTTGCTGAACTCCCTTTATTCTGGCTGTATGTTTGCAGACTCGCTTGGATTTTTTA A_73_100798 A_73_100798 FALSE XM_877265 XM_877265 LOC532578 ref|XM_877265 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein FLJ10707, transcript variant 35 (FLJ10707) AATAGGGACTTTTTCATCTCCTTATGCTTTTCCTCCCAACTCTTTCTAGCTCCTGCAGTG A_73_100799 A_73_100799 FALSE XM_614440 XM_614440 LOC541076 ref|XM_614440 unmapped Bos taurus similar to hypothetical protein FLJ32001 (LOC541076) ATTTTCTTACTAGTTGTTACTGGCTGGTACAGTACATCCCTTCGTGTTTCAGCTTATTTA A_73_100800 A_73_100800 FALSE NM_001034038 NM_001034038 RPS3A ref|NM_001034038 unmapped Bos taurus similar to Homo sapiens ribosomal protein S3A (RPS3A) AGGTGCTAAAGTTGAACGAGCTGATGGATACGAGCCACCAGTCCAAGAATCGGTTTAAAA A_73_100801 A_73_100801 FALSE XM_615931 XM_615931 LOC535817 ref|XM_615931 unmapped PREDICTED: Bos taurus similar to STE20/SPS1-related proline-alanine rich protein kinase (Ste-20 related kinase) (Serine/threonine-protein kinase 39) (Pancreatic serine /threonine-protein kinase) (PS/TK) (PSTK1) (LOC535817), partial mRNA. CCACAGCAGCAGAACTTTTAAAATGCAAATTCTTCCAGAAAGCCAAGAACAGAGAGTACC A_73_100802 A_73_100802 FALSE XM_597874 XM_597874 LOC519650 ref|XM_597874 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 121 (C1orf121) CAGAACTGTCTGTGGCAGTTGACTATCACTAGAGAAAAGTAAAAGAATAAACGTCCTTTG A_73_100803 A_73_100803 FALSE XM_606595 XM_606595 LOC528183 ref|XM_606595 unmapped PREDICTED: Bos taurus similar to NIMA (never in mitosis gene a)-related expressed kinase 5 (LOC528183) TGTGCTACCTCTGACAGTTTCACATTCATTCGGTGTCACACTGAAATTCGTGCACACTCA A_73_100804 A_73_100804 FALSE BE667594 BE667594 gb|Unidentified transcripts unmapped Unknown TGCCTGCTTTGCCTCTTTTTGTACAGAAGTTTTGAGTGTGAAATGAAAATTAAAGTTTGG A_73_100805 A_73_100805 FALSE XM_607500 XM_607500 LOC529060 ref|XM_607500 unmapped Bos taurus similar to Homo sapiens Kell blood group, metalloendopeptidase (KEL) CGGGGCACTGACCATCGCACTGAAGGCATACAAAAAGAGGCTAGTTCTGTTCCGTGGGGA A_73_100806 A_73_100806 FALSE NM_001024482 NM_001024482 ZDHHC16 ref|NM_001024482 unmapped Bos taurus Abl-philin 2 isoform 2 (ZDHHC16) TTCTCAACAGGGCAAAGATATCAGGCCTACTGCTGAGGTCACTGCCACTTCTCATGTGCT A_73_100807 A_73_100807 FALSE XM_869942 XM_869942 LOC617645 ref|XM_869942 unmapped Bos taurus similar to Homo sapiens KIAA1160 protein (KIAA1160) GGGTACATTTGCCGCTTCCGTCTGGGAGTGGTTCTGCACAGAGCTATTTTTATTAAAGAT A_73_100808 A_73_100808 FALSE NM_001015662 NM_001015662 PTPRR ref|NM_001015662 unmapped Bos taurus protein tyrosine phosphatase, receptor type, R (PTPRR) AAACAATCTACACTCAGCAAACACTAGATGTTCTGCTCACATATGAATTTTTAATGCAGC A_73_100809 A_73_100809 FALSE NM_001034458 NM_001034458 MGC128642 ref|NM_001034458 unmapped Bos taurus similar to Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 19 (DNAJC19), transcript variant 1 AGGATCTCCTTATATAGCAGCCAAAATCAATGAAGCTAAAGATTTGCTAGAAGGTCAAGC A_73_100810 A_73_100810 FALSE NM_001008416 NM_001008416 KLK1 ref|NM_001008416 unmapped Bos taurus kallikrein 1 (KLK1) TCCTGCCCAATGAGAAGTGTGCCACAGCCCACCCCCAGGAGGTGACAGAGTGGATGCTGT A_73_100811 A_73_100811 FALSE XM_612961 XM_612961 LOC533527 ref|XM_612961 unmapped Bos taurus similar to Homo sapiens protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma) (PPP3CC) TGCTTTCCATAATAACCTACTCTCTTCTGGACTCTCAGTTACTCTTAATGTATCCTGGTA A_73_100812 A_73_100812 FALSE NM_001034343 NM_001034343 MRPS7 ref|NM_001034343 unmapped Bos taurus similar to Homo sapiens MIF4G domain containing (MIF4GD) AATTTACTGATCACTGGGTCTTCAAACACAGAGCTTGTTTTCGTGGCTGGGGCAGCTTTA A_73_100813 A_73_100813 FALSE XM_591246 XM_591246 LOC513550 ref|XM_591246 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 18, member B (FAM18B) TTTGAAGATGTTTTGTTTAATTGAATGCGTGTCTTTATTGGAGTGAGAGCTTTGAAGGTG A_73_100814 A_73_100814 FALSE XM_594774 XM_594774 LOC516618 ref|XM_594774 unmapped Bos taurus similar to Homo sapiens rotatin (RTTN) AAGACATGCTAAGCCTCCACAACAAAAGGTGTAGAGAGTCCTGGGAACACAAGCAGTTTT A_73_100815 A_73_100815 FALSE CB452276 CB452276 gb|Bos taurus similar to Homo sapiens TNF receptor-associated factor 2 (TRAF2) unmapped Unknown TCCTGGGGCGACACCACATCAGACCCCCATTGAAGACAAAGCCACTGACACTTTTCAGGC A_73_100816 A_73_100816 FALSE CB418455 CB418455 gb|Unidentified transcripts on BTA2 position 70684562-70683896 unmapped Unknown AGTAGGTGCTCCTGAGGTCCTGGGCCACTTGGTAATGACCCCTGAGCCTGAACTTTCCAA A_73_100817 A_73_100817 FALSE XM_869763 XM_869763 LOC617491 ref|XM_869763 unmapped PREDICTED: Bos taurus similar to Mpv17 transgene, kidney disease mutant-like (LOC617491) ACCCCCATTTTGATGGTATACATCTCTTCTAAAATCTCAGGTTGTCTCCTAAACACTTTT A_73_100818 A_73_100818 FALSE XM_607974 XM_607974 LOC529524 ref|XM_607974 unmapped PREDICTED: Bos taurus similar to tumor protein p53 binding protein, 1 (LOC529524) AAAGGAAAAATGGATCTACTGCTGTTGCTGAGGCTGTTGCCAGGTCTCTTCAGCTTCTTA A_73_100819 A_73_100819 FALSE XM_582692 XM_582692 LOC506264 ref|XM_582692 unmapped Bos taurus similar to Homo sapiens cysteine rich transmembrane BMP regulator 1 (chordin-like) (CRIM1) TATTTTAAGGTTGCCAGTTCCATGAATCTCCAGCATCACAAACAGCCCCATTGCTTTGCT A_73_100820 A_73_100820 FALSE XM_582867 XM_582867 LOC506420 ref|XM_582867 unmapped Bos taurus similar to Homo sapiens HIG1 domain family, member 2A (HIGD2A) GGAAAAGTTTATTCGCAAGACCCGCGAGAACCCATTGGTACCCATAGGCTGCCTGGGCAC A_73_100821 A_73_100821 FALSE NM_001014855 NM_001014855 PSMC1 ref|NM_001014855 unmapped Bos taurus proteasome 26S ATPase subunit 1 (PSMC1) GAAGGAAAATGTTCTTTATAAAAAGCAGGAGGGCACCCCAGAGGGGCTCTATCTCTAGTA A_73_100822 A_73_100822 FALSE XM_874697 XM_874697 LOC533920 ref|XM_874697 unmapped PREDICTED: Bos taurus similar to lysophospholipase-like 1, transcript variant 2 (LOC533920) TATCAACAGTTTACTGACTTACTTGTTTTTGACATACTGAGCACCATAGATAGTAGTGTG A_73_100823 A_73_100823 FALSE BP111591 BP111591 gb|Bos taurus similar to Homo sapiens SH3 domain binding glutamic acid-rich protein like 2 (SH3BGRL2) unmapped Unknown TTGGTGAAATGTCAGATTTTATATTCAGCATTAAAGAGGAATAAATTCCCGAAAACCCCC A_73_100824 A_73_100824 FALSE XM_618574 XM_618574 LOC538371 ref|XM_618574 unmapped Bos taurus similar to Homo sapiens paired box gene 2 (PAX2), transcript variant b CTGGGAGTGATTTTTCCGGGAGCCCCTACAGCCACCCTCAGTATCCCTCGTACAACGACT A_73_100825 A_73_100825 FALSE NM_001038536 NM_001038536 MGC134069 ref|NM_001038536 unmapped Bos taurus similar to enoyl Coenzyme A hydratase domain containing 2 (MGC134069) CATATCATCCCCTCCCCAAGATTTTTGTGTAAAAAGGGGGCCCTCAGGGGGTAAATATTA A_73_100826 A_73_100826 FALSE XM_585092 XM_585092 LOC508330 ref|XM_585092 unmapped Bos taurus similar to Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) (MLL) TCTCTGTCTTAAACCCTGAACTGCCTTGCCTCTCATTTTGTTGTATTCATTTGCCAAAAC A_73_100827 A_73_100827 FALSE XM_868990 XM_868990 LOC616867 ref|XM_868990 unmapped Bos taurus similar to Homo sapiens MARVEL domain containing 1 (MARVELD1) GGGACCGAAGTGCCTCATTCAGTAGTTTAGTGATGATGACGGACACGCTTTTCTGAATAA A_73_100828 A_73_100828 FALSE XM_612552 XM_612552 LOC533222 ref|XM_612552 unmapped Bos taurus similar to Homo sapiens DEAH (Asp- Glu-Ala-His) box polypeptide 40 (DHX40) TTTTTGCCACCTCCACCTGGAATTAGAAAATGTGTCATATCCACCAATATTTCTGCAACA A_73_100829 A_73_100829 FALSE NM_203358 NM_203358 GAP43 ref|NM_203358 unmapped Bos taurus growth associated protein 43 (GAP43) GCTCACGTCCGTGAGTCTGTCCTCTCCCACCCACTGGCCCTCTTTCTCTCTGTGTGGCAA A_73_100830 A_73_100830 FALSE XM_870387 XM_870387 LOC618057 ref|XM_870387 unmapped PREDICTED: Bos taurus similar to sperm- specific protein Izumo (LOC618057) CGATCATCTATTTTCACGTCACAGTATTGCCCAAAAGAATCCAGGAGGAGATACCGTCAC A_73_100831 A_73_100831 FALSE XM_596639 XM_596639 LOC518448 ref|XM_596639 unmapped PREDICTED: Bos taurus similar to Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 1 (Brain cyclic nucleotide gated channel 1) (BCNG-1) (LOC518448) TCTAAGAATGGTGGAGTAGAAGGACGTGTGATCATCTTCTCCTTAGAGAACTCCAAAACT A_73_100832 A_73_100832 FALSE NM_001040502 NM_001040502 AGP ref|NM_001040502 unmapped Bos taurus alpha-1 acid glycoprotein (AGP) CCTGCTCACTGTTTGTAACTCAGTTCCCTCGGTTGCATCAATAAAGTTTGTTTCGGTGCA A_73_100833 A_73_100833 FALSE XM_593250 XM_593250 LOC515266 ref|XM_593250 unmapped Bos taurus similar to Homo sapiens activating transcription factor 3 (ATF3), transcript variant 1 TCTCTGGCTACTATCTGTTTAAATTCTGACGTTTCTGTGAAATCCTCAGAGTGTTTAGTC A_73_100834 A_73_100834 FALSE XM_864758 XM_864758 LOC533994 ref|XM_864758 unmapped Bos taurus similar to Homo sapiens Sec23 homolog A (S. cerevisiae) (SEC23A) TCCCGCTTATTTTGAAATCTAGTAAGCCTGAAAAGCCTAGTGTAAAAGTAGAGCATTTAT A_73_100835 A_73_100835 FALSE XM_879256 XM_879256 LOC514443 ref|XM_879256 unmapped Bos taurus similar to Homo sapiens TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa (TAF10) TGTTTTCATAATAAACTTTATTGTGACAGGCAGGGCTGATCCCTCCCATGCTGGGAGACA A_73_100836 A_73_100836 FALSE XM_615361 XM_615361 GDNF ref|XM_615361 unmapped Bos taurus similar to Homo sapiens glial cell derived neurotrophic factor (GDNF), transcript variant 1 GTGTTGCAGACCCATCGCCTTTGATGACGACCTGTCCTTTTTAGATGATAACCTGGTTTA A_73_100837 A_73_100837 FALSE XM_582180 XM_582180 LOC505827 ref|XM_582180 unmapped PREDICTED: Bos taurus similar to tumor protein p53 inducible protein 5 (LOC505827) GAGAGCAAGTTCACTATCAAGTTCTTCACTCTGCAGTTTTTTGCTCACTTCTCCTCCCTT A_73_100838 A_73_100838 FALSE XM_607057 XM_607057 LOC528630 ref|XM_607057 unmapped PREDICTED: Bos taurus similar to tripartite motif protein 17 (LOC528630) GCTCAACCACTTCCGAGTCAACTTTTCACTCAGTAATGAAGTAAGCAGTCAGCACATCAG A_73_100839 A_73_100839 FALSE NM_173934 NM_173934 LUM ref|NM_173934 unmapped Bos taurus lumican (LUM) ATGGATGTTTACAGTCCTGCAGCAAATTATCTCAATGCTCAAATGTTCACATTTCAATGT A_73_100840 A_73_100840 FALSE XM_613709 XM_613709 LOC534075 ref|XM_613709 unmapped PREDICTED: Bos taurus similar to egl nine homolog 1 (LOC534075) CCTGTGTGTATATATGCAGAAAAGTATAATCGGTGTGGTCATGAACTAAAGAGCTGTTTA A_73_100841 A_73_100841 FALSE XM_883110 XM_883110 LOC617051 ref|XM_883110 unmapped Bos taurus similar to Homo sapiens H3 histone, family 3B (H3.3B) (H3F3B) ATAAGGCAAAAGTACTTTTCTGGTTTTGGGAAACTTCCCATATGTTTTATCCCTGGGTTT A_73_100842 A_73_100842 FALSE XM_601242 XM_601242 LOC522953 ref|XM_601242 unmapped PREDICTED: Bos taurus similar to A-kinase anchor protein 6 (Protein kinase A anchoring protein 6) (PRKA6) (A-kinase anchor protein 100 kDa) (AKAP 100) (mAKAP) (LOC522953), partial mRNA. GATGACCTCGGAGAGGGTCCGAGACCTAACCTATTCAGTCCAGCAGGACTCAGACAGCAA A_73_100843 A_73_100843 FALSE XM_869381 XM_869381 LOC617176 ref|XM_869381 unmapped Bos taurus similar to Homo sapiens MORN repeat containing 1 (MORN1) CTCGCGGATGGCTCCACCTATGAGAGGTGATGGTGACCAATTGTGGCGTGTGGGACTAAA A_73_100844 A_73_100844 FALSE XM_869799 XM_869799 LOC617524 ref|XM_869799 unmapped PREDICTED: Bos taurus similar to Acidic mammalian chitinase precursor (AMCase) (TSA1902) (LOC617524) TCTGAGTTCCTTCCTCTCCTCTGCTCCTGCTTACAGTAACTTCATGCAGGAAGAACCCAA A_73_100845 A_73_100845 FALSE NM_001007811 NM_001007811 CDK11 ref|NM_001007811 unmapped Bos taurus PITSLRE protein kinase beta 1 (CDK11) AGAACCAGGCATGTGAACTCTCAGCCACAGTGGGTTTTTGTACAAGGTTGTTTCTGTGTT A_73_100846 A_73_100846 FALSE NM_174112 NM_174112 MMP1 ref|NM_174112 unmapped Bos taurus matrix metalloproteinase 1 (MMP1) ACAACTTCAGGAATGTATGAGCAACCACCACTACCATCCTGATACCCAAGGGACAACTTT A_73_100847 A_73_100847 FALSE XM_584430 XM_584430 LOC507756 ref|XM_584430 unmapped Bos taurus similar to Homo sapiens ADP- ribosyltransferase 5 (ART5) ATGAAGTCTTCGTGGTGACGAGTTTCTTTAAGGATGGAAACAACAGCCTGGTGACTCTCT A_73_100848 A_73_100848 FALSE AW464731 AW464731 gb|Bos taurus similar to PREDICTED: Homo sapiens Rho GTPase activating protein 23, transcript variant 2 (ARHGAP23) unmapped Unknown AACAACTAAGATTTCCTGCTTGTGAAAAGTCCTGTCTGAACAGTATAGTCTATATGTTGG A_73_100849 A_73_100849 FALSE CB448410 CB448410 gb|Bos taurus similar to Homo sapiens zinc finger, AN1-type domain 3 (ZFAND3) unmapped Unknown GAAAAATCTTATTTAACCCTTTTGTGTTCTAGATTTACTTACACACATAGCCTAGAGCCC A_73_100850 A_73_100850 FALSE XM_866480 XM_866480 LOC519754 ref|XM_866480 unmapped PREDICTED: Bos taurus similar to protein kinase N2, transcript variant 2 (LOC519754) TTCAGAAGAGGAGCAAGAAATGTTCAGAGATTTTGACTACATTGCTGATTGGTGTTAAGT A_73_100851 A_73_100851 FALSE XM_612483 XM_612483 LOC533166 ref|XM_612483 unmapped Bos taurus similar to Homo sapiens sortilin- related receptor, L(DLR class) A repeats-containing (SORL1) ACGACGTCCCCATGGTGATAGCCTGAAAGAGCTTTCCTCACTAGAAACCAAATGTTGTAA A_73_100852 A_73_100852 FALSE XM_605843 XM_605843 LOC527452 ref|XM_605843 unmapped PREDICTED: Bos taurus similar to obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (LOC527452) AAGGATGGCGTGGAGCTCGGTTGCTCCTGCCAGCACTTCTCCCGGGAGGATGTAGACACA A_73_100853 A_73_100853 FALSE NM_001014963 NM_001014963 C14orf32 ref|NM_001014963 unmapped Bos taurus MAPK-interacting and spindle- stabilizing protein (C14orf32) TGTTAGGTTTTATCACCTGCTGCTGTATTTGTAAACAAAGACAAATGTTGCTTTAAGACG A_73_100854 A_73_100854 FALSE XM_586906 XM_586906 LOC539404 ref|XM_586906 unmapped Bos taurus similar to Homo sapiens iron- responsive element binding protein 2 (IREB2) TAAGGATTTATGTTTCCAGTCTACCTAGTCCAGTAAAAGTACAAGCAGTCTTTTATTCAG A_73_100855 A_73_100855 FALSE XM_864920 XM_864920 LOC613651 ref|XM_864920 unmapped Bos taurus similar to Homo sapiens splA/ryanodine receptor domain and SOCS box containing 2 (SPSB2) CAAGGCTGTGGCAGCCTGGTACACAAGACATTTTTGCAAGTAAAAATTATAAGAGATGTG A_73_100856 A_73_100856 FALSE XM_870502 XM_870502 LOC618180 ref|XM_870502 unmapped Bos taurus similar to Homo sapiens free fatty acid receptor 1 (FFAR1) CCTTTGGTGACTGGCTACTTGGGAGGCCACCCTGGCCAGGGGACAGTCTGTGTGGCAAAA A_73_100857 A_73_100857 FALSE XM_876747 XM_876747 LOC513116 ref|XM_876747 unmapped Bos taurus similar to Homo sapiens DDHD domain containing 2 (DDHD2) AGAATTGGTATTGCTTATTCTCAGCAAGAGAGATTGTTTGCATGGAAAGATTAATAGCAC A_73_100858 A_73_100858 FALSE CB436528 CB436528 gb|Unidentified transcripts on BTA9 position 59527183-59525929 unmapped Unknown TTTTTTGGCCGTGCAACATGGCATGTGGGATCATAGTGCTGCCTGTAATGGAAGCGTGGA A_73_100859 A_73_100859 FALSE XM_590673 XM_590673 LOC513052 ref|XM_590673 unmapped Bos taurus similar to Homo sapiens target of EGR1, member 1 (nuclear) (TOE1) TGACCAGCACCTGTAACACCGACTTTATTCATTTTTAAATCTCAAAGTGTCCTGGGAAAG A_73_100860 A_73_100860 FALSE BE724076 BE724076 gb|Unidentified transcripts unmapped Unknown TAACAATGATGGTGGAGTTGGGCTATATTGGTTTTCTACTGTTGCATTAAACTTACCATG A_73_100861 A_73_100861 FALSE CB448035 CB448035 gb|Bos taurus similar to Homo sapiens solute carrier family 1 (glial high affinity glutamate transporter), member 2 (SLC1A2) unmapped Unknown CTAGGAAATGCCTTGTTGGCAAAGCACATTTTGGGTATTTGAAGTATTTTACTTTCACCT A_73_100862 A_73_100862 FALSE XM_614253 XM_614253 LOC541040 ref|XM_614253 unmapped Bos taurus similar to Homo sapiens SEC63-like (S. cerevisiae) (SEC63) AAAGGTCACTATAAAAGCTGAAAGACATTGTTAGCTTTTAATCTACCTGACTCTGTCAGA A_73_100863 A_73_100863 FALSE XM_867218 XM_867218 LOC615416 ref|XM_867218 unmapped PREDICTED: Bos taurus similar to type II keratin Kb23 (LOC615416) ATGGGTCAGGTTGAGCCCTCCTTTCCATTACTAGCTAAATCTCTTGTTTCAAATTACCTT A_73_100864 A_73_100864 FALSE hmm78645 gb|Bos taurus similar to Homo sapiens SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal) (SOX9) unmapped Unknown GAGCAGGGTCAGCCCACTGACAAACTTTAATTCCTAATTACTTCTGTGGCTGGAGAGTTT A_73_100865 A_73_100865 FALSE BM287943 BM287943 gb|Bos taurus similar to Homo sapiens R7 binding protein (R7BP) unmapped Unknown CTAGAAAGAGGAAGCCACATGCTTTGTTTTTCTGCTCACAGCTTTGTTGTGCTCTTCCTC A_73_100866 A_73_100866 FALSE XM_585854 XM_585854 LOC508986 ref|XM_585854 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 10, subfamily J, member 5 (OR10J5) CAAGCCAGAGTAAGACTACTTGTTTCTGTGCCTGAGGAGTTCTGTTTGGAGACCTCTTTT A_73_100867 A_73_100867 FALSE XM_872650 XM_872650 LOC534742 ref|XM_872650 unmapped Bos taurus similar to Homo sapiens solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24 (SLC25A24), transcript variant 1 CATCACCCCAAACTTTATGAAGGTGCTCCCTGCTGTAGGCATCAGTTATGTGGTTTATGA A_73_100868 A_73_100868 FALSE NM_173896 NM_173896 BTC ref|NM_173896 unmapped Bos taurus betacellulin (BTC) GCACATGCTGTCATCCTCTTCGGAAACGTCGGAAAAGAAGAAAGAAGGAAGAAGAAATGG A_73_100869 A_73_100869 FALSE EE905367 EE905367 gb|Bos taurus similar to Homo sapiens ATPase, Ca++ transporting, plasma membrane 3 (ATP2B3), transcript variant 1 unmapped Unknown ACTGGGAAGGCCCTCTCTCTAAAGCATTATCTTATACGGAATGGCTTGGTCAACTGTGTT A_73_100870 A_73_100870 FALSE XM_618431 XM_618431 LOC538233 ref|XM_618431 unmapped Bos taurus similar to Homo sapiens slingshot homolog 1 (Drosophila) (SSH1) CTTTTAAAGTTGCCCGCACCAAACACCGCTACTTAAAGCGACAGGAAGGCACAGACACCG A_73_100871 A_73_100871 FALSE XM_864561 XM_864561 LOC511775 ref|XM_864561 unmapped Bos taurus similar to Homo sapiens NOL1/NOP2/Sun domain family, member 6 (NSUN6) GAAAGCAGTAATGGCAGATAAGAAATAGGATTAACATTTGTTTCTTTAACAGACATTTTC A_73_100872 A_73_100872 FALSE NM_001015679 NM_001015679 DC-UbP ref|NM_001015679 unmapped Bos taurus dendritic cell-derived ubiquitin- like protein (DC-UbP) ATACCAGCTTCCAGTCTATTGCTTGGCACCACCAATCAACATGATAGAGGAAAAGAGCGA A_73_100873 A_73_100873 FALSE XM_592634 XM_592634 LOC514738 ref|XM_592634 unmapped Bos taurus similar to Homo sapiens O-sialoglycoprotein endopeptidase-like 1 (OSGEPL1) CAAAATGTCCTCTTGGAGTAGATATATCAAAAGAAGTTGGAGAAGCTGCTATAAAAGTGC A_73_100874 A_73_100874 FALSE XM_585656 XM_585656 LOC508822 ref|XM_585656 unmapped Bos taurus similar to Homo sapiens kynureninase (L-kynurenine hydrolase) (KYNU), transcript variant 1 GGATATCTAACTCTGTGTGCTGTGGCATGTATAAGACTTACTTAATAAAATGCCTAAGAA A_73_100875 A_73_100875 FALSE XM_612592 XM_612592 LOC533250 ref|XM_612592 unmapped Bos taurus similar to Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5) TTTATTTTTTATTCTGATTAGCCATTTTAAACCAACAAGGAATAAAAAGAAATCCTGATC A_73_100876 A_73_100876 FALSE XM_618325 XM_618325 LOC538131 ref|XM_618325 unmapped Bos taurus similar to Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 17 (ADAMTS17) CTCGAAGGATTCGTGTGGTGGAGGATAAACCTGCCCACAGTTTTCTGGGTAAAACAAAAA A_73_100877 A_73_100877 FALSE AW668786 AW668786 gb|Unidentified transcripts on BTA2 position 71849035-71848231 unmapped Unknown AATGTTTCAAGTGGGCCTGTTTAAGATAACTTGAAATACTTACCACAGTTCAAGTAGATG A_73_100878 A_73_100878 FALSE NM_001034034 NM_001034034 GAPD ref|NM_001034034 unmapped Bos taurus glyceraldehyde-phosphate- dehydrogenase (GAPDH) TACGACAATGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGTCCACATGGCCTCC A_73_100879 A_73_100879 FALSE XM_613315 XM_613315 LOC540824 ref|XM_613315 unmapped Bos taurus similar to Homo sapiens B-cell CLL/lymphoma 10 (BCL10) TCCAGATACCTGTCTCATATATATTTCCATTACTTGGAAAAAGCAGAGATGGAAATATGC A_73_100880 A_73_100880 FALSE XM_612410 XM_612410 LOC533114 ref|XM_612410 unmapped Bos taurus similar to Homo sapiens cyclin- dependent kinase-like 2 (CDC2-related kinase) (CDKL2) CTGTCGATTCTGAACTGGATGCTGCTATGGTACCTGAGAGAACATTCTTGTGCAACAGAA A_73_100881 A_73_100881 FALSE XM_589962 XM_589962 LOC512445 ref|XM_589962 unmapped Bos taurus similar to Homo sapiens zinc finger protein 187 (ZNF187), transcript variant 3 GTATAAATTTATAGGTTTAAGCAGAAGAAGAGAGGGTTGATATTTTTGCACATGCTGCAG A_73_100882 A_73_100882 FALSE XM_867453 XM_867453 LOC615596 ref|XM_867453 unmapped Bos taurus similar to Homo sapiens tetraspanin 7 (TSPAN7) CCTCTGTCTCGCATGCCAACAAGAATGCATTGATATTGTGAACATTTGTGATACATGTAT A_73_100883 A_73_100883 FALSE XM_600750 XM_600750 LOC522467 ref|XM_600750 unmapped Bos taurus similar to Homo sapiens wingless- type MMTV integration site family, member 3A (WNT3A) CGAAACAGGATCATTCGGCACGCGAGACCGCACCTGCAACGTGAGCTCGCACGGCATAGA A_73_100884 A_73_100884 FALSE XM_588289 XM_588289 LOC511036 ref|XM_588289 unmapped Bos taurus similar to Homo sapiens ATG16 autophagy related 16-like 2 (S. cerevisiae) (ATG16L2) AGCAAAGGGCAGTGGTTTTGGAGCCGTGGACGTTTCTCCTGTGCTCCAAGATAGTCCTGG A_73_100885 A_73_100885 FALSE XM_587041 XM_587041 LOC539418 ref|XM_587041 unmapped PREDICTED: Bos taurus similar to retinol binding protein 5, cellular (LOC539418) CTGGCGACTCTGGCTGGAGGAAGAGATGTTATATCAGGAAGTGACCGCACGGGATGCAGT A_73_100886 A_73_100886 FALSE XM_866404 XM_866404 LOC535933 ref|XM_866404 unmapped Bos taurus similar to Homo sapiens pantothenate kinase 2 (Hallervorden-Spatz syndrome) (PANK2), nuclear gene encoding mitochondrial protein, transcript variant 3 AAATGTCAGAAGTTACCATTTGATTTGAAAAATCCACACCCTCTGCTGCTCGTGAACATT A_73_100887 A_73_100887 FALSE XM_617991 XM_617991 LOC537806 ref|XM_617991 unmapped Bos taurus similar to Homo sapiens receptor tyrosine kinase-like orphan receptor 1 (ROR1) AGCAGACACTGCAACAAGTATCTTCTGTGAAGTTTAACTGTGTCTTACCAACCAGGGCAG A_73_100888 A_73_100888 FALSE XM_612208 XM_612208 LOC532970 ref|XM_612208 unmapped Bos taurus similar to Homo sapiens T-box 5 (TBX5), transcript variant 1 TGGAGGACATTAGCTGCAATGCCTGGCCCAGTATGTCCTCATACAGCAGCTGCACGGTCA A_73_100889 A_73_100889 FALSE NM_001034662 NM_001034662 PSMA2 ref|NM_001034662 unmapped Bos taurus similar to Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 2 (PSMA2) AGCCCCCTAGAGTCTACTAGATCTTTCTAACTCAAGGATGAACGTGAGTGCTGGAAATAA A_73_100890 A_73_100890 FALSE XM_609973 XM_609973 LOC531476 ref|XM_609973 unmapped PREDICTED: Bos taurus similar to Jun dimerization protein, transcript variant 1 (LOC531476) GACCGACAGCGTCAAGACACCTGAGTCAGAAGGCAACCCTCTGCTTGAGCAGCTTGAGAA A_73_100891 A_73_100891 FALSE XM_592096 XM_592096 LOC514270 ref|XM_592096 unmapped Bos taurus similar to Homo sapiens zinc finger protein 513 (ZNF513) CAGGGGCAGTGGAGGAACTGGCTGGGGGACTGTCCAGCCTCACACCTGTTTATTTAACTT A_73_100892 A_73_100892 FALSE XM_589102 XM_589102 LOC511713 ref|XM_589102 unmapped Bos taurus similar to Homo sapiens PDZ domain containing, X chromosome (FLJ21687) TGAGGTGGTAGGAAGGCCCCAGAAAGAAGATGATCGCATTCCAGATCCTGGGGAGCCAGA A_73_100893 A_73_100893 FALSE XM_863952 XM_863952 LOC613428 ref|XM_863952 unmapped Bos taurus similar to Homo sapiens zinc finger, FYVE domain containing 9 (ZFYVE9), transcript variant 3 AAACACCTATGTATGCTTTACCCAGATTCACCTGTTATTTACAGATTAACTTGTTGGCTT A_73_100894 A_73_100894 FALSE XM_595926 XM_595926 LOC517750 ref|XM_595926 unmapped Bos taurus similar to Homo sapiens leucine rich repeat containing 10 (LRRC10) GCCTGAAGCTGGTCATCTATGACCACAATCCTTGCAGGAATGCACCCAAGGTGGCCAAAG A_73_100895 A_73_100895 FALSE XM_870520 XM_870520 LOC618195 ref|XM_870520 unmapped Bos taurus similar to Homo sapiens leucine- rich repeat LGI family, member 4 (LGI4) TCAATCCGGCCAATCGCTTTTAGTGCCCGCCTTCATGACGTCATCAGTCGCTGGGCAGTT A_73_100896 A_73_100896 FALSE CB456079 CB456079 gb|Bos taurus similar to Homo sapiens glioblastoma amplified sequence (GBAS) unmapped Unknown AGTGCCAATTTTGTGACTGTAATCATGTGAAAGTCCTGTTGAAGTGAAAAATTATGTCTG A_73_100897 A_73_100897 FALSE XM_618393 XM_618393 LOC538197 ref|XM_618393 unmapped Bos taurus similar to Homo sapiens CP110 protein (CP110) TGAGTAGACAAGGGAGTATATGCAGGAAAAATCCAAAGAAAGCGGCCAAATGTTGCGACA A_73_100898 A_73_100898 FALSE NM_001035069 NM_001035069 COG6 ref|NM_001035069 unmapped Bos taurus similar to Homo sapiens component of oligomeric golgi complex 6 (COG6) TCTCTTCATATGATGCCCCTTGCAAAGAATTGTTTGGGCTCTGACTTTGAAACTTGACCA A_73_100899 A_73_100899 FALSE NM_001040513 NM_001040513 LOC510137 ref|NM_001040513 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein LOC155006 (LOC155006) CCCAAGAATGTCAATCACCAAGTTGTGGGTAATAGCAGGAGGGGAGAGCGCTGATGTGGT A_73_100900 A_73_100900 FALSE XM_614177 XM_614177 LOC534416 ref|XM_614177 unmapped Bos taurus similar to Homo sapiens WW domain binding protein 11 (WBP11) CTAAGCTATTAGATAGCTAGAAAAGGCTACTGCTATTGCTGTTTTTGAATTTGTCACTTC A_73_100901 A_73_100901 FALSE XM_585290 XM_585290 LOC508505 ref|XM_585290 unmapped PREDICTED: Bos taurus similar to Transcription factor COE3 (Early B-cell factor 3) (EBF-3) (Olf-1/EBF-like 2) (OE-2) (O/E-2) (LOC508505) CAATGACCAAACAGGATGTTGGTGTAGCTGCTAAACCAGAACCACGCTCTGCCTCTCGCC A_73_100902 A_73_100902 FALSE XM_865060 XM_865060 LOC613864 ref|XM_865060 unmapped PREDICTED: Bos taurus similar to Progestin and adipoQ receptor family member III (LOC613864), partial mRNA. GGTGTATGTCATGCAGTATAGACACAGCAAACCCTGTCCTGACTATGTTTCACATTTGTG A_73_100903 A_73_100903 FALSE BM087854 BM087854 gb|Unidentified transcripts unmapped Unknown TGACTCCGCTGTTTTTCTAAGTCCTGTATCTCGCCTCTGAAATGTCAGGATCCATAGAGA A_73_100904 A_73_100904 FALSE XM_867655 XM_867655 LOC615762 ref|XM_867655 unmapped PREDICTED: Bos taurus similar to Interleukin 1 family member 9 (IL-1F9) (Interleukin-1 homolog 1) (IL-1H1) (Interleukin-1 epsilon) (IL-1 epsilon) (IL-1 related protein 2) (IL- 1RP2) (LOC615762) AGAAACCAGCCCATCTTTCTCACTTCTGAGCTGGGGAACATATACAATACTGCCTTCCAA A_73_100905 A_73_100905 FALSE BF599391 BF599391 gb|Bos taurus similar to Homo sapiens Rho guanine nucleotide exchange factor (GEF) 17 (ARHGEF17) unmapped Unknown TTCTTGCTACCAAACAGTCATGTATTAACTTTCCTTGGATGATGAAGTTTAAAGGGTCAA A_73_100906 A_73_100906 FALSE NM_174455 NM_174455 RPL24 ref|NM_174455 unmapped Bos taurus ribosomal protein L24 (RPL24) TGAAGGTTTCTGCTCCTCGAGTTGGTGGAAAACGCTAAGTCGGCAGATTGGATTTTTGAA A_73_100907 A_73_100907 FALSE BI848712 BI848712 gb|Unidentified transcripts unmapped Unknown TGTAGCCTCCCCCTTCAGGAACATAGCTGGTGGTCAGCAAACCCTTGTCCTTCACACCGT A_73_100908 A_73_100908 FALSE XM_591182 XM_591182 LOC540052 ref|XM_591182 unmapped Bos taurus similar to Homo sapiens muscle, skeletal, receptor tyrosine kinase (MUSK) ATAGAAAACTCCAAAGAAGGAAAAACCATTCATTGTCTCCTCACCCAAAGATGGGTGTTG A_73_100909 A_73_100909 FALSE XM_867977 XM_867977 LOC616014 ref|XM_867977 unmapped Bos taurus similar to Homo sapiens mixed lineage kinase 4 (KIAA1804) ATGAGGAGCAGAGCGAGCCGACCATCTCTGTATGAACTCGAGAAAGAATTTCTGTCTTAA A_73_100910 A_73_100910 FALSE BM286886 BM286886 gb|Unidentified transcripts on BTA1 position 42044280-42045164 unmapped Unknown TGCTAGCTCTTCATTCCCTCCAAGGGGTATGCACTCTTTTTATCCCTGCTCTTGCAAAAA A_73_100911 A_73_100911 FALSE NM_001038038 NM_001038038 ATP6V0B ref|NM_001038038 unmapped Bos taurus similar to Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 1 TGTGTGGCTTCGCACCTGTGTCCCTCCCCCACCTCGTCTTCCCAGTGTTTGTGAAATAAA A_73_100912 A_73_100912 FALSE NM_001024569 NM_001024569 ELF5 ref|NM_001024569 unmapped Bos taurus E74-like factor 5 ESE-2a (ELF5) TGAACCGCAAGATAGACTGAGGGCCTCCATCTTAGAGTTTCACGTCAAAAGTCACTTGTT A_73_100913 A_73_100913 FALSE XM_866927 XM_866927 LOC615187 ref|XM_866927 unmapped PREDICTED: Bos taurus similar to Pituitary adenylate cyclase activating polypeptide precursor (PACAP) (LOC615187) GCTGTTCTAGGGAAAAGGTATAAACAAAGGGTTAAAAACAAAGGACGGCGAATACCGTAT A_73_100914 A_73_100914 FALSE BF046154 BF046154 gb|Bos taurus similar to Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3 (SMARCA3), transcript variant 1 unmapped Unknown CTGCTTCTTTACCCAAGCATTTACAGACTTGTGTTTTTAAACACATTGATGTGACAAGTC A_73_100915 A_73_100915 FALSE CB533923 CB533923 gb|Bos taurus similar to Homo sapiens GTPase activating Rap/RanGAP domain-like 1 (GARNL1), transcript variant 2 unmapped Unknown TTTTTTGAACGAGCATCTCCTAAGGAAATGTAGCATGACATTGGTACTAACTGCATGTGT A_73_100916 A_73_100916 FALSE XM_611441 XM_611441 LOC512547 ref|XM_611441 unmapped Bos taurus similar to Homo sapiens ATPase, Class VI, type 11A (ATP11A), transcript variant 1 TTTCCCTCAGTTTTTATACCAGTTCTTCTGTGGGTTTTCACAGCAGACGCTGTACGACAC A_73_100917 A_73_100917 FALSE XM_597340 XM_597340 LOC519127 ref|XM_597340 unmapped PREDICTED: Bos taurus similar to complement factor H-related protein, transcript variant 1 (LOC519127) CTCTAACAAGCGTGTATGAGTGTACAGATTCCTAGATAAGTGTATAACCAAATAAATGTG A_73_100918 A_73_100918 FALSE AV589859 AV589859 gb|Unidentified transcripts on BTA5 position 39894069-39893302 unmapped Unknown CTGCAGAAGTCCTTTTCTTCCCTTGTTTCTCAAGTGTTGGGGTCTTCTCTGCATGACAAT A_73_100919 A_73_100919 FALSE XM_880972 XM_880972 LOC615251 ref|XM_880972 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 72 (CCDC72) TGCCACCTATAGCTAGAATGAAGTGTTGTCTTGGAACCTATTGTACATTTAAGAATAAAC A_73_100920 A_73_100920 FALSE EE894129 EE894129 gb|Unidentified transcripts on BTA24 position 7975319-7976103 unmapped Unknown CACCTTTGGAAAAGGAATGCAAATAAAGAGCTGTCCCTGGAAACTAAATGTGAATTTCTG A_73_100921 A_73_100921 FALSE EE924484 EE924484 gb|Unidentified transcripts on BTA27 position 25306964-25307608 unmapped Unknown TCCTGGTATCAAGCAGACAAGTCTAGATCCTAAGTGTCAGCTTTCTTCACTGCGCTCTAA A_73_100922 A_73_100922 FALSE XM_610389 XM_610389 LOC531886 ref|XM_610389 unmapped Bos taurus similar to Homo sapiens tripartite motif-containing 71 (TRIM71) GGTCACGCCGGACGGGATGATCGTTGTGGTGGACTTCGGCAACAATCGAATCCTCATCTT A_73_100923 A_73_100923 FALSE XM_867013 XM_867013 LOC615255 ref|XM_867013 unmapped PREDICTED: Bos taurus similar to Glia maturation factor beta (GMF-beta) (LOC615255) AGCTAGCAAAGGCATTTTATTTTTAAATTTTGGTGTATCTCCCATTCGTATGTGCTTTGC A_73_100924 A_73_100924 FALSE XM_585293 XM_585293 LOC508507 ref|XM_585293 unmapped Bos taurus similar to Homo sapiens nebulin (NEB) TGCTTCTGAAACAAGGATGCAATGAAATCCTGCGTCCAGATATGTTGACTGCCCTCTACA A_73_100925 A_73_100925 FALSE NM_173921 NM_173921 IL4 ref|NM_173921 unmapped Bos taurus interleukin 4 (IL4) ACCTCTTGGAAAGGCTAAAGACGATTATGAAGGAGAAATACTCCAAGTGTTGAAGCTGAA A_73_100926 A_73_100926 FALSE AU232185 AU232185 gb|Bos taurus similar to Homo sapiens sterile alpha motif and leucine zipper containing kinase AZK (ZAK), transcript variant 2 unmapped Unknown ATCTTCCATACAAACATGATACAAGATTTTGGCATACGACTTGCTCAGAATAACATTGCG A_73_100927 A_73_100927 FALSE XM_867662 XM_867662 LOC615768 ref|XM_867662 unmapped Bos taurus similar to Homo sapiens ankyrin repeat domain 26 (ANKRD26) AGTAAAAGTTTCCCTACAGGACTGTTTACATGAAGTTTTCATTGTTTCCCATTAAACCTG A_73_100928 A_73_100928 FALSE XM_581991 XM_581991 LOC538683 ref|XM_581991 unmapped Bos taurus similar to Homo sapiens synaptogyrin 4 (SYNGR4) GGATATTCCAGGCCTACCTGGCCTTCCAGGAGCTCCGAAATGATGCCCCGGTCCCCTACA A_73_100929 A_73_100929 FALSE XM_876620 XM_876620 LOC521089 ref|XM_876620 unmapped Bos taurus similar to Homo sapiens cyclin T2 (CCNT2), transcript variant b CACATATTAGCAGGGGAAACCCATTAAGGGAGAAAGCACCAAGGGAGCAATCTTTCCAAA A_73_100930 A_73_100930 FALSE XM_607033 XM_607033 LOC528606 ref|XM_607033 unmapped PREDICTED: Bos taurus similar to Histone- lysine N-methyltransferase, H3 lysine-9 specific 5 (Histone H3-K9 methyltransferase 5) (H3-K9-HMTase 5) (Euchromatic histone-lysine N-methyltransferase 1) (Eu-HMTase1) (G9a-like protein 1) (GLP1) (LOC528606) ATGCCGAAGTCCATCCCGGGCCTGGTGTGCAGTTACACCCCGGAGTTTCTTGGGCGTGTT A_73_100931 A_73_100931 FALSE XM_871772 XM_871772 LOC533187 ref|XM_871772 unmapped Bos taurus similar to Homo sapiens bobby sox homolog (Drosophila) (BBX) TCATGCCTTGAGGATTCTTTTTATTTTCTACACAGGGGTCTGAGTAACCAATGGATCGTT A_73_100932 A_73_100932 FALSE XM_868406 XM_868406 LOC616396 ref|XM_868406 unmapped PREDICTED: Bos taurus similar to Proprotein convertase subtilisin/kexin type 5 precursor (Proprotein convertase PC5) (Subtilisin/kexin-like protease PC5) (PC6) (hPC6) (LOC616396) AAGGCTGAGCTGCCATCCTAGATTTCTTTGTTCCTGTAGACTTATAGATTACTCCATATT A_73_100933 A_73_100933 FALSE NM_174023 NM_174023 CLTC ref|NM_174023 unmapped Bos taurus clathrin, heavy polypeptide (Hc) (CLTC) CTCATTCTTTCAAGAACTGCTTAATACTCAATCTATTGTGAAGAACCTGATTTGCACTCT A_73_100934 A_73_100934 FALSE XM_609769 XM_609769 LOC531278 ref|XM_609769 unmapped Bos taurus similar to Homo sapiens osmosis responsive factor (OSRF) ATGCATTTTCAAGATACCACTTGAAAAGCAAGTTCTCAAATAGTGAATAACTTGATGGCC A_73_100935 A_73_100935 FALSE NM_001034053 NM_001034053 LMNA ref|NM_001034053 unmapped Bos taurus similar to Homo sapiens lamin A/C (LMNA), transcript variant 1 GTTTCCCATCTGCACCCCTTCTCTCCTCCCTGAATCAATACACTAGTTGTTTGCTTACGG A_73_100936 A_73_100936 FALSE XM_581695 XM_581695 LOC505408 ref|XM_581695 unmapped Bos taurus similar to Homo sapiens hypothetical protein DKFZp564O0523 (DKFZP564O0523) ATTTTAGAGGGGCCTTCCATTCAAAGACATCTGGATTTCCTGCAGCCTCTCTGAACACTT A_73_100937 A_73_100937 FALSE XM_604327 XM_604327 LOC525967 ref|XM_604327 unmapped PREDICTED: Bos taurus similar to transcription factor-like nuclear regulator (LOC525967) AAGCATAGAGGGTAGGCTACTTTTAAGAGTAGCTCCTCTTTTCTCTGGATCCGCAGTCAT A_73_100938 A_73_100938 FALSE XM_592546 XM_592546 LOC514660 ref|XM_592546 unmapped PREDICTED: Bos taurus similar to TGF beta receptor associated protein -1 (LOC514660) CTGGCCCTTTACCCTTTAACCCCTGGATGGGTCCGAAATACACAAGATGTACAAATGTAA A_73_100939 A_73_100939 FALSE XM_612098 XM_612098 LOC540563 ref|XM_612098 unmapped PREDICTED: Bos taurus similar to ash1 (absent, small, or homeotic)-like (LOC540563) AATTCCTTGGCTTGGGGCCACTTCTGTCTTCAGAACCAGCAACAATGACATTGAGATCAT A_73_100940 A_73_100940 FALSE XM_877421 XM_877421 LOC614783 ref|XM_877421 unmapped Bos taurus similar to Homo sapiens DAZ associated protein 1 (DAZAP1), transcript variant 2 CTACTGAGTGTGTTTTGTTTTTTGTTTTCTTCTCTGCTTTTGTCGACTGGCGTGCCTGGC A_73_100941 A_73_100941 FALSE XM_868400 XM_868400 LOC615050 ref|XM_868400 unmapped Bos taurus similar to Homo sapiens fibrosin 1 (FBS1) GGTGGGGCTTATTCTGTAACATGACTTGCGGATATTTATATAAAAATGAGTGTTACAAAA A_73_100942 A_73_100942 FALSE XM_617620 XM_617620 LOC537455 ref|XM_617620 unmapped Bos taurus similar to Homo sapiens netrin 4 (NTN4) ACCACAGTGCCATAAGATTAACTTCACATTCAGAACATATGTTTTTCCTGAGGTCCTGTG A_73_100943 A_73_100943 FALSE XM_589690 XM_589690 LOC512220 ref|XM_589690 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 4, subfamily X, member 2 (OR4X2) AGTTTTCTTTATCCACTTCTTTGGTGGCATTGAAATGTTCTTGCTCACTGTGATGGCCTA A_73_100944 A_73_100944 FALSE AU232881 AU232881 gb|Bos taurus similar to Homo sapiens IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L) unmapped Unknown TGTCCCCAAAATGCAGACTTTTGGAAATATGAAAATTTTATTCCCAAATGTCTCAAAGGG A_73_100945 A_73_100945 FALSE XM_600423 XM_600423 LOC522148 ref|XM_600423 unmapped PREDICTED: Bos taurus similar to transglutaminase 6 (LOC522148) AAGCAGCTGGTGCCTCCCCAGGAAATTATTCTAAAAAGAAGAAGTAGAAGCTGCCAGTCT A_73_100946 A_73_100946 FALSE XM_600204 XM_600204 LOC521931 ref|XM_600204 unmapped Bos taurus similar to Homo sapiens potassium channel, subfamily K, member 12 (KCNK12) TGGCGTGCAGCCGGGCGGCGTTTGCTCTCCTCTCAGACGCTGGCGCTTTCTTAACCTTTA A_73_100947 A_73_100947 FALSE NM_001034508 NM_001034508 RABL2A ref|NM_001034508 unmapped Bos taurus similar to Homo sapiens RAB, member of RAS oncogene family-like 2A (RABL2A), transcript variant 2 TTCTTTTAAAATCCGTATTTCATTTTTCTGGGGACTGATGTGGGCTCTGAGCCTCCTTGG A_73_100948 A_73_100948 FALSE NM_001040567 NM_001040567 LOC539474 ref|NM_001040567 unmapped Bos taurus similar to Putative RNA-binding protein 11 (RNA-binding motif protein 11) (LOC539474) ATCTGTATTCTACTAAAGGACCAATTCCATGGCTTTCTTGTCTTCTTTGAAGTATATAGC A_73_100949 A_73_100949 FALSE XM_866703 XM_866703 LOC615019 ref|XM_866703 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 84 (C9orf84) AACCAGCGCAGTTCAAAAAACAACGTCTTGTGTATGAAAAAGTCCCTGGTAGGCTTGACG A_73_100950 A_73_100950 FALSE XM_585919 XM_585919 LOC509038 ref|XM_585919 unmapped Bos taurus similar to Homo sapiens interleukin 20 receptor, alpha (IL20RA) TAACCCTCAAATGTCCCTTTGCCAGACCTCTACTGTTACAAAACATGTCAGTGCAGAGAA A_73_100951 A_73_100951 FALSE NM_173920 NM_173920 IL3 ref|NM_173920 unmapped Bos taurus interleukin 3 (IL3) CTTGGGAATATGTTCATTTGTACTTCAGGTTTGAAACTGAGGTACACATCTGTGAAAATA A_73_100952 A_73_100952 FALSE XM_590603 XM_590603 LOC539971 ref|XM_590603 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, subfamily H (eag-related), member 2 (KCNH2), transcript variant 3 AAGGATCATATGAATAATTAATGAAGATGCTGATGACTATGAATAATAAATAATTATCCT A_73_100953 A_73_100953 FALSE XM_616470 XM_616470 LOC536342 ref|XM_616470 unmapped PREDICTED: Bos taurus similar to kinase non- catalytic C-lobe domain (KIND) containing 1 (LOC536342) AGCTGAAAGCTGTGGAGGTCTTCCTGAAGAGTGACAGCCTGTGTCTGATGGAAGGACGGC A_73_100954 A_73_100954 FALSE NM_001012673 NM_001012673 STAT5A ref|NM_001012673 unmapped Bos taurus signal transducer and activator of transcription 5A (STAT5A) TCAAGGAAGGTGGGGACAAGAAGCAGGATTCTTTTGTACTTTGTACATAGGCTACACATT A_73_100955 A_73_100955 FALSE XM_596999 XM_596999 LOC518798 ref|XM_596999 unmapped Bos taurus similar to Homo sapiens protein tyrosine phosphatase, non-receptor type 14 (PTPN14) TTTTTCCTCTTTCGGGATAACTTGTGATTCATCCTATGGGCAGTTTTCACAATAATATAG A_73_100956 A_73_100956 FALSE XM_583947 XM_583947 LOC538964 ref|XM_583947 unmapped Bos taurus similar to Homo sapiens cytochrome P450, family 8, subfamily B, polypeptide 1 (CYP8B1) ATTCAGGGCCTAGAACAGTGTCATCCGATAGCCATATGAGGCAAGCCACATGTGTAATTT A_73_100957 A_73_100957 FALSE XM_878569 XM_878569 LOC528207 ref|XM_878569 unmapped Bos taurus similar to Homo sapiens FAST kinase domains 2 (FASTKD2) CATGTATTTCGGAGACCTGCTGTTTAGTCTTCATGCTATAGTGAAGCTTGGGATTCCTCA A_73_100958 A_73_100958 FALSE NM_175827 NM_175827 CCL5 ref|NM_175827 unmapped Bos taurus chemokine (C-C motif) ligand 5 (CCL5) CCCCATCTCGGTCCCTCACTGGGGAGGGCTGCACTGGCAAATAAGAAGAAATCAGCTGTT A_73_100959 A_73_100959 FALSE XM_587687 XM_587687 LOC510539 ref|XM_587687 unmapped Bos taurus similar to Homo sapiens golgi associated, gamma adaptin ear containing, ARF binding protein 3 (GGA3), transcript variant short GGTCACTTCGTGACAAAAAACTGTACTGGATATATCAACTGCTGCCCTTGTTTTGCTGCA A_73_100960 A_73_100960 FALSE XM_867775 XM_867775 LOC521244 ref|XM_867775 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical LOC284988 (LOC284988) AACAAGGTATGGTAGTAAAAGTGGACAAAATAACCGCAAGTGAAAATGTTTCCAAAGCCA A_73_100961 A_73_100961 FALSE XM_870028 XM_870028 LOC617718 ref|XM_870028 unmapped Bos taurus similar to Homo sapiens otoancorin (OTOA), transcript variant 1 GATGAATTAAGCTCTGTTGCCACAAAGGTACCTCAATGTTCTATCTTAGAGAAGGCTGAA A_73_100962 A_73_100962 FALSE XM_613692 XM_613692 LOC534063 ref|XM_613692 unmapped PREDICTED: Bos taurus similar to Translation initiation factor eIF-2B gamma subunit (eIF-2B GDP-GTP exchange factor) (LOC534063) TGCCTGAATCTTAGTTGCTGTCATTGGACTAACTCATAGAGAGTAACTGAGCATTCCTCC A_73_100963 A_73_100963 FALSE XM_590159 XM_590159 LOC512613 ref|XM_590159 unmapped Bos taurus similar to Homo sapiens cyclin- dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B) GTCACAAGAGAAATATGTGACTTGCTTTTGTCTTTATCATTTTCATATGCTCTCACACTC A_73_100964 A_73_100964 FALSE NM_001025348 NM_001025348 SPINK1 ref|NM_001025348 unmapped Bos taurus similar to Homo sapiens serine peptidase inhibitor, Kazal type 1 (SPINK1) CTTGCTGAGAACCAAAGTTCTGAAATCCCATAAGTACACTACAATGCATGGCTGGCCTGA A_73_100965 A_73_100965 FALSE XM_604909 XM_604909 LOC526536 ref|XM_604909 unmapped Bos taurus similar to Homo sapiens Crn, crooked neck-like 1 (Drosophila) (CRNKL1) ACATTTTGTGCCTCCATCATTCATTAGGAAATCTAATTCATCTGTTTTAGATGGAACTGC A_73_100966 A_73_100966 FALSE XM_593447 XM_593447 LOC515425 ref|XM_593447 unmapped PREDICTED: Bos taurus hypothetical LOC515425 (LOC515425) TGAAGGCCTTGCAGGAATACATGAACCGACTGGACATGCGGTCGTGACCTCGGATGCTGA A_73_100967 A_73_100967 FALSE NM_001035448 NM_001035448 MORF4L2 ref|NM_001035448 unmapped Bos taurus similar to Homo sapiens mortality factor 4 like 1 (MORF4L1), transcript variant 1 TATTTGTGTCTAATGCACGTTTTAACATGATAGACGCAATGCATTGTGTAGCTACAGTTT A_73_100968 A_73_100968 FALSE AU098098 AU098098 gb|Bos taurus similar to Homo sapiens ubiquitin-conjugating enzyme E2Z (putative) (UBE2Z) unmapped Unknown AGCAGAGCATGTCTGGCATACCAGCCTGACTTTTACGCCCTAAATTTTGAGTTGAGGAAT A_73_100969 A_73_100969 FALSE XM_581912 XM_581912 LOC538672 ref|XM_581912 unmapped Bos taurus similar to Homo sapiens thrombopoietin (myeloproliferative leukemia virus oncogene ligand, megakaryocyte growth and development factor) (THPO), transcript variant 2 TATTTTTTACAGATTGAAGGTTTGTGGCAACCCTGTGTTGTCACATGATGGTTAGCATTT A_73_100970 A_73_100970 FALSE XM_580467 XM_580467 LOC504356 ref|XM_580467 unmapped Bos taurus similar to Homo sapiens protein disulfide isomerase family A, member 2 (PDIA2) GCCTGGTCGGAAGGTGATTGACTACAAAGGCGCCAGGGACCTGGAGACCTTCTCCAAATT A_73_100971 A_73_100971 FALSE XM_588343 XM_588343 LOC511080 ref|XM_588343 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 111 (CCDC111) ACAAGAGTAGCTAATTATGGACACTGACATAACTAGGCTGTAATCTACATGAAGGCAGAT A_73_100972 A_73_100972 FALSE XM_865591 XM_865591 LOC614425 ref|XM_865591 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to CG33096-PB, isoform B, transcript variant 1 (LOC653401) CTTTGACGCGTTCCCCAACATCGAGAAGGTGTCGAAGATCACGTCGCCGGTGCTCATCAT A_73_100973 A_73_100973 FALSE BI538482 BI538482 gb|Unidentified transcripts on BTA28 position 34709046-34708284 unmapped Unknown ATTCCTCTTCCTTTTAAAAGCACCAAGCTCTTACAAACAAATTTGAAAACGTTACAAGGG A_73_100974 A_73_100974 FALSE XM_594080 XM_594080 LOC515964 ref|XM_594080 unmapped PREDICTED: Bos taurus similar to RRN3 RNA polymerase I transcription factor homolog (LOC515964) TGAACTTTTATAAAACACAGTATTTTATCTTGAGGCTCCCAAGAGTGCTATTAGAACTGG A_73_100975 A_73_100975 FALSE NM_181026 NM_181026 SFTPD ref|NM_181026 unmapped Bos taurus surfactant, pulmonary-associated protein D (SFTPD) TAAAATAGTGACCCTCTACTGGCCAGGGCTTCTCCACAGAGCCACAGGATAAGGCCAGAG A_73_100976 A_73_100976 FALSE XM_879418 XM_879418 LOC534092 ref|XM_879418 unmapped Bos taurus similar to Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 3 AGGAGCTGACGGTTCATCTCTCTGTCCCCGGGGATACCATCCTCATCAACAACCGCCCAG A_73_100977 A_73_100977 FALSE XM_866254 XM_866254 ADAM1 ref|XM_866254 unmapped PREDICTED: Bos taurus a disintegrin and metalloproteinase domain 1 (ADAM1) TTTTTTGTGTCTGCACGTTTTGTAAAGAGGACCAAGGAGCAGCTGCTGAATCAAAAGAGG A_73_100978 A_73_100978 FALSE NM_174186 NM_174186 SNCG ref|NM_174186 unmapped Bos taurus synuclein, gamma (breast cancer-specific protein 1) (SNCG) CTTATCCCTGTCCACCACCCTCTGATCTTTCTGATCCCCACAGATGCTACTGTGAATTTT A_73_100979 A_73_100979 FALSE XM_865332 XM_865332 LOC614455 ref|XM_865332 unmapped Bos taurus similar to Homo sapiens retinol saturase (all-trans-retinol 13,14-reductase) (RETSAT) ATATGGAAAAATACTTATCGTTGGACCAAATAAGCTTTAAAGAAATAAATCATCATCAAA A_73_100980 A_73_100980 FALSE XM_864972 XM_864972 LOC613821 ref|XM_864972 unmapped Bos taurus similar to Homo sapiens microtubule-associated protein 9 (MAP9) AGAAAAGAGCTGCTAAGAGAGAAGAAGCCTTAGCATCATTTGAGGCCTGGAAAGCCATGA A_73_100981 A_73_100981 FALSE XM_876435 XM_876435 LOC506947 ref|XM_876435 unmapped Bos taurus similar to Homo sapiens methyltransferase like 8 (METTL8) TCCAAGGAAAGTCACAAGACCAAGGCAAAGGCCTATTTTTTGTTTTGTTATTGTCTGTTG A_73_100982 A_73_100982 FALSE XM_606484 XM_606484 LOC528075 ref|XM_606484 unmapped Bos taurus similar to Homo sapiens ring finger protein 17 (RNF17) TATATGAAGATAAACAGTATCCAATTCATATGTCATTAGTAGAAATGGGGCTTGCAGACC A_73_100983 A_73_100983 FALSE AW315177 AW315177 gb|Unidentified transcripts on BTA1 position 34676433-34677199 unmapped Unknown CTGTGCTGTAATGGTTTCACAGGCTATGTGTCCAGTAGATGATGAGCTCTGTAGACTCTA A_73_100984 A_73_100984 FALSE EE909002 EE909002 gb|Bos taurus similar to Homo sapiens mastermind-like 2 (Drosophila) (MAML2) unmapped Unknown TTTTCTCCCTCAGGGCAGAGCACTGTATCAGAGAAAGAGTTCCTGCTGAATTGTAACAGA A_73_100985 A_73_100985 FALSE BI538914 BI538914 gb|Unidentified transcripts on BTA8 position 49495142-49496116 unmapped Unknown TCGGTTTCTCCATCTGTGAAAGTGGTGTAATACTTATCTACCTCCCTTGAATGTTGTAAA A_73_100986 A_73_100986 FALSE XM_587740 XM_587740 LOC539501 ref|XM_587740 unmapped Bos taurus similar to Homo sapiens helicase with zinc finger (HELZ) CTGAATCACGTCCTGGCATTGTTTATCCCAATCCCAAATTTCATCGCAAAGATAATCTCA A_73_100987 A_73_100987 FALSE XM_589029 XM_589029 LOC511650 ref|XM_589029 unmapped Bos taurus similar to Homo sapiens angiogenic factor with G patch and FHA domains 1 (AGGF1) CACCCTCCTTGGTCAATCTCAGATTATTACTATCAGACATACTATAATGAAGCTAATCTT A_73_100988 A_73_100988 FALSE NM_174727 NM_174727 MYH7 ref|NM_174727 unmapped Bos taurus myosin, heavy polypeptide 7, cardiac muscle, beta (MYH7) CAACTGAAGCTCCCAGTCCCGGAGCCTGGAGAGCTGCCCCTTTGGAAGAAGCAGAATAAA A_73_100989 A_73_100989 FALSE XM_871019 XM_871019 LOC618694 ref|XM_871019 unmapped PREDICTED: Bos taurus similar to Tissue factor pathway inhibitor precursor (TFPI) (Lipoprotein-associated coagulation inhibitor) (LACI) (Extrinsic pathway inhibitor) (EPI) (LOC618694) ACTAACCAGACACAGCTGCAACGCCAAGTCCAGGTTCTGGGATTTTTTATATGGTAGCTA A_73_100990 A_73_100990 FALSE NM_001037616 NM_001037616 HMGB2 ref|NM_001037616 unmapped Bos taurus similar to Homo sapiens high- mobility group box 2 (HMGB2) TTGTGTATGGTAGCACAGCAAACTCATAGAAATTAGCATCAATAGCAACTTTTGGGTTTT A_73_100991 A_73_100991 FALSE XM_878681 XM_878681 LOC614918 ref|XM_878681 unmapped Bos taurus similar to Homo sapiens high mobility group nucleosomal binding domain 4 (HMGN4) CTCCACCTTCAACATCAACAAACTTTTCTTCCTTGGAGTATCTTGGCTATTCTTAGCCAA A_73_100992 A_73_100992 FALSE AW658590 AW658590 gb|Bos taurus similar to Homo sapiens protein tyrosine phosphatase, receptor type, O (PTPRO), transcript variant 4 unmapped Unknown TTTCCTGATTAACACTTCAGTGTTTCTTCCTTGCCCCTCTTGGACTAATATCACTGTTCA A_73_100993 A_73_100993 FALSE XM_587626 XM_587626 LOC510486 ref|XM_587626 unmapped Bos taurus similar to Homo sapiens transmembrane and coiled-coil domain family 1 (TMCC1), transcript variant 2 GTTGCTGCCAGTTCTCAGCAGCACTTTTACTGTACATACGAATTTGAAATAAAGACCTCA A_73_100994 A_73_100994 FALSE AW430258 AW430258 gb|Bos taurus similar to Homo sapiens v-ski sarcoma viral oncogene homolog (avian) (SKI) unmapped Unknown GTTTTTCCAGAGTTGTGTTTTCCAGTCATTTCTTCAAGGGAAACTAAATGATTTAGTTGG A_73_100995 A_73_100995 FALSE NM_001034452 NM_001034452 PP2447 ref|NM_001034452 unmapped Bos taurus similar to Homo sapiens TraB domain containing (TRABD) CATGGGCCACGTCCCTGGCATTGAGAAGAACTGGACCACTGACCTCAACATCCAGGAGAT A_73_100996 A_73_100996 FALSE CB463655 CB463655 gb|Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family F (with FYVE domain) member 1 (PLEKHF1) unmapped Unknown TGCAAGTGACAGAAACCCTATCCATAATACTTAATAATAAAAAGAAAGTTTATTCACTCA A_73_100997 A_73_100997 FALSE NM_174732 NM_174732 PFDN5 ref|NM_174732 unmapped Bos taurus prefoldin 5 (PFDN5) GTCTGTGTTTAATGCTAATAAATGAGCCAGCTGGGCAGAGTGGTGGTCTTTTCTTGCATT A_73_100998 A_73_100998 FALSE XM_872221 XM_872221 LOC540947 ref|XM_872221 unmapped Bos taurus similar to Homo sapiens synovial sarcoma translocation, chromosome 18 (SS18), transcript variant 2 GACAGCCTTATTGTGACTGAAATGCTTTTAGGTTCTGTGCCAATTTTCCACCACTGTGTA A_73_100999 A_73_100999 FALSE XM_601726 XM_601726 LOC523427 ref|XM_601726 unmapped Bos taurus similar to Homo sapiens GINS complex subunit 1 (Psf1 homolog) (GINS1) CCCACTGCTTAAAAATTGAGACATTATTTAACCAGGAATGCTTGGTGGAGGAGTATGGTT A_73_101000 A_73_101000 FALSE EE911190 EE911190 gb|Unidentified transcripts unmapped Unknown TGGGTAAATTTTAGTCCTGCAGGCTGAAGTGAACACAAAATCAGGTTTTGCAACCTCTCC A_73_101001 A_73_101001 FALSE XM_582437 XM_582437 LOC506046 ref|XM_582437 unmapped Bos taurus similar to Homo sapiens hypothetical protein MDS025 (MDS025) TCTTGGAACACTGCCTGGATGGATTTACTCTGAACATTCAGTAGGAACTGAATACACGAT A_73_101002 A_73_101002 FALSE XM_586833 XM_586833 LOC509794 ref|XM_586833 unmapped Bos taurus similar to Homo sapiens tescalcin (TESC) GCTCATCTCGTTTTCCCGCAGGGTATGGTGTGTGGGACTTTGGTGTTTTTATCTCTAATA A_73_101003 A_73_101003 FALSE XM_869919 XM_869919 LOC506376 ref|XM_869919 unmapped PREDICTED: Bos taurus similar to heterogeneous nuclear ribonucleoproteins methyltransferase-like 2 (LOC506376) TGGACCCCAAGCAGCTGGTCATCAACCTGCCTCATAAAGGAAGTGGACATCTACACGGTC A_73_101004 A_73_101004 FALSE XM_870871 XM_870871 LOC618538 ref|XM_870871 unmapped Bos taurus similar to Homo sapiens SAPS domain family, member 1 (SAPS1) AAATAAAGGACAGTTTAAGACTAGTGCTGCTCAGACTTCGAGTTTGAGGTCATGGGGTTG A_73_101005 A_73_101005 FALSE CB169993 CB169993 gb|Unidentified transcripts unmapped Unknown TAGCAAATAGCCCTAGGATTCTAATCTTCCCATGCAGCTGTCCTCCAGTACTTATTGGTA A_73_101006 A_73_101006 FALSE XM_607095 XM_607095 LOC528665 ref|XM_607095 unmapped Bos taurus similar to Homo sapiens melatonin receptor 1B (MTNR1B) AATACAAGAGGATCATCTCTGCCCTCTGGAACCCACGGCGCTGCCTGCAGAACTCTTCCA A_73_101007 A_73_101007 FALSE NM_174379 NM_174379 LAMR1 ref|NM_174379 unmapped Bos taurus laminin receptor 1 (ribosomal protein SA, 67 kDA) (LAMR1) TCCAGACACTTGCAGAACTTCCACAAACTTCCACCAAAATGGAAATTTGGTTGATGGAAA A_73_101008 A_73_101008 FALSE CB428907 CB428907 gb|Bos taurus similar to PREDICTED: Homo sapiens KIAA0459 protein (KIAA0459) unmapped Unknown TGTGTTTTTAATCTTCAACACTTGGTGCAATAGAAGCTGCAAAGATGTGCCACTTTATCT A_73_101009 A_73_101009 FALSE BE589840 BE589840 gb|Bos taurus similar to PREDICTED: Homo sapiens sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1, transcript variant 7 (SVEP1) unmapped Unknown AACTCATGTAGAAAATGCAATTGCCCGAGGCGTACATTATCAGTATGGGGGACGTGATCA A_73_101010 A_73_101010 FALSE U83013 U83013 gb|Unidentified transcripts on BTA5 position 70818131-70817337 unmapped Unknown AGAATTGACGTGTCATGGGCCTGGGGTTTTATTTGGTTTTGTTTTTTCAGACTGCAGACT A_73_101011 A_73_101011 FALSE NM_174163 NM_174163 RAC1 ref|NM_174163 unmapped Bos taurus rho family, small GTP binding protein Rac1 (RAC1) ACATTGATCTTTTGCTAACGCGATTAGCAGTATGTTTTGCATGTATGACTTAATAAACCC A_73_101012 A_73_101012 FALSE XM_583923 XM_583923 LOC538960 ref|XM_583923 unmapped PREDICTED: Bos taurus similar to coiled-coil domain containing 13 (LOC538960) CTGGTCCCGTGAGCATCATGTTGCTTGTTCTGGGTCAGGCTCCAGATCCAGTAACGTCCT A_73_101013 A_73_101013 FALSE XM_613666 XM_613666 LOC540914 ref|XM_613666 unmapped Bos taurus similar to Homo sapiens metallophosphoesterase domain containing 2 (MPPED2) TTTTCTCAAAGGCCACGCCATTGTAAATTGTTAGTGTTCGCCAAAGGACAGCCAAGCTTT A_73_101014 A_73_101014 FALSE NM_174312 NM_174312 EPB42 ref|NM_174312 unmapped Bos taurus erythrocyte membrane protein band 4.2 (EPB42) CAACAGAAAAAGCACTCATTTCTGTCACCCCAGCTCAAAGCATCTATGAAGACTAGTTGT A_73_101015 A_73_101015 FALSE XM_612455 XM_612455 LOC533146 ref|XM_612455 unmapped PREDICTED: Bos taurus similar to SH3 multiple domains 2 (LOC533146), partial mRNA. AAGAAGCTCAACTGAGCTTGAGCCTTATAACTTAGATAAGGCAGTTGAGACCATTAAAAA A_73_101016 A_73_101016 FALSE CB171384 CB171384 gb|Bos taurus similar to Homo sapiens L antigen family, member 3 (LAGE3) unmapped Unknown ATCATCTAAGAAATGGAGGAGGATAGGTCCTGTCTCTCATTCAGTATTAGCTACTATCAA A_73_101017 A_73_101017 FALSE AW655010 AW655010 gb|Unidentified transcripts unmapped Unknown GGCAACCTGTGATTGCGTTTCCTCAGTCATAATAAAAATACGTGCATTTGGCAACGCGTC A_73_101018 A_73_101018 FALSE XM_591156 XM_591156 LOC513471 ref|XM_591156 unmapped Bos taurus similar to Homo sapiens melanoma associated antigen (mutated) 1 (MUM1) ATCTGTTCTGAGGTCTGCTTGTGGAACTGAACTGTTGAGACTGGAATTAAAGGCCGTTTT A_73_101019 A_73_101019 FALSE NM_174130 NM_174130 ODC1 ref|NM_174130 unmapped Bos taurus ornithine decarboxylase (ODC1) CACCAATGTGGAAGACTGGGAGATGGGGTCACACTTATCTGTGTTCCTATGGAAACTATT A_73_101020 A_73_101020 FALSE EE896447 EE896447 gb|Unidentified transcripts on BTA22 position 27570483-27569388 unmapped Unknown ACAGAGGGTTGAGAGATATGCATGCCACATCTACAGTTCTCAGCCTTTCATCTCCATCAA A_73_101021 A_73_101021 FALSE CB170971 CB170971 gb|Bos taurus similar to Homo sapiens caveolin 2 (CAV2), transcript variant 2 unmapped Unknown GGAAGAGGTGGGTGATGGTGGGACTTTCCCAGTATCTATAATAAACTTTTTAAAACTAAA A_73_101022 A_73_101022 FALSE NM_174028 NM_174028 CSF3 ref|NM_174028 unmapped Bos taurus colony stimulating factor 3 (granulocyte) (CSF3) TCTGGGGTCCCACAAATTTGCTGGGGAAACTTCGTCAAGACTTTTTTCAAGCACATTTTG A_73_101023 A_73_101023 FALSE NM_174040 NM_174040 DPP6 ref|NM_174040 unmapped Bos taurus dipeptidylpeptidase VI (DPP6) ATCTGGCAGGAGGGAGTGAAGTGTGGCATGGTAGTGTGTTCATCCATGGAATAAAACATT A_73_101024 A_73_101024 FALSE EE908139 EE908139 gb|Unidentified transcripts on BTA7 position 50866332-50865175 unmapped Unknown CATAGAGAAGTGTTCACCCATCTATTGTTAAGTTAATAAGCAGTCTAAAAATTGGCATGC A_73_101025 A_73_101025 FALSE XM_595134 XM_595134 LOC516972 ref|XM_595134 unmapped PREDICTED: Bos taurus similar to thyroid hormone receptor interactor 12 (LOC516972), partial mRNA. TTCCAGGGTCTTCTAAGTCAGAAACATCCAAACCTGGACCTTCTGGATTACAGGCCAAAT A_73_101026 A_73_101026 FALSE CB168484 CB168484 gb|Unidentified transcripts on BTA13 position 27646036-27645426 unmapped Unknown TCACCCTGGATGATAAATCCACCTTCGCAGAGTCAGTGTATTTTGTGTGAACCTGTACAG A_73_101027 A_73_101027 FALSE BF606770 BF606770 gb|Bos taurus similar to Homo sapiens glioma tumor suppressor candidate region gene 1 (GLTSCR1) unmapped Unknown TTTTTTAAAAGGAGAATTCTGTACATTTAGAACTCTTGTAAATTAAAAAGCGATCCTTTT A_73_101028 A_73_101028 FALSE AW356133 AW356133 gb|Bos taurus similar to Homo sapiens nucleoporin like 1 (NUPL1), transcript variant 3 unmapped Unknown GATAAGTGGTGTGATGTAGCAGAGCCTAATAGTAGAACTCAATTATCACTTTTTGTGAAC A_73_101029 A_73_101029 FALSE EE927493 EE927493 gb|Unidentified transcripts on BTA14 position 45337625-45336931 unmapped Unknown ACACTAGTGTGTAAAATAAGGATTAGTACAGTACGTCTCATTACTTTTAATTCAGGGCAC A_73_101030 A_73_101030 FALSE XM_598706 XM_598706 LOC520462 ref|XM_598706 unmapped Bos taurus similar to Homo sapiens SH3-domain binding protein 4 (SH3BP4) TTTTTTCCTCAGGGGCTTTAAATAGTTTCCTATGCAACGTGTCTTGTAGCACAAATTCAA A_73_101031 A_73_101031 FALSE NM_001034779 NM_001034779 MAPKAPK3 ref|NM_001034779 unmapped Bos taurus similar to Homo sapiens mitogen- activated protein kinase-activated protein kinase 3 (MAPKAPK3) GGGAGGACAACACTGCTGGGTTTTATATCCAGGTATTAATAAAGAGCATTTTGGCATTTT A_73_101032 A_73_101032 FALSE AV601804 AV601804 gb|Unidentified transcripts on BTAX position 8832836-8833625 unmapped Unknown AGAGACATCAAAGAAGAAATGTAGTCTAGGGGTATTGGAAGAGGGATGCCTGCTTTCCCA A_73_101033 A_73_101033 FALSE CB451256 CB451256 gb|Bos taurus similar to Homo sapiens dipeptidyl-peptidase 10 (DPP10), transcript variant 1 unmapped Unknown CCAGAGGCTCGGTGGATCAATGGTATGTATGTATGTTCTTATACATCATGTTTATTTCAT A_73_101034 A_73_101034 FALSE AW437510 AW437510 gb|Unidentified transcripts on BTA7 position 43761484-43762526 unmapped Unknown CAATGGGAAAACTGAAGGAGACTGACATTTTTCTCAACAGGAATCCATACTTAACAGTTC A_73_101035 A_73_101035 FALSE AV590014 AV590014 gb|Bos taurus similar to Homo sapiens casein kinase 1, epsilon (CSNK1E), transcript variant 1 unmapped Unknown AAGTGAGGAGGAGCCCCCATCGGACCAGTATTTGCTTAGTGTCTTCACTGTATTTTCTTT A_73_101036 A_73_101036 FALSE NM_174530 NM_174530 CYP2E1 ref|NM_174530 unmapped Bos taurus cytochrome P450 subfamily IIE polypeptide 1 (CYP2E1) CACTTTAACTTGAAGTCACTTGTTGACCCCAAGGATATCGACCTCAGCCCCATTGCAATT A_73_101037 A_73_101037 FALSE CB166967 CB166967 gb|Bos taurus similar to Homo sapiens neighbor of BRCA1 gene 1 (NBR1), transcript variant 3 unmapped Unknown AGTCGTATTGTAAGGGTCCAGTCGTCTGTCCCATTGTACTTGTACGTAACCGCTTAAAGA A_73_101038 A_73_101038 FALSE NM_182786 NM_182786 FOS ref|NM_182786 unmapped Bos taurus murine FBJ osteosarcoma viral (v-fos) oncogene homolog (FOS) CCTTGAGGTCTTTTGACATGTGGAAAGTGAACTTGAATGAAAAATTTAAGCATTGTTTGC A_73_101039 A_73_101039 FALSE XM_592955 XM_592955 LIPE ref|XM_592955 unmapped Bos taurus similar to Homo sapiens lipase, hormone-sensitive (LIPE) ATCGTCAAGAATCCCTTCATGTCACCGCTGCTGGCACCCAACAGCATGCTGCAGACTCTG A_73_101040 A_73_101040 FALSE XM_870026 XM_870026 LOC617716 ref|XM_870026 unmapped PREDICTED: Bos taurus similar to transmembrane protease, serine 9 (LOC617716) CGGAACTTGTGACTTTGGGCCCGCTCCAGTGTCCATAGAGGCTGGGCTTTGTGTTACCAT A_73_101041 A_73_101041 FALSE XM_870472 XM_870472 LOC618146 ref|XM_870472 unmapped PREDICTED: Bos taurus similar to ubiquitin- conjugating enzyme E2R 2 (LOC618146) GCCGGCTGGAACTACCCCAGAGGGCAGAGTGACCTGCACTTATGGGATTGGACCTTTTTT A_73_101042 A_73_101042 FALSE BE667105 BE667105 gb|Unidentified transcripts on BTA1 position 57030696-57029828 unmapped Unknown TTTGATGTATGTTTGCTCAACTATGCAGCTTCTTTAGAAAACTGTAAATTACTGGTTGGG A_73_101043 A_73_101043 FALSE NM_001034431 NM_001034431 EPB49 ref|NM_001034431 unmapped Bos taurus similar to Homo sapiens erythrocyte membrane protein band 4.9 (dematin) (EPB49) CATCGCTTCCGCCCATGCCCGTGCACGCCCCACCATGCTTTCTAAAGAATGTAATTTATT A_73_101044 A_73_101044 FALSE XM_864248 XM_864248 LOC511673 ref|XM_864248 unmapped Bos taurus similar to Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA) TGTCCCCAGGACTAGCAGCAGACCTGTTGTTGAAAGCTTTTAAAAGCAGACACGAATGAA A_73_101045 A_73_101045 FALSE CB462624 CB462624 gb|Unidentified transcripts unmapped Unknown TATGGATTTACATAGCATCTTTAATTACATAGATCTTTAATAAATGATCATTAAAAGAGA A_73_101046 A_73_101046 FALSE XM_863898 XM_863898 LOC504236 ref|XM_863898 unmapped Bos taurus similar to Homo sapiens leukocyte receptor cluster (LRC) member 4 (LENG4) CGCTCCTGTAGCCTCCTGTCATCCTCGGGCCTGAGACAGGCTCAGAATGTGTAAATCTCT A_73_101047 A_73_101047 FALSE AW657670 AW657670 gb|Bos taurus similar to Homo sapiens solute carrier family 12, (potassium-chloride transporter) member 5 (SLC12A5) unmapped Unknown GCTCCCATTTAATGCTATATAGCTTTTACTGTATTAATTTTTTAGACTCCCGTCTGCACA A_73_101048 A_73_101048 FALSE XM_598917 XM_598917 LOC520669 ref|XM_598917 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 62 (C2 domain containing), member A (FAM62A) GCAGAGAATCCCACCTACCCATCAGGTGTTTATTCCAAGTGTCAAAAGCCTTTGTTCAGT A_73_101049 A_73_101049 FALSE XM_879785 XM_879785 LOC506776 ref|XM_879785 unmapped Bos taurus similar to Homo sapiens leucine- zipper-like transcription regulator 1 (LZTR1) CCCTATTTATTGTCAATAGGCTTGCCTCCATTAAAGCCACAGCAACGCTACCTGCAAAAA A_73_101050 A_73_101050 FALSE NM_176662 NM_176662 PRKCSH ref|NM_176662 unmapped Bos taurus protein kinase C substrate 80K-H (PRKCSH) ACCATGATGAGCTCTAGCCCTGCCCTGCCCTGCCCAGTGCAGAGAAATCAAGATGTGGAA A_73_101051 A_73_101051 FALSE XM_616125 XM_616125 LOC536007 ref|XM_616125 unmapped Bos taurus similar to Homo sapiens centrosomal protein 110kDa (CEP110) TAGAACAATCAACTCTACAAACAGAACTTGAGAAAGAAAAACAAGCCCTCAAGAACGCCC A_73_101052 A_73_101052 FALSE XM_616231 XM_616231 LOC536110 ref|XM_616231 unmapped Bos taurus similar to Homo sapiens doublecortin and CaM kinase-like 2 (DCAMKL2), transcript variant 1 GGTGAGCCTGTAGTTCCTTCTCACTGTTAGACTTTTGCCCCCTACAAGTGTATCCAATAA A_73_101053 A_73_101053 FALSE CB441730 CB441730 gb|Bos taurus similar to Homo sapiens NK2 transcription factor related, locus 2 (Drosophila) (NKX2-2) unmapped Unknown TGCAAACATTTCTCAAATGTGACAAAAGAAAAACATAATGTAGGCGAGCGAGAAGGCCCC A_73_101054 A_73_101054 FALSE NM_001038091 NM_001038091 MGC134096 ref|NM_001038091 unmapped Bos taurus similar to Homo sapiens methionine- tRNA synthetase (MARS) ACTTATCATAGAAAGTCACTTTAATGGATATGGACAATAATAAATAAATGTACAATCTAA A_73_101055 A_73_101055 FALSE XM_867368 XM_867368 LOC615252 ref|XM_867368 unmapped Bos taurus similar to Homo sapiens nucleolar protein 12 (NOL12) GGCCAAGTGTGGGGCGTCTGGCCAAATGTGAACCTCCCTGGACCTTCATCAGATTTGTGA A_73_101056 A_73_101056 FALSE NW_930042 NW_930042 gb|Putative orthologue of human miRNA hsa-mir-495 on chr 14, (+) strand. Mature length 23 nt, stem-loop length 82 nt. Source: NW_930042.1:547368-547448 unmapped Unknown AAACAAACATGGTGCACTTCTTTTATCCTACTATACGTATCACAT A_73_101057 A_73_101057 FALSE XM_586187 XM_586187 LOC509260 ref|XM_586187 unmapped Bos taurus similar to Homo sapiens deformed epidermal autoregulatory factor 1 (Drosophila) (DEAF1) CGTGTACATATATGTGTCTTGTCAATAAAGTCAATACCCCTGTCCCACCTGGACAGGTGA A_73_101058 A_73_101058 FALSE XM_602611 XM_602611 LOC524289 ref|XM_602611 unmapped Bos taurus similar to Homo sapiens oculocutaneous albinism II (pink-eye dilution homolog, mouse) (OCA2) AAGGAAAGTAGATCTGAATGGGCAGATGGAAGATACTTAGCTCTGTCCATCATTTTTGTT A_73_101059 A_73_101059 FALSE XM_601920 XM_601920 LOC523618 ref|XM_601920 unmapped Bos taurus similar to Homo sapiens immediate early response 5 (IER5) TGGGGGAACTGACAAGGTTTTTGTACAGTATTTTCTCCTTCGTTGTATTGACTTTTGTAT A_73_101060 A_73_101060 FALSE XM_870738 XM_870738 LOC618408 ref|XM_870738 unmapped Bos taurus similar to Homo sapiens glutathione S-transferase, C-terminal domain containing (GSTCD), transcript variant 1 AACATGGCTTCTCTGTTCAAGTGATATCCATGGAGCCAGAGAGCTGCTCTCCCAAAAATA A_73_101061 A_73_101061 FALSE XM_582280 XM_582280 LOC505916 ref|XM_582280 unmapped Bos taurus similar to Homo sapiens spermidine synthase (SRM) TAGCGGGTGGACTGTCTGTCTTCCTCTGGGTGGCATTCAGCCACCAAACCTATACCAGCT A_73_101062 A_73_101062 FALSE BM288215 BM288215 gb|Bos taurus similar to Homo sapiens germ cell associated 2 (haspin) (GSG2) unmapped Unknown CTTTTGAGGAAATCCTGCCAGAAATCATCATCTCCAAAGAGCTGAGCCTCTTGTCTGATG A_73_101063 A_73_101063 FALSE XM_870211 XM_870211 LOC617881 ref|XM_870211 unmapped Bos taurus similar to Homo sapiens coagulation factor XIII, A1 polypeptide (F13A1) ATCCGCACCAGCCGAAACCCCGAAACGGACACATACATTCTCTTCAACCCTTGGTGTGAA A_73_101064 A_73_101064 FALSE XM_604673 XM_604673 LOC526306 ref|XM_604673 unmapped PREDICTED: Bos taurus similar to Exocyst complex component Sec6 (rSec6) (LOC526306) TGCATGGCATGGCACTATCAGAACTGAGTGCCTTCCTGAGGAGGTCTGACCCACTCCCAA A_73_101065 A_73_101065 FALSE XM_880490 XM_880490 LOC512534 ref|XM_880490 unmapped Bos taurus similar to Homo sapiens histocompatibility (minor) 13 (HM13), transcript variant 1 AGACTTTTGTATTGTGGACTGACTTTGCCTCACATTAAAAACTCATCCCGTTGCCTGGGC A_73_101066 A_73_101066 FALSE NM_001015570 NM_001015570 LGALS9 ref|NM_001015570 unmapped Bos taurus lectin, galactoside-binding, soluble, 9 (galectin 9) (LGALS9), transcript variant 2 GAAGCCTGCCACGAGGGATGCCCTTCTTCCGAGGCCAGAGCTTCTCGGTGTGGATCATGT A_73_101067 A_73_101067 FALSE XM_587025 XM_587025 LOC509955 ref|XM_587025 unmapped Bos taurus similar to Homo sapiens trafficking protein particle complex 2-like (TRAPPC2L) CAAGATTCATCCTCTAAAGATAGGGAGCAGAAAACTAGGCAGTGTCTGGGTCTTTGCTGA A_73_101068 A_73_101068 FALSE XM_596498 XM_596498 LOC518310 ref|XM_596498 unmapped PREDICTED: Bos taurus similar to tripartite motif-containing 35 isoform 1 (LOC518310) GTGCATCCAGCAATCGGTCCCATTTCCTTCCTGTCCCTTCCCAAAGCCACGCTTGCCTTG A_73_101069 A_73_101069 FALSE XM_584340 XM_584340 LOC507682 ref|XM_584340 unmapped Bos taurus similar to Homo sapiens bone morphogenetic protein 5 (BMP5) GCTATTTATGTGGGCTCCACAGCTAGGATTATTTACAGTTCATCTAAAATACTCATAAAG A_73_101070 A_73_101070 FALSE XM_609171 XM_609171 LOC530695 ref|XM_609171 unmapped PREDICTED: Bos taurus similar to CXXC finger 6 (LOC530695) AACTGAAAAAGAAGCCATCTGTCATTGTGTCTTTGGAGGTAAGCAAATACCCAAAGGGCT A_73_101071 A_73_101071 FALSE XM_585294 XM_585294 LOC508508 ref|XM_585294 unmapped Bos taurus similar to Homo sapiens nucleosome assembly protein 1-like 5 (NAP1L5) TTTTAGGAGACACATTTAATGTAAAGACTCTTAGCTTCTTTGTGGGTTTTGAACTGTGTG A_73_101072 A_73_101072 FALSE CB439387 CB439387 gb|Unidentified transcripts on BTA22 position 24286682-24287328 unmapped Unknown TTCCTTGTCAGCTCTTTATGCAACTGCACATCAGACCGTACACCCTGAGTTTTGCCATAT A_73_101073 A_73_101073 FALSE AW631621 AW631621 gb|Bos taurus similar to Homo sapiens adenosine monophosphate deaminase (isoform E) (AMPD3), transcript variant 1 unmapped Unknown CACCACACGGTGAAATCTCTCCTTTACCTAATATGCAGACCTCTTCAGTATGTACCTGGT A_73_101074 A_73_101074 FALSE XM_870575 XM_870575 LOC618245 ref|XM_870575 unmapped Bos taurus similar to Homo sapiens acyl- Coenzyme A binding domain containing 6 (ACBD6) CTCCAGTGGTGGAAGAAAACTGCAAAAATGACACGTCTTTTGCCGCCCATCTTTGGTATA A_73_101075 A_73_101075 FALSE XM_581102 XM_581102 LOC504908 ref|XM_581102 unmapped Bos taurus similar to Homo sapiens dolichyl pyrophosphate phosphatase 1 (DOLPP1) AGATCTGGCCTGCATGATGCCTTGCAGGATGGATGGAATGACAGGCAGGGACGAAGCAGA A_73_101076 A_73_101076 FALSE NM_001035500 NM_001035500 MRPS34 ref|NM_001035500 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein S34 (MRPS34), nuclear gene encoding mitochondrial protein TCCCCGCCAACTTGTCGAGGATTTACGTTTTCGTAGAAAGGGTGCGGTCTGCACCCTGGT A_73_101077 A_73_101077 FALSE XM_868162 XM_868162 LOC616194 ref|XM_868162 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 41 (C1orf41) TAGTGTTTCTGCGGAGGGAGTAGCAGTCTCAAATCTTTCTTAGTAATTATAATATACCCA A_73_101078 A_73_101078 FALSE EE910003 EE910003 gb|Unidentified transcripts on BTA5 position 65293316-65292738 unmapped Unknown TTTTTCTGTACATAAGCCCAAACATACAGACCTCTATCACCTCTTGTTCGACACTGAGGT A_73_101079 A_73_101079 FALSE XM_864297 XM_864297 LOC523900 ref|XM_864297 unmapped Bos taurus similar to Homo sapiens cyclin- dependent kinase-like 1 (CDC2-related kinase) (CDKL1) TGACCAGCAGCAGCATCCTTCCAGCTCTGGATAACAAGAAACATTGCTATAACACCAAGA A_73_101080 A_73_101080 FALSE XM_872561 XM_872561 LOC613452 ref|XM_872561 unmapped PREDICTED: Bos taurus hypothetical protein LOC613452 (LOC613452) AACAGCAGAAACACATGTCAGCCCTAGGCCCTAGCTGAGCTGAGGCTGGAGACAGCACAT A_73_101081 A_73_101081 FALSE XM_615133 XM_615133 LOC535130 ref|XM_615133 unmapped Bos taurus similar to Homo sapiens sec1 family domain containing 2 (SCFD2) TTAAATCATTTTTCTAAAGGCATCAAACTGCCTTTCAGCTGGCCTAATTCATGATAATGC A_73_101082 A_73_101082 FALSE XM_609795 XM_609795 LOC531303 ref|XM_609795 unmapped Bos taurus similar to Homo sapiens NADPH oxidase, EF-hand calcium binding domain 5 (NOX5) TTCCTTGAGAACCAGGGAGAGGGCGGGGCCTTGTGGGGTGCTACTATGAGTTTGGGAATT A_73_101083 A_73_101083 FALSE NM_001034396 NM_001034396 MGC128558 ref|NM_001034396 unmapped Bos taurus similar to Homo sapiens nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 1 TTTTTTAAACCAAGCTTTAATCAATGTCTCTACTGAGCTGGAAGCCTTGTCATGGTTTTC A_73_101084 A_73_101084 FALSE XM_864763 XM_864763 LOC512034 ref|XM_864763 unmapped Bos taurus similar to Homo sapiens protease, serine, 12 (neurotrypsin, motopsin) (PRSS12) GTCTTGTCTCAATTTCTCAGCATTCTCCAGAGATTATTGTATATTGATTGTGCAATAAGG A_73_101085 A_73_101085 FALSE XM_866539 XM_866539 LOC614894 ref|XM_866539 unmapped PREDICTED: Bos taurus similar to Antigen KI-67 (LOC614894) GACCAGAAACTGAGCCCTCACACAGGAAGTTTGACAAGCAGTGCATTCAATACCAAGAAA A_73_101086 A_73_101086 FALSE XM_591765 XM_591765 LOC513987 ref|XM_591765 unmapped Bos taurus similar to Homo sapiens transcription elongation factor A (SII)-like 4 (TCEAL4), transcript variant 1 CTTTACTAGTGATCCATGTACAGGAAAAACTGAAAACTGTCTACTAAAAAATCAACAGCG A_73_101087 A_73_101087 FALSE XM_602231 XM_602231 LOC523920 ref|XM_602231 unmapped Bos taurus similar to Homo sapiens centromere protein J (CENPJ) ATGTACATTTCTTGTGGATTCTGTGGTTTAATTTATATATTCTGTGTGTGTGCGCATCTG A_73_101088 A_73_101088 FALSE XM_583691 XM_583691 LOC507132 ref|XM_583691 unmapped Bos taurus similar to Homo sapiens RNA binding motif protein 28 (RBM28) AGAAGGAGCTGAAGCCTAAAAAAGCCAAAGTGGCAGATAAGAAAGCCAGATTAATTATTC A_73_101089 A_73_101089 FALSE XM_592031 XM_592031 LOC514218 ref|XM_592031 unmapped Bos taurus similar to Homo sapiens erythroblast membrane-associated protein (Scianna blood group) (ERMAP), transcript variant 2 ATCTTCTCTCAGACCATGCGAAAGAAAAAGGACGACTCCATAAAGCCCTCAAGAAACTCC A_73_101090 A_73_101090 FALSE XM_581233 XM_581233 LOC505010 ref|XM_581233 unmapped Bos taurus similar to Homo sapiens calmin (calponin-like, transmembrane) (CLMN) GATGCCCTTCACATCCCCAGGCTCCTGGAGCCAGAAGACATCATGGTTGACACACCAGAT A_73_101091 A_73_101091 FALSE NM_001034780 NM_001034780 DEADC1 ref|NM_001034780 unmapped Bos taurus similar to Homo sapiens deaminase domain containing 1 (DEADC1) ATTGGACCACGATTCTGTGGTCCTTACAAGAGATTTTTGCTTTTATAAAGCATTTAGAGA A_73_101092 A_73_101092 FALSE XM_864697 XM_864697 LOC514867 ref|XM_864697 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 75 (C6orf75) TAATGAGAAAGGCTAGGACCTGACAACCTAAAAAGATTCCAAACTCCTTGAAGCCTGTTC A_73_101093 A_73_101093 FALSE XM_867165 XM_867165 LOC615374 ref|XM_867165 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily T, member 2 (OR2T2) TAAAGATGTGGCTACAGCTCTAAGAAGAATACAGGGGAGATGTACATACTCCCAGAAAGT A_73_101094 A_73_101094 FALSE NM_174482 NM_174482 UPK1B ref|NM_174482 unmapped Bos taurus uroplakin IB (UPK1B) ATCCTGAAGGAATTTCTTATAACAACATTTGTCTTTATATAAATAAAGAGAGTTTTAAAT A_73_101095 A_73_101095 FALSE NM_181669 NM_181669 NRBF1 ref|NM_181669 unmapped Bos taurus nuclear receptor binding factor 1 (NRBF1) TCTCCCCACTGTCCCTTCTGACTCAGAGAATTGGGGGGCCGGCCTCAGGGTATTGAATAA A_73_101096 A_73_101096 FALSE XM_869045 XM_869045 LOC616908 ref|XM_869045 unmapped Bos taurus similar to Homo sapiens similar to KIAA1680 protein (MGC48628) GGATGAAGATGATCTAATGCTTGATTTGGAATTTTTAGAGGAACAGAATCTTCATCCTTC A_73_101097 A_73_101097 FALSE XM_584824 XM_584824 LOC508097 ref|XM_584824 unmapped Bos taurus similar to Homo sapiens ectonucleoside triphosphate diphosphohydrolase 6 (putative function) (ENTPD6) GGATCCAGGAGCTACTGGATGTGGCCAAACAGGACATCCCCTTTGACTTCTGGAAGGCCA A_73_101098 A_73_101098 FALSE NM_001034542 NM_001034542 MGC128096 ref|NM_001034542 unmapped Bos taurus similar to Homo sapiens chaperonin containing TCP1, subunit 6A (zeta 1) (CCT6A), transcript variant 1 ATTGCACTGCAGTGTCCACATACAGCAGGTCATACTTACCCAGTAAACAGGACATTTTGC A_73_101099 A_73_101099 FALSE XM_587136 XM_587136 LOC539436 ref|XM_587136 unmapped Bos taurus similar to Homo sapiens KIAA1754-like (KIAA1754L), transcript variant 1 TGAAAGCTCTGCCCTGTTCCTCGCTGGCCGGGGCACGTTGACTTGTATTCAGGCCATTAA A_73_101100 A_73_101100 FALSE CB170148 CB170148 gb|Bos taurus similar to Homo sapiens formin-like 2 (FMNL2) unmapped Unknown AATATTGGCATGTCCTTTTCTGTTTGTCTCCTAATGGGCCTGCTTCTTAGCAATATTAGA A_73_101101 A_73_101101 FALSE NM_174656 NM_174656 SLC25A1 ref|NM_174656 unmapped Bos taurus solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1) TCGTGTTCATCATCTACGACGAGGTGGTGAAGCTTCTCAACAAAGTGTGGAGGACGGACT A_73_101102 A_73_101102 FALSE XM_586169 XM_586169 LOC509245 ref|XM_586169 unmapped Bos taurus similar to Homo sapiens mediator of RNA polymerase II transcription, subunit 19 homolog (S. cerevisiae) (MED19) TGGCTGATGTGAATGCCTATCTAAGCTTCTAAGACAACAAAAGGCAGCCTAAACTAGCGA A_73_101103 A_73_101103 FALSE XM_589475 XM_589475 LOC512037 ref|XM_589475 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 8, subfamily D, member 4 (OR8D4) CCCCTGATATATAGTCTGAGGAACAAGGAAGTAAAAAACTCATTGATGAAACTCTTAAGA A_73_101104 A_73_101104 FALSE XM_615033 XM_615033 LOC541204 ref|XM_615033 unmapped Bos taurus similar to Homo sapiens activating transcription factor 7 (ATF7) CATAAACTTTAGCCCTTCTCCCTACCAGCCACCAAAAACAAAAAGAAATGAAATCCTAAA A_73_101105 A_73_101105 FALSE XM_594532 XM_594532 LOC516379 ref|XM_594532 unmapped PREDICTED: Bos taurus similar to Intestinal alkaline phosphatase precursor (IAP) (LOC516379) GGCTTACAACCTGATGTGGATGAAACCGAGAGCATGGACCCCAACTACAAGCAACAAGCC A_73_101106 A_73_101106 FALSE XM_864056 XM_864056 LOC613368 ref|XM_864056 unmapped PREDICTED: Bos taurus similar to Vav-2 protein (LOC613368) TACGGCTTCTATCTCATTCACCTACAAGGCAAGCAAGGCTTCCAGTTTTTCTGCAAGACA A_73_101107 A_73_101107 FALSE CB449370 CB449370 gb|Bos taurus similar to Homo sapiens SRY (sex determining region Y)-box 7 (SOX7) unmapped Unknown ACAGTATCACAGACATTAAGCTAAACTGTTCCACTTTCTGTAGGAACTATATATGCTTTG A_73_101108 A_73_101108 FALSE XM_615928 XM_615928 LOC535814 ref|XM_615928 unmapped Bos taurus similar to Homo sapiens zinc finger, DHHC-type containing 21 (ZDHHC21) GCTCTGAGCCTCCACTTCTGCTTGACCTTTTGTACAGTCCTGTTTATGAGTTGACAGTTA A_73_101109 A_73_101109 FALSE XM_865157 XM_865157 LOC533823 ref|XM_865157 unmapped Bos taurus similar to Homo sapiens Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 (ARHGEF6) TGCATAAGTCAGACCTTGTTCTCTAAATGGCTGAAGTGTAGAGAAGGGAAGGAAATAAGG A_73_101110 A_73_101110 FALSE AW314401 AW314401 gb|Bos taurus similar to Homo sapiens exostoses (multiple)-like 1 (EXTL1) unmapped Unknown GGGCTCACCCACCTGGAATTGGAATTATCACTTCCGAAATAAAAGCGCGTGTCCTTGCCG A_73_101111 A_73_101111 FALSE XM_867236 XM_867236 LOC512381 ref|XM_867236 unmapped PREDICTED: Bos taurus similar to ubiquitin specific protease 11 (LOC512381) ATGTATTTTCTTTCTGAGACCTTGTACCTTGCACTGTGTATATAAAAGTGCCAGTGTGTT A_73_101112 A_73_101112 FALSE CB224340 CB224340 gb|Bos taurus similar to PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 1 (MAP3K1) unmapped Unknown GATTCCTAAGACTTCCAGGGCTTAAGGGCTAACTTCTATTAGCACCTTACTGTGTAAGCA A_73_101113 A_73_101113 FALSE CB421936 CB421936 gb|Bos taurus similar to Homo sapiens hypothetical protein FLJ14154 (FLJ14154) unmapped Unknown TGTTGAACAGATTGTAGTGTTTCTTCTCATTACAAACAAATAAATAGACTTCAGTTGGCC A_73_101114 A_73_101114 FALSE XM_598964 XM_598964 LOC520714 ref|XM_598964 unmapped PREDICTED: Bos taurus similar to slit homolog 2 (LOC520714) CAAAAACGAGAATTTGTCTGCAGCGGTCACCAGTCATTTATGGCTCCTTCTTGCAGTGTT A_73_101115 A_73_101115 FALSE BM090226 BM090226 gb|Bos taurus similar to Homo sapiens MIS12 homolog (yeast) (MIS12) unmapped Unknown AAAGGAGTTTCTCAGTAGGTGGACGGTATGGGATTTATATCGACGATATTCTTAATCCTA A_73_101116 A_73_101116 FALSE BM254208 BM254208 gb|Bos taurus similar to Homo sapiens Yes-associated protein 1, 65kDa (YAP1) unmapped Unknown GGGCTTATTAGATCTACTTATGGTTGATGGAGCATATTGATTTGTAGTTTCAGATTTTCC A_73_101117 A_73_101117 FALSE XM_870998 XM_870998 LOC618672 ref|XM_870998 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 100, member A (FAM100A) CCAGAGCCCGGGGGTACCCCATCCCCAATTCCTTTCCCCCTTTTAACAAAGGAGAAGAAA A_73_101118 A_73_101118 FALSE XM_865695 XM_865695 LOC519864 ref|XM_865695 unmapped Bos taurus similar to Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10), transcript variant 1 GAAGCCCCATTCCGGGGGTAACAGGGTACCAAAGTTTATAAATTAAACATTGGGGGATGT A_73_101119 A_73_101119 FALSE CB457253 CB457253 gb|Unidentified transcripts on BTA11 position 66297096-66295948 unmapped Unknown ACATTTGATGTCACTGATGGGGTGAATACACTTCATCAAAGCTGAAAAGTCACAGCGGTC A_73_101120 A_73_101120 FALSE NM_177512 NM_177512 B4GALT1 ref|NM_177512 unmapped Bos taurus glycoprotein-4-beta-galactosyltransferase 2 (B4GALT1) TGGGTGAATGTCTGACGTTGGTGTTCAAAACAGAACTGTATTTTTGCCTTTAAAATCCAG A_73_101121 A_73_101121 FALSE XM_582806 XM_582806 LOC506370 ref|XM_582806 unmapped Bos taurus similar to Homo sapiens cytochrome b5 type B (outer mitochondrial membrane) (CYB5B) CAAACGCACACTAGACATATTTAACAGCTTGTCACGTTCTGGTTTTGAAGCTTTTAATTA A_73_101122 A_73_101122 FALSE XM_590778 XM_590778 LOC539999 ref|XM_590778 unmapped Bos taurus similar to Homo sapiens TTMB protein (TTMB) TGCATCGAACATTCCAAGTCTTTGGATCTGGGCCTCGGAGAGCTCCTGCTGGGGGCCCCA A_73_101123 A_73_101123 FALSE EE971450 EE971450 gb|Unidentified transcripts on BTA3 position 68376443-68377099 unmapped Unknown GGAATAAAACAAAAATGAGTGCTTGACAGTAAGTTTTGTCGAATAAGAAATGGTGGTGCC A_73_101124 A_73_101124 FALSE XM_600291 XM_600291 LOC522018 ref|XM_600291 unmapped Bos taurus similar to Homo sapiens NACHT, leucine rich repeat and PYD containing 12 (NALP12), transcript variant 2 AGGCTGCGGATTTTGTGGTTGAAGATCTGCCTCCTCACTGGTGCTGCGTGTGAAGACTTG A_73_101125 A_73_101125 FALSE XM_867806 XM_867806 LOC505083 ref|XM_867806 unmapped PREDICTED: Bos taurus similar to Rho-related BTB domain containing 2 (predicted) (LOC505083) GGGGCCAGGTGCAGGTGACCGGAAGGATTCCTTTATGCTTCCTCCAAACCAGAAAGATGC A_73_101126 A_73_101126 FALSE XM_865879 XM_865879 MYH8 ref|XM_865879 unmapped Bos taurus similar to Homo sapiens myosin, heavy polypeptide 8, skeletal muscle, perinatal (MYH8) AAAGTTGGCCCAGATTATAACAAGAACTCAAGCTGTCTGTAGGGGATTCCTAATGAGGGT A_73_101127 A_73_101127 FALSE XM_582418 XM_582418 LOC506029 ref|XM_582418 unmapped Bos taurus similar to Homo sapiens amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 (ALS2CR2) CTAGAATTATACTTGAAAATACAGTTGGTGCACTGGAGAATCTGTCATTTAAAACCACTC A_73_101128 A_73_101128 FALSE XM_589573 XM_589573 LOC512125 ref|XM_589573 unmapped Bos taurus similar to Homo sapiens mitogen- activated protein kinase 15 (MAPK15) ATCCAGCTCCCTAGCGGCCTTTTCCATTCGAACCAAAGTCTCTGCTGTCACCCCACCTGG A_73_101129 A_73_101129 FALSE XM_869472 XM_869472 bTrappin-5 ref|XM_869472 unmapped PREDICTED: Bos taurus trappin 5 (bTrappin-5) AGTGAAAGGTCAAGAGCCAGTGAAAGGTCAAGATCCAGTGAAAGGTCAAGATCCAGTCAA A_73_101130 A_73_101130 FALSE XM_864390 XM_864390 FN1 ref|XM_864390 unmapped Bos taurus similar to Homo sapiens fibronectin 1 (FN1), transcript variant 3 TGGTTGGTGATTATTTTTTATACTGTATGTGCCAAAGCTTTACTACTGTGGAAAGACAAC A_73_101131 A_73_101131 FALSE NM_001035335 NM_001035335 MGC127460 ref|NM_001035335 unmapped Bos taurus similar to Homo sapiens oxidase (cytochrome c) assembly 1-like (OXA1L) TTCCTGCCTGGCTCATGGAAACTATCCCTAAGACACTGTATAAAAATGATGGAGCCACTC A_73_101132 A_73_101132 FALSE NM_177506 NM_177506 QPCT ref|NM_177506 unmapped Bos taurus glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (QPCT) TGTGTCCTCCAGAGTCAATATGAAGGTAACACAGAGAAAGCCCAGCAATTATGATCATTT A_73_101133 A_73_101133 FALSE EE923647 EE923647 gb|Unidentified transcripts on BTA19 position 44298746-44298094 unmapped Unknown CTACTAAATTCCCTGGGCTACCTCTTAACAGGCTGACGGCCAGGCAGTCCCTTCCTCAGA A_73_101134 A_73_101134 FALSE XM_582913 XM_582913 LOC506466 ref|XM_582913 unmapped Bos taurus similar to Homo sapiens like- glycosyltransferase (LARGE), transcript variant 2 GCTGGAAACACTTCAGTGTAGAAAGCAAAGTCGATAAACAGCAACTTTACACTTCTGTGA A_73_101135 A_73_101135 FALSE NM_001038110 NM_001038110 MGC127789 ref|NM_001038110 unmapped Bos taurus similar to Homo sapiens vasodilator-stimulated phosphoprotein (VASP), transcript variant 1 CTCTTACCTTCACCTTTAGCTTCTTGGAAATGGGCCCCTGTGGAATAAATCTGCCAGTTT A_73_101136 A_73_101136 FALSE XM_596215 XM_596215 LOC518033 ref|XM_596215 unmapped PREDICTED: Bos taurus similar to SEC14p-like protein TAP3 (LOC518033) AAGAAGATCAGCTACACCGTAGAGGTGCTGCTCCCCGACAAGGCCTCCGAGGAGAAGATT A_73_101137 A_73_101137 FALSE XM_882423 XM_882423 CACNA1G ref|XM_882423 unmapped Bos taurus similar to Homo sapiens calcium channel, voltage-dependent, alpha 1G subunit (CACNA1G), transcript variant 12 TTGACGGGGGCCCATCTTCAGTGGAGAGCAAGAACCATTTTGGAAACTGTAATGTAACTT A_73_101138 A_73_101138 FALSE CB446501 CB446501 gb|Unidentified transcripts on BTA22 position 11949762-11950629 unmapped Unknown TGACATCCCTGTTTCAGACTTGGGGGCCAGTGGAAGTGTTGCATATGTAAATAAAGAGGT A_73_101139 A_73_101139 FALSE XM_866411 XM_866411 LOC614786 ref|XM_866411 unmapped Bos taurus similar to Homo sapiens WW domain containing transcription regulator 1 (WWTR1) AGTGACTTTTGACAGGTGGCTGGGTCCAGGAAATGTACACAAAACTCGACCTGATTTACA A_73_101140 A_73_101140 FALSE NM_001037491 NM_001037491 NM_001037491 ref|Bos taurus similar to Homo sapiens chromosome 9 open reading frame 116 (C9orf116) unmapped Unknown TATCCAAAGAAAGTTTTTACTCATGTATTAATTTGGGAGGAAATGAAATACCGTGGCCAG A_73_101141 A_73_101141 FALSE XM_867056 XM_867056 LOC615291 ref|XM_867056 unmapped PREDICTED: Bos taurus similar to ferritin light chain 1 (LOC615291) GAATTATTCCACCAAGGTAGAGGCCGCCATCAACCACCTGCTCTACATGCACCTGCAGGC A_73_101142 A_73_101142 FALSE XM_865776 XM_865776 LOC613751 ref|XM_865776 unmapped Bos taurus similar to Homo sapiens GC-rich promoter binding protein 1 (GPBP1) GTCGTTCTCTGTAGTGTTCAAGATATTGGTCTCTAAACACATTGTGGTTTATTCACTTTT A_73_101143 A_73_101143 FALSE NM_174445 NM_174445 PTGS2 ref|NM_174445 unmapped Bos taurus prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2) TGTTAAATATCTGAATGACTGAATCTGGGAATTTGGAATATATGAGTGTTTTGGTGCCTC A_73_101144 A_73_101144 FALSE XM_595859 XM_595859 LOC517685 ref|XM_595859 unmapped PREDICTED: Bos taurus similar to D1086.9 (LOC517685) TGAAAACTTAGTCTATGAAAAGCCAGAGGATCCCCTGAATTTTATGCTGTGCCAGCAACC A_73_101145 A_73_101145 FALSE CB461186 CB461186 gb|Unidentified transcripts unmapped Unknown CAGCTTTAGTGAGGTATAGTTGACATACAACAAACTGTACTTACTAAAGTACATGCTTTG A_73_101146 A_73_101146 FALSE NM_174580 NM_174580 POU5F1 ref|NM_174580 unmapped Bos taurus POU domain, class 5, transcription factor 1 (POU5F1) GGAGGGAAGGTGAAGTTCAATGATGCTCTTGACTTTAATCCCCACATCACTCATCACTTT A_73_101147 A_73_101147 FALSE XM_613422 XM_613422 LOC540849 ref|XM_613422 unmapped PREDICTED: Bos taurus similar to YLP motif containing protein 1 (Nuclear protein ZAP3) (ZAP113) (LOC540849) GAGGACTCCAACAGACAGTGTTTCCTCCACTGTACAGTTGTCACAGACTATCTCTATCAT A_73_101148 A_73_101148 FALSE NM_178322 NM_178322 DBIL5 ref|NM_178322 unmapped Bos taurus diazepam binding inhibitor-like 5 (DBIL5); Homo sapiens GABA receptor modulator, acyl-Coenzyme A binding protein AGGAGGCACTTTAAAGACCTTTTGAGGGCCAAAATGTCCTCAGGCTGTACCAACCACCGA A_73_101149 A_73_101149 FALSE XM_582744 XM_582744 LOC506314 ref|XM_582744 unmapped Bos taurus similar to Homo sapiens interleukin 16 (lymphocyte chemoattractant factor) (IL16), transcript variant 1 TACAAACGACAGACTGCATCTAGAGAGCTTAGTGATAATACTGTGGTGCTGTAAATAAAT A_73_101150 A_73_101150 FALSE BF073340 BF073340 gb|Bos taurus similar to Homo sapiens KIAA0182 (KIAA0182) unmapped Unknown CATCTCTAAATCTAAGCCACATACCCCGTTTCCCTCTGAGCCACGGTTTAAAAGTGTAGA A_73_101151 A_73_101151 FALSE XM_597427 XM_597427 LOC519213 ref|XM_597427 unmapped Bos taurus similar to Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class V (PIGV) AGCAGCGATAGTAAGTAAAATGGGACCATCTTTTCTAAATGGGATGTTGTTTCTGACGAG A_73_101152 A_73_101152 FALSE CB446820 CB446820 gb|Bos taurus similar to Homo sapiens FLJ43339 protein (FLJ43339) unmapped Unknown TTGGAATCCAAGAGACTGAATCTGAATTCTAGGTCTGTCACCTGCTAGCTGGATGACTCT A_73_101153 A_73_101153 FALSE XM_615192 XM_615192 LOC535183 ref|XM_615192 unmapped Bos taurus similar to Homo sapiens transcription factor 8 (represses interleukin 2 expression) (TCF8) TGACCCCTTTTCGAACTATAATTTCTTTATGAGTCTGTGATCATTTATGAATCTGTGACC A_73_101154 A_73_101154 FALSE NM_001015606 NM_001015606 ABHD10 ref|NM_001015606 unmapped Bos taurus abhydrolase domain containing 10 (ABHD10) ATCTAATGATGTATTTTCACAAGTGATACAAATTGTGAAGAAAGTGCCAGCTGCTGTTTG A_73_101155 A_73_101155 FALSE XM_581098 XM_581098 LOC504903 ref|XM_581098 unmapped Bos taurus similar to Homo sapiens synaptoporin (SYNPR) TCAGTCAATTATTAATGTGGAGAGTGTGGAATGTAAATCAGAGATCTGTCGGCCTCATTA A_73_101156 A_73_101156 FALSE XM_868154 XM_868154 LOC615930 ref|XM_868154 unmapped Bos taurus similar to Homo sapiens interferon, gamma-inducible protein 30 (IFI30) TCAAAATTCTGCCCCAGGATCAAGAATCTTGTCTCACTGTGAATGGTGCTACGTCAAAAC A_73_101157 A_73_101157 FALSE CB439711 CB439711 gb|Bos taurus similar to Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5) unmapped Unknown TTTAAAAGTGTGTTTGCACTTGTCTAAAAATCAAGCCAATACAAGAGAACTGATCAGTGC A_73_101158 A_73_101158 FALSE CB530181 CB530181 gb|Bos taurus similar to Homo sapiens similar to expressed sequence AW210596 (LOC387700) unmapped Unknown TTTTTTCAGATTGTGACTTCACTAATAGATCACATATTTATGATAATATTTCTTATTTCA A_73_101159 A_73_101159 FALSE XM_589601 XM_589601 LOC512151 ref|XM_589601 unmapped Bos taurus similar to Homo sapiens NFAT activating protein with ITAM motif 1 (NFAM1) ACCAGGAGGTTCCAGCAGGGACCCAGTACTGTGTGCACACGCATCGCAGAGTAGATGAAT A_73_101160 A_73_101160 FALSE XM_868798 XM_868798 LOC616704 ref|XM_868798 unmapped Bos taurus similar to Homo sapiens mutated in colorectal cancers (MCC) AGTCACTTAGAAGAAAAACGCCCAACGCTACAGTTCAAAGATCTGCTTACGACCAGATCA A_73_101161 A_73_101161 FALSE XM_602637 XM_602637 LOC524315 ref|XM_602637 unmapped PREDICTED: Bos taurus similar to FRAS1-related extracellular matrix protein 3 precursor (LOC524315) TGACACGGTCACTGACTATAAGCAGAGTGCTTGTCCTCCTTTTGGTTGTTTAAGAGAGAG A_73_101162 A_73_101162 FALSE CB443840 CB443840 gb|Unidentified transcripts unmapped Unknown AACCAAAGGCCAAATATGTATTTCTTACTATGTCCTATGAGTCTCTTATACGCGGAAAAA A_73_101163 A_73_101163 FALSE XM_593659 XM_593659 LOC515612 ref|XM_593659 unmapped Bos taurus similar to Homo sapiens forkhead box N4 (FOXN4) GGGAAGGCCTTTAAATTATTCTCCTGGGATGAACACCTGTCTCAGTCTCCAGCGGACAGG A_73_101164 A_73_101164 FALSE CB425670 CB425670 gb|Bos taurus similar to Homo sapiens zinc finger protein, subfamily 1A, 4 (Eos) (ZNFN1A4) unmapped Unknown CTGCACTTTAACCAGGGTCTTAGGTACAAAATCCTACTTTCCAGAGCCTTCCAGCTCTGG A_73_101165 A_73_101165 FALSE BE756221 BE756221 gb|Unidentified transcripts on BTA22 position 8069258-8066999 unmapped Unknown TAAAGCTTCATGTAAATAATTCTGTGTACTCTTGCTCAGCATTGTATCTCTGAGTTATCC A_73_101166 A_73_101166 FALSE NM_001037468 NM_001037468 MGC128732 ref|NM_001037468 unmapped Bos taurus similar to Homo sapiens CDC7 cell division cycle 7 (S. cerevisiae) (CDC7) TCCAGTCTGAAGCTCACCAGGAAAGCTGTTCACAAAATAAATCCTATGTAATCACCGGCA A_73_101167 A_73_101167 FALSE XM_580860 XM_580860 LOC504698 ref|XM_580860 unmapped Bos taurus similar to Homo sapiens transferrin receptor (p90, CD71) (TFRC) GTTCTTGAAATTTTAGTTTACTAAAGATAGCGTATTAGACTTGCCAACTTACTGCTCAGC A_73_101168 A_73_101168 FALSE XM_867580 XM_867580 LOC615704 ref|XM_867580 unmapped PREDICTED: Bos taurus similar to squamous cell carcinoma antigen recognized by T cells 1 (LOC615704) GTGGATTAAAATAACCTTAGAAAATGTAAGAAAAGAACAGAAAAATGTAAACAAGGGATG A_73_101169 A_73_101169 FALSE XM_870975 XM_870975 LOC618644 ref|XM_870975 unmapped PREDICTED: Bos taurus similar to Dual specificity protein phosphatase 16 (Mitogen-activated protein kinase phosphatase 7) (MAP kinase phosphatase 7) (MKP-7) (LOC618644) CCTGTAAATCTGAAATATATATATGTACATATATATTTTTGGAAAATGGAGCTATGGTGT A_73_101170 A_73_101170 FALSE NM_175804 NM_175804 NR2F1 ref|NM_175804 unmapped Bos taurus nuclear receptor subfamily 2, group F, member 1 (NR2F1) TAACCCTTTGCTTCTTATAATGAGTGCGATATATGTTGTCGAGGCTGTTCTTCAAGAATT A_73_101171 A_73_101171 FALSE NM_001035078 NM_001035078 MGC127419 ref|NM_001035078 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein S11 (MRPS11), nuclear gene encoding mitochondrial protein, transcript variant 1 CCCAGACTCCCAGCAGTAAATGCTGTTTCTCTTCTGAAAAAATAAAATTATTTCCACCAT A_73_101172 A_73_101172 FALSE NM_001015566 NM_001015566 PSMA5 ref|NM_001015566 unmapped Bos taurus proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5) TTGCCCTTAACTTTTATTTCCAGCTCCAGTTCCTTGGGAAATCTCCAGTGTATGTGCATT A_73_101173 A_73_101173 FALSE XM_603252 XM_603252 LOC524913 ref|XM_603252 unmapped Bos taurus similar to Homo sapiens chromosome 13 open reading frame 24 (C13orf24) ACCTGGACCATCAAAAGAACCAAGTAACACAGCTTTCACAAGAGCTTGACAGGGCCAATT A_73_101174 A_73_101174 FALSE XM_590933 XM_590933 LOC513270 ref|XM_590933 unmapped Bos taurus similar to Homo sapiens nucleoporin 153kDa (NUP153) AAATTGGGGATTCTTAAAGTGAGTTTATTGGCTTTTCTGATCCAGTTTTTGTTTGGACCA A_73_101175 A_73_101175 FALSE XM_617854 XM_617854 LOC537677 ref|XM_617854 unmapped PREDICTED: Bos taurus similar to Calcium /calmodulin-dependent protein kinase type IV (CAM kinase-GR) (CaMK IV) (LOC537677), partial mRNA. CGTTTTGTCCTTCAGCAAGGAAGGCGGAAGCATGATGTGCACTATATTGTGGTTCTGTTT A_73_101176 A_73_101176 FALSE XM_880998 XM_880998 LOC534369 ref|XM_880998 unmapped Bos taurus similar to Homo sapiens ATPase type 13A1 (ATP13A1) CTGGCTGGCGGAACCAGCCCCGGGCCAGCACCTTTGGTAAATAAAGCAGCATTGATGATT A_73_101177 A_73_101177 FALSE XM_610532 XM_610532 LOC532025 ref|XM_610532 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to Leucine-rich repeat-containing protein 14 (LOC389257) CGACCCGGACATTCAGGAAACCAGCAATGAACTCGGAGCTTTCTTGCTGCAAGCCTTCAA A_73_101178 A_73_101178 FALSE XM_585154 XM_585154 LOC508386 ref|XM_585154 unmapped Bos taurus similar to Homo sapiens CD48 molecule (CD48) AATGCAAGATTTTTCCCTCATTGGCAATCGGCTATTAACCAGGACCGAAGCTCTGGCTAT A_73_101179 A_73_101179 FALSE XM_865690 XM_865690 LOC614262 ref|XM_865690 unmapped Bos taurus similar to Homo sapiens V-set and immunoglobulin domain containing 4 (VSIG4) GATTATCATGAAACAGACCAGGGATCAGATCTGCTCCTGTACTATGAGCCTAGTGCTCTA A_73_101180 A_73_101180 FALSE NM_001034493 NM_001034493 MGC127253 ref|NM_001034493 unmapped Bos taurus similar to Homo sapiens immature colon carcinoma transcript 1 (ICT1) CACGTGTTATCACACCTTTGTTATCCATGTCCTGTATTAGTTGCAATAAAATTCTAAACC A_73_101181 A_73_101181 FALSE CB165345 CB165345 gb|Bos taurus similar to Homo sapiens ankyrin 2, neuronal (ANK2), transcript variant 1 unmapped Unknown TGAGGGCATGTATTAGTTAACGGAAAAAATACAACACTAACAATACATAGCTGCAATGTG A_73_101182 A_73_101182 FALSE XM_617724 XM_617724 LOC537555 ref|XM_617724 unmapped PREDICTED: Bos taurus similar to Atrophin-1-interacting protein 1 (Membrane-associated guanylate kinase inverted-2) (MAGI-2) (Activin receptor-interacting protein 1) (Acvrip1) (LOC537555), partial mRNA. ATCGAGGAGGTAAGATAAAGGCTGGCTTAGCAATCAGTATACAGGTGAAATTGTAGAACC A_73_101183 A_73_101183 FALSE XM_615207 XM_615207 LOC541233 ref|XM_615207 unmapped Bos taurus similar to Homo sapiens REST corepressor 2 (RCOR2) TCCACCAGCCTGGAGTAAGGAGGGTTGGGAACATATGCAGACATGGGTTTATTTTTCAAT A_73_101184 A_73_101184 FALSE CB421462 CB421462 gb|Bos taurus similar to Homo sapiens actin filament associated protein (AFAP), transcript variant 1 unmapped Unknown ATCAACTTTTAAATTATGCGTGTTCAGCATTGATTGACCATGGCTGTGAGTTGTAAAATG A_73_101185 A_73_101185 FALSE XM_593130 XM_593130 LOC515158 ref|XM_593130 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 99 (CCDC99) ATTGTCTTTATCTGAGGATACCTTCTTGCAGCCTATTTTCCTTCTACTCATTGTGCCGGG A_73_101186 A_73_101186 FALSE XM_609516 XM_609516 LOC531032 ref|XM_609516 unmapped Bos taurus similar to Homo sapiens C3 and PZP- like, alpha-2-macroglobulin domain containing 8 (CPAMD8) TGGAAACAAAACAGGCCCCTCTTCTCCAAAATGCAGAAGTCCCAGCCTCCCTTTGGGCCA A_73_101187 A_73_101187 FALSE XM_609607 XM_609607 LOC531121 ref|XM_609607 unmapped Bos taurus similar to Homo sapiens tubulin tyrosine ligase-like family, member 5 (TTLL5) GTGAAGGAAGAGAATGATCGGAGAGGTGGATTTATTCGCATATTCCCCACATCAGAGACA A_73_101188 A_73_101188 FALSE XM_617163 XM_617163 LOC537010 ref|XM_617163 unmapped Bos taurus similar to Homo sapiens striatin, calmodulin binding protein (STRN) TTTTAATGGTCCAAAGGGTATGGTTAACCTCAGGCAGCTGTCTTTGCAGAATTACTAAAT A_73_101189 A_73_101189 FALSE EE920931 EE920931 gb|Region on unlocalized contig NW_946666 unmapped Unknown CATTTGAGACGTTTCGTGTCATCTTCTCATAATGTAGGTATTCAGTCCTGTCCCCACCCA A_73_101190 A_73_101190 FALSE XM_876576 XM_876576 LOC510459 ref|XM_876576 unmapped Bos taurus similar to Homo sapiens homeo box A9 (HOXA9) GGATGAAAATGAAGAAAATCAACAAGGACCGAGCAAAAGACGAGTGATGCGACTCGAGTT A_73_101191 A_73_101191 FALSE XM_870486 XM_870486 LOC618162 ref|XM_870486 unmapped Bos taurus similar to PREDICTED: Homo sapiens microtubule associated monoxygenase, calponin and LIM domain containing 3, transcript variant 1 (MICAL3) CCCGGTCTGAGAGGGCCTGGGCCTCCGGGGAGTTTGCACTCAGGTCCACGTGGCCCCAGG A_73_101192 A_73_101192 FALSE AV664523 AV664523 gb|Unidentified transcripts on BTAX position 13482849-13483480 unmapped Unknown CTACCCATCCTTGCCCCCTGCCAGTGTCGTGAGAATAAAGCAAGCTGCCTTTTGAGGGTG A_73_101193 A_73_101193 FALSE XM_593919 XM_593919 LOC515830 ref|XM_593919 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 186 (C20orf186) CCTCATCGATGTGGACACAGAACTCTTGGCCATGTTTTCCGTGGAGAATGATAAGCTTAT A_73_101194 A_73_101194 FALSE EE904623 EE904623 gb|Unidentified transcripts on BTA23 position 13435598-13436140 unmapped Unknown AATCCTCAGATCAGAGCATCAACTTCCTGAACACAGACCCTGCACAGTAGGAAGTTGAGA A_73_101195 A_73_101195 FALSE EE909634 EE909634 gb|Unidentified transcripts on BTA15 position 41781945-41781383 unmapped Unknown TGTGATGCTTTTCAGTAATGTGAGCATGGTCTATATTAGGACAGCTGAGTGTGAACAGAA A_73_101196 A_73_101196 FALSE XM_581186 XM_581186 LOC538571 ref|XM_581186 unmapped Bos taurus similar to Homo sapiens ring finger and SPRY domain containing 1 (RSPRY1) ATCGTCCTATTACAGAGCTGATTTCCTTCCTGGCTGTACTTGTTGGGGTGCTGGATTTTT A_73_101197 A_73_101197 FALSE NW_991518 NW_991518 gb|Putative orthologue of human miRNA hsa-mir-188 on chr X, (+) strand. Mature length 22 nt, stem-loop length 86 nt. Source: NW_991518.1:c46856-46771 unmapped Unknown CATCCCTTGCATGGTGGAGGGTTATCCTACTATACGTATCACATA A_73_101198 A_73_101198 FALSE XM_581958 XM_581958 LOC505641 ref|XM_581958 unmapped Bos taurus similar to Homo sapiens polymerase (RNA) III (DNA directed) polypeptide G (32kD) like (POLR3GL) ATATTTTGACAATGGGGAGGACTTTGGGGGTGACAGTGATGACAATATGGATGAGGCTAT A_73_101199 A_73_101199 FALSE XM_607366 XM_607366 LOC528929 ref|XM_607366 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 6, subfamily B, member 2 (OR6B2) ATTGTGTGCAGCTGGTGGCTTTTTCCTATATGACTGGTTTCATGATCACTGTGATCAAGG A_73_101200 A_73_101200 FALSE XM_589978 XM_589978 aqp2 ref|XM_589978 unmapped PREDICTED: Bos taurus aquaporin 2 (aqp2) CCGCTCCCTGGCTCCAGCTATCGTCACCGGCAAGTTTGACGACCACTGGGTCTTCTGGAT A_73_101201 A_73_101201 FALSE XM_590059 XM_590059 LOC539882 ref|XM_590059 unmapped Bos taurus similar to Homo sapiens tubulin, alpha 3 (TUBA3) TGCCGGGGATAAGGGCACCAGGTTTGGTCTTGGAACTTTTGTCAAATCCACTTCAGGGCG A_73_101202 A_73_101202 FALSE NM_001035432 NM_001035432 CNOT4 ref|NM_001035432 unmapped Bos taurus similar to Homo sapiens CCR4-NOT transcription complex, subunit 4 (CNOT4), transcript variant 1 AACTTAAAAAATTACTGTTTGTGTGTTGTTAAGCTTAATAATTTATTGGAAGTTGATGGA A_73_101203 A_73_101203 FALSE CB450059 CB450059 gb|Unidentified transcripts on BTA17 position 42668217-42667685 unmapped Unknown AGCACTCCTTCTGTGGACCCAGCCCTCCATCCACCAAGAACGATGAAGCACAGAGTCTGA A_73_101204 A_73_101204 FALSE XM_593272 XM_593272 LOC515282 ref|XM_593272 unmapped Bos taurus similar to Homo sapiens chromosome X open reading frame 45 (CXorf45) GTCTGACCTGAGTTGCATTCTATGATATTAACCAGTTTTGAAGGCACATGGTGCTCTGCT A_73_101205 A_73_101205 FALSE XM_614322 XM_614322 LOC534526 ref|XM_614322 unmapped Bos taurus similar to Homo sapiens p21 (CDKN1A)-activated kinase 3 (PAK3) TCTTGCATTCAAACCTCCTTCAAAACTCCTTACCCAATGTAATGTTTTTCACTTGCATTG A_73_101206 A_73_101206 FALSE XM_867752 XM_867752 LOC615834 ref|XM_867752 unmapped Bos taurus similar to Homo sapiens protein arginine methyltransferase 8 (PRMT8) AGCTGTGCGAAACATCTGTATCTAATTACTACAAAATGCGTTAGCACACGTGGGAGGCTG A_73_101207 A_73_101207 FALSE NM_001033989 NM_001033989 EP24.16 ref|NM_001033989 unmapped Bos taurus neurolysin (EP24.16) TTTTTCCCCAGACTGTTGTGTTTTCCAGTTTCAGGCAAAAACTCTCTTCAGCTTTTTCTA A_73_101208 A_73_101208 FALSE NM_001014853 NM_001014853 TOMM40L ref|NM_001014853 unmapped Bos taurus translocase of outer mitochondrial membrane 40 homolog-like (yeast) (TOMM40L) CCTCGCCCTCGGAGCCTTCCTTAATCACTGGCGCAACAGATTCCACTGTGGCTTTAGCAT A_73_101209 A_73_101209 FALSE BE477280 BE477280 gb|Bos taurus similar to Homo sapiens adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) (ADARB1), transcript variant 1 unmapped Unknown TAGAGTGGAAAACTGGCTGTAAAGCTAGTGTTGAAGTTCACAGTTGTGGAGATGCTTCAG A_73_101210 A_73_101210 FALSE XM_867675 XM_867675 LOC615779 ref|XM_867675 unmapped PREDICTED: Bos taurus similar to death- associated kinase 2 (predicted) (LOC615779) AATGGCACAGAGGAATTGTGAGAGTGACACAGAGGAGGACATCGCCAAGAGGAAAGTCCT A_73_101211 A_73_101211 FALSE AW658711 AW658711 gb|Unidentified transcripts on BTA8 position 55832980-55833781 unmapped Unknown TATATACATGTTGAAGAAAGCATCACAGCAGAACTGTAGGAGTCCAAATTTAATGAACTG A_73_101212 A_73_101212 FALSE XM_883278 XM_883278 LOC533359 ref|XM_883278 unmapped Bos taurus similar to Homo sapiens MAX dimerization protein 3 (MXD3) TTCCTAAACAAGGGCCCCTGGCCTTTGCCCCACGCATACTGTATTTTCATTAAAAGCCTC A_73_101213 A_73_101213 FALSE XM_580923 XM_580923 LOC504755 ref|XM_580923 unmapped Bos taurus similar to Homo sapiens NGFI-A binding protein 2 (EGR1 binding protein 2) (NAB2) CGTCTCCAGCTGGGATCACCAACTGGGGTTAGCTCTTAGGTCCAGGTGGGACATTGAGAT A_73_101214 A_73_101214 FALSE XM_612625 XM_612625 LOC533270 ref|XM_612625 unmapped Bos taurus similar to Homo sapiens protein kinase D1 (PRKD1) CTCAGGTGAAACTTTGTGATTTTGGTTTTGCCCGGATCATTGGAGAGAAGTCTTTCCGGA A_73_101215 A_73_101215 FALSE NM_001015674 NM_001015674 LAX ref|NM_001015674 unmapped Bos taurus membrane associated adaptor protein LAX (LAX) TAATTCTCATCATTGCTAAGGGGATTGCAAGCCATAACCTTCCCTCTGGAAAATTGTTCA A_73_101216 A_73_101216 FALSE NM_181025 NM_181025 PTGFR ref|NM_181025 unmapped Bos taurus prostaglandin F receptor (FP) (PTGFR) CTTCCAAAGCCTGTACTACCAATGTCAAGGGGAACTTTGGCAATTAGCCAGGTATTTTGC A_73_101217 A_73_101217 FALSE XM_588636 XM_588636 LOC511322 ref|XM_588636 unmapped Bos taurus similar to Homo sapiens tripartite motif-containing 44 (TRIM44) AAAGATATTTTTAGTACGTGAGGTTATCCTGGACTTCAGATTCATAATTCAATCCTGTGG A_73_101218 A_73_101218 FALSE CB418507 CB418507 gb|Unidentified transcripts on BTA13 position 49563007-49562312 unmapped Unknown TTGTGTGGCCAGCTGGCCTAGCTTGCATGGAATTGAGGGGTTTCCCAGGACATGGGACTT A_73_101219 A_73_101219 FALSE XM_869084 XM_869084 LOC616938 ref|XM_869084 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily T, member 1 (OR2T1) GTTTGAGAAACAAAGATGTAACTGGAGCTATGAAGAGGGTACTGGACAGGTTCAAGCGTA A_73_101220 A_73_101220 FALSE BM432354 BM432354 gb|Unidentified transcripts on BTA20 position 9069083-9069691 unmapped Unknown GAACCAGGGACCCAAGATGTTATACCCTTAGGATTTCACAAGGGCAGAAAATTTGTGTAT A_73_101221 A_73_101221 FALSE XM_581051 XM_581051 LOC504866 ref|XM_581051 unmapped PREDICTED: Bos taurus similar to Zinc finger BED domain containing protein 4 (LOC504866) CGCAAAGTCAGATGGAGCTGAGCGACTTTACTTTCATACTAAACTGATATATCTCCCCTC A_73_101222 A_73_101222 FALSE XM_600097 XM_600097 LOC521827 ref|XM_600097 unmapped Bos taurus similar to Homo sapiens inscuteable (Drosophila) (INSC), transcript variant 1 GGTGAGAAAAATCGATGCTTCGGACAATATCTACACCACAGAGTCCACCACGGGGAACCT A_73_101223 A_73_101223 FALSE NW_991518 NW_991518 gb|Putative orthologue of human miRNA hsa-mir-501 on chr X, (+) strand. Mature length 22 nt, stem-loop length 84 nt. Source: NW_991518.1:c33979-33902 unmapped Unknown AATCCTTTGTCCCTGGGTGAGATATCCTACTATACGTATCACATA A_73_101224 A_73_101224 FALSE NM_173944 NM_173944 NPB ref|NM_173944 unmapped Bos taurus preproneuropeptide B (NPB) ACTTTCCAGTGCAAGGCCGACGTCTTCCTGTCGCTCAGCGCCTCGGACTGTCGCAAGTGA A_73_101225 A_73_101225 FALSE XM_582249 XM_582249 LOC505885 ref|XM_582249 unmapped Bos taurus similar to Homo sapiens WD repeat domain 16 (WDR16), transcript variant 1 CCCAACTTTCCGCGGAGTTCAAGAACGCAGTCTCCAAGTATGGCGCTCAGTTCCAAGGCA A_73_101226 A_73_101226 FALSE XM_582170 XM_582170 LOC505819 ref|XM_582170 unmapped Bos taurus similar to Homo sapiens mannan- binding lectin serine peptidase 2 (MASP2), transcript variant 1 AGAGGAAAACAGAAGCAATGGAGAGGTTATTTACTTTCACTTCCTGTGCACACCAGCTCA A_73_101227 A_73_101227 FALSE XM_869323 XM_869323 LOC617129 ref|XM_869323 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 79 (C6orf79) TAAAGTGTCTATTTAAAGAGCATTCTATTGTTCTGCCTTAAGAACACCAGAATCTTGCTG A_73_101228 A_73_101228 FALSE XM_598402 XM_598402 LOC520167 ref|XM_598402 unmapped PREDICTED: Bos taurus similar to Laminin beta-2 chain precursor (S-laminin) (Laminin B1s chain) (LOC520167) GGCTTTGTTAGGCTGCAGGAAGGCCAGGTGCTGGAGTTCGTGGTGGCCTCTGTACCGAGA A_73_101229 A_73_101229 FALSE CB459660 CB459660 gb|Bos taurus similar to Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 (B3GNT3) unmapped Unknown CTCAAACAGGTGTCTGAAATGGGCTTCACAGGAATTGGGACGGTGGCAAGGGGGGTCTCA A_73_101230 A_73_101230 FALSE CB437644 CB437644 gb|Unidentified transcripts on BTA4 position 58996826-58998287 unmapped Unknown CTGACTGCATCTTGCAATTTTCTTTTTCGAATTTGGCAGAAATACTGTATTTCCATCGAT A_73_101231 A_73_101231 FALSE AV616491 AV616491 gb|Unidentified transcripts on BTA13 position 56255671-56257057 unmapped Unknown GTGTACCACCCCTCCCCCACCTTATGTCACTTAAAAGCAATACTAAACTGTAAAATAAGT A_73_101232 A_73_101232 FALSE XM_588043 XM_588043 LOC510836 ref|XM_588043 unmapped Bos taurus similar to Homo sapiens TatD DNase domain containing 2 (TATDN2) TCCCCTTTGGCCATCTCTTTCTGAAAATAAAGTGATGGATCTTCAGCCCATGGTCTCCAT A_73_101233 A_73_101233 FALSE XM_867761 XM_867761 LOC519920 ref|XM_867761 unmapped Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 4E member 2 (EIF4E2) TTTCAAAACCTCTGGAAGCCGCGGTTGAATGTGCCATGACCCTCTCCCTCTCTGGATGGC A_73_101234 A_73_101234 FALSE XM_584331 XM_584331 LOC507674 ref|XM_584331 unmapped Bos taurus similar to Homo sapiens rhomboid domain containing 3 (RHBDD3) CAGGGTGGCCCCCCAGCACCCTGCCCCAGTACTGTTCAGAATAAAACACAGTTCACTTTT A_73_101235 A_73_101235 FALSE XM_582091 XM_582091 LOC538697 ref|XM_582091 unmapped Bos taurus similar to Homo sapiens START domain containing 13 (STARD13), transcript variant gamma TATATATAATTGCGTATTTTGAAAAGGAGTGCATTTGATCAGGTGCGCCCTTTCGGCACA A_73_101236 A_73_101236 FALSE CB445232 CB445232 gb|Unidentified transcripts on BTA21 position 1329270-1330037 unmapped Unknown CCCGTTCATATTTTTCCTGGGTATTTATTTCTTTACCCTTTTCATTACTGAGCTGAAAGG A_73_101237 A_73_101237 FALSE XM_882798 XM_882798 LOC532695 ref|XM_882798 unmapped Bos taurus similar to Homo sapiens periphilin 1 (PPHLN1), transcript variant 4 TCAAGTTATCCAAACTGAATTTGATCCAAGCCAAGGTTTCTCAACAGAGAGCAAGAGGAC A_73_101238 A_73_101238 FALSE XM_863902 XM_863902 LOC613292 ref|XM_863902 unmapped PREDICTED: Bos taurus similar to oxysterol- binding protein-like protein 10 (LOC613292) GCGCTCGAGGGCGTGCTCAGCAAATACACCAACCTCCTCCAGGGCTGGCAGAACAGGTAA A_73_101239 A_73_101239 FALSE XM_582572 XM_582572 LOC506162 ref|XM_582572 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily AG, member 1 (OR2AG1) AATAAAGAGGTCATGGGGGCCTTAAGGAGAATCCTGGAGAGAAGTAGCCTCATAAGACAT A_73_101240 A_73_101240 FALSE NM_001034543 NM_001034543 SMAP-5 ref|NM_001034543 unmapped Bos taurus similar to Homo sapiens Yip1 domain family, member 5 (YIPF5), transcript variant 2 TGTCACGATTTCAGTATTGCAGTTCCCAGTGTAAAGTGCGTTTGATGCTTATTGATTAAA A_73_101241 A_73_101241 FALSE AV601940 AV601940 gb|Bos taurus similar to Homo sapiens ring finger protein 144 (RNF144) unmapped Unknown TTTGTCCCCCACCCCTTTCGAAGGGATTTCTTTTTAAAGATATTTTGGCTGGAATACAGG A_73_101242 A_73_101242 FALSE XM_865455 XM_865455 LOC510356 ref|XM_865455 unmapped Bos taurus similar to Homo sapiens tyrosine kinase, non-receptor, 1 (TNK1) TCTCCTGCCCTCTCCTATCACATACATCTTCCACTGTGCAAAAAGTTACAAAGTTTATAT A_73_101243 A_73_101243 FALSE XM_582692 XM_582692 LOC506264 ref|XM_582692 unmapped Bos taurus similar to Homo sapiens cysteine rich transmembrane BMP regulator 1 (chordin-like) (CRIM1) CGTTTCCAGGGCTACACTTCCTTGTTGTCGCTTTCTTCTGTTCTGATGTTGGTTGTTCAT A_73_101244 A_73_101244 FALSE NM_205811 NM_205811 HNF4G ref|NM_205811 unmapped Bos taurus hepatocyte nuclear factor 4gamma (HNF4G) TACTTAACTGCCAAGAACGCTGGGCAAAGGGGAACTGAAGTTTTCAGCATATTTTCAATA A_73_101245 A_73_101245 FALSE XM_616964 XM_616964 LOC536820 ref|XM_616964 unmapped Bos taurus similar to Homo sapiens synaptotagmin XII (SYT12) AGCTGTGAAGAGGGACGACCCTAACCCAGTGTTCAATGAAGCCATGATCTTCTCTGTGCC A_73_101246 A_73_101246 FALSE XM_598898 XM_598898 LOC520650 ref|XM_598898 unmapped Bos taurus similar to Homo sapiens SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae) (SIL1), transcript variant 2 CCTGGGCATCATCTGGGCAGTGCTGGCTTGGCTATTAAATGGAGGCGTGACGGCCAAAAA A_73_101247 A_73_101247 FALSE NM_001035414 NM_001035414 MGC128072 ref|NM_001035414 unmapped Bos taurus similar to Homo sapiens UBX domain containing 2 (UBXD2) TCTGAGAGCATTTTAACTAGCCAGCCAGATGATAATTCTTGCTCATCAGCTGCAAGCAAA A_73_101248 A_73_101248 FALSE XM_591672 XM_591672 LOC513912 ref|XM_591672 unmapped PREDICTED: Bos taurus similar to sarcalumenin (LOC513912) TGTTTCTCTCCAAAGCAGAATCTTTCCAATGCTCTTTCTGTTCAGAGTTCATCAGGGAGA A_73_101249 A_73_101249 FALSE XM_581710 XM_581710 LOC505423 ref|XM_581710 unmapped PREDICTED: Bos taurus similar to Leucine-rich repeat-containing G-protein coupled receptor 4 precursor (G-protein coupled receptor 48), transcript variant 2 (LOC505423) CTTCTATCAGAGTCGAGGATTCCCTTTGGTGCGCTATGCTTACAATCTCCCAAGAGTTAA A_73_101250 A_73_101250 FALSE XM_868863 XM_868863 LOC616756 ref|XM_868863 unmapped PREDICTED: Bos taurus similar to sine oculis homeobox homolog 3 (LOC616756) CAAGAAACGCGAACTGGCGCAGGCCACCGGCCTCACTCCCACACAAGTAGGCAACTGGTT A_73_101251 A_73_101251 FALSE XM_606293 XM_606293 LOC527886 ref|XM_606293 unmapped Bos taurus similar to Homo sapiens likely ortholog of rat brain-enriched guanylate kinase-associated protein (KIAA1446) GGCGGCATCCATCCAAGCCTGGCCCTGAAGCCAACCTCAGACCCCCCTCATCGCACACGC A_73_101252 A_73_101252 FALSE XM_610173 XM_610173 LOC531673 ref|XM_610173 unmapped PREDICTED: Bos taurus similar to cancer susceptibility candidate 3 (LOC531673) ACACTGTGCAGGCATTGCAAATAGATGGAATTACAGCAAAATGTGCTCAATGTATTTGCC A_73_101253 A_73_101253 FALSE XM_587766 XM_587766 LOC539506 ref|XM_587766 unmapped PREDICTED: Bos taurus similar to Sterile alpha motif domain containing protein 4 (LOC539506) AGTCCCCCAGAAGCCCTTTAGTGCAGTCTGGTTTGGTGACTTGCTGTGTGTGGCATGTCC A_73_101254 A_73_101254 FALSE NM_203323 NM_203323 SSAT2 ref|NM_203323 unmapped Bos taurus polyamine N-acetyltransferase (SSAT2) AAGAGGCAGGCCTTCCCACCTCCTTGTTAAGCGTGAAAAATAAATGAGAATTCCTCCTGT A_73_101255 A_73_101255 FALSE NM_174660 NM_174660 SLC25A6 ref|NM_174660 unmapped Bos taurus solute carrier family 25 member 6 (SLC25A6) CCTCTCTTTTGCACAGCCGAATACGCGCGATTATGTTTCTCCGTCGGGCATTTCCGCTGC A_73_101256 A_73_101256 FALSE XM_612948 XM_612948 LOC533516 ref|XM_612948 unmapped Bos taurus similar to Homo sapiens RNA binding motif protein 38 (RBM38), transcript variant 1 AAGGTAGCTAATATTATAATAATATTTTTATTAGAATGTTCTGATTATAAAAAATAAAAC A_73_101257 A_73_101257 FALSE XM_867926 XM_867926 LOC615979 ref|XM_867926 unmapped Bos taurus similar to Homo sapiens chromosome 14 open reading frame 112 (C14orf112) CAGAAGCCTAGATATGAGTAATTTGATGACAAGTACTCTTGATAAAAAGTCAAGTACAGG A_73_101258 A_73_101258 FALSE XM_593890 XM_593890 LOC515804 ref|XM_593890 unmapped Bos taurus similar to Homo sapiens importin 9 (IPO9) GTGACGCCGTGCCCCACCCCCGCTGGACTAGGACACTGGGGGGCTTCAGAAGGGGCGTCA A_73_101259 A_73_101259 FALSE XM_864547 XM_864547 LOC613599 ref|XM_864547 unmapped Bos taurus similar to Homo sapiens lysyl oxidase-like 3 (LOXL3) TTTTTGTGGGGGGAAAGAGCAGTGTTCCACCCTTCCCCTCATTTTTCAGTATGACATGTT A_73_101260 A_73_101260 FALSE XM_590730 XM_590730 LOC513097 ref|XM_590730 unmapped Bos taurus similar to Homo sapiens solute carrier family 44, member 3 (SLC44A3) CCCCAAGCAAGTCTTTTCCCTTGTTTAATCGATGCATCCCTCAAACTCCTGAGTGTTATT A_73_101261 A_73_101261 FALSE XM_865328 XM_865328 LOC614024 ref|XM_865328 unmapped PREDICTED: Bos taurus similar to fatty acid desaturase 2 (LOC614024), partial mRNA. GCAGCACCTGTACTTCCATGTGTCTTGGGTCCCCTTTCTTATACCAGTATATTTCAACCT A_73_101262 A_73_101262 FALSE EE897901 EE897901 gb|Unidentified transcripts unmapped Unknown TGTGAGGCTTCCATTATCTTGCCAGTCCCTCTGCTTAACTGTTTGGATTATAAATTTTTT A_73_101263 A_73_101263 FALSE XM_870424 XM_870424 LOC618096 ref|XM_870424 unmapped Bos taurus similar to Homo sapiens transmembrane protein 151 (TMEM151) GCCCGGCCCAGCGGGCCCCGCCTGCCTTTCAGCCGCAGCCGCCTCTCGCTGGGAGCCGGG A_73_101264 A_73_101264 FALSE AV608434 AV608434 gb|Bos taurus similar to Homo sapiens smoothelin-like 2 (SMTNL2) unmapped Unknown GGGGATTTGCTGCAAATATTTATAAAAAGTAACTCCATCTGTACCATTGACTGTTTGTAC A_73_101265 A_73_101265 FALSE XM_584548 XM_584548 LOC507863 ref|XM_584548 unmapped PREDICTED: Bos taurus similar to Nesprin-2 (Nuclear envelope spectrin repeat protein 2) (Syne-2) (Synaptic nuclear envelope protein 2) (Nucleus and actin connecting element protein) (NUANCE protein) (LOC507863) ATGGCAGGTGAATCCTCCATGAAAGCCTTGTTGACAGAAAAGGAAAGTCTGAAAGTGTAA A_73_101266 A_73_101266 FALSE XM_614052 XM_614052 LOC534321 ref|XM_614052 unmapped PREDICTED: Bos taurus similar to Transcription factor SOX-6 (LOC534321), partial mRNA. TTTTTTCCAGACAATGGTAAAGTACTCAGGAATCTGGAGACGAGATATTGTAAGGCATGA A_73_101267 A_73_101267 FALSE XM_865768 XM_865768 LOC614318 ref|XM_865768 unmapped PREDICTED: Bos taurus similar to phosphatidylinositol-specific phospholipase C, X domain containing 1 (LOC614318) AGGCGAATTCATCTGGGCTGACGGGTTTGTTGGCGACGTCATCGGGTTGAACTGGAAGCT A_73_101268 A_73_101268 FALSE XM_588901 XM_588901 LOC511548 ref|XM_588901 unmapped Bos taurus similar to Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 8 (ABCB8), nuclear gene encoding mitochondrial protein CTTGTTCCAGGGGCTCTCCAACATCGCCTTCAACTGCATGGTCTTGGGCACCCTGTTTGT A_73_101269 A_73_101269 FALSE AW632383 AW632383 gb|Bos taurus similar to Homo sapiens Ras association (RalGDS/AF-6) domain family 5 (RASSF5), transcript variant 3 unmapped Unknown TCTTGCGCAGTGTGTGCTCTGGGGCTGTTTTCTTCTGAAATGTCTGTCTTATATGGGTTT A_73_101270 A_73_101270 FALSE XM_870075 XM_870075 LOC617758 ref|XM_870075 unmapped PREDICTED: Bos taurus similar to deleted in malignant brain tumors 1 isoform b precursor (LOC617758) GAAAAGGATCCAAAGGAGTTAAAGGCATTATTAAAAGCAGACAATATTTGTACACCTGTC A_73_101271 A_73_101271 FALSE XM_878246 XM_878246 LOC536558 ref|XM_878246 unmapped Bos taurus similar to Homo sapiens heat shock 70kDa protein 4 (HSPA4), transcript variant 1 GTACAGACACAGCTGTGCCTTCGGATTCAGACAAGAAGCTTCCTGAAATGGACATTGATT A_73_101272 A_73_101272 FALSE EE935861 EE935861 gb|Unidentified transcripts unmapped Unknown TACAGTAGTCAAGTCCTTGCAATTAATCTCTTAGTATATATCTCCTACAGGTTCTTCTTC A_73_101273 A_73_101273 FALSE NM_174063 NM_174063 ASZ1 ref|NM_174063 unmapped Bos taurus ankyrin repeat, SAM and basic leucine zipper domain containing 1 (ASZ1) AACTACCTTTGCCAGTACTCTGTAGGAAGAATTATGATAGTATAGAGCAGAATGCTCTTC A_73_101274 A_73_101274 FALSE none gb|Possibly (HOXD5), (HOXD6), or (HOXD7), not annotated in human or bovine genomes unmapped Unknown GGGGCACCGGAAGCTGGGGAGAAGCCACCAAGAACTCGGAATTCCGACTTAAGTCCAATT A_73_101275 A_73_101275 FALSE XM_866257 XM_866257 LOC614680 ref|XM_866257 unmapped Bos taurus similar to Homo sapiens WD repeat domain 25 (WDR25) AGAGACCACAGTGTTTTTGTATGTGGCGGCTTCAGCTCTGAAATGAAAGCTTGGGACATA A_73_101276 A_73_101276 FALSE XM_593171 XM_593171 LOC515194 ref|XM_593171 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L39 (MRPL39), nuclear gene encoding mitochondrial protein, transcript variant 1 AATGGTAACTGAAGATCAAACTAAGCCTACAGAGAAGAGTGCATCTACCTAGTAACTTCC A_73_101277 A_73_101277 FALSE CB165790 CB165790 gb|Unidentified transcripts on BTA14 position 3771902-3772673 unmapped Unknown TATGTATGCTTCAAATCCATTTCCTCTTCTGACTGCATCTTTGACACAGTCTTGAAAAAA A_73_101278 A_73_101278 FALSE NM_001001147 NM_001001147 LOC407194 ref|NM_001001147 unmapped Bos taurus cyclin T1 (LOC407194) CGGCGTTTGAATACGTTCATTCTTATGGAGAATATATGAATCCACGGGCTGGTGGAATGT A_73_101279 A_73_101279 FALSE XM_866313 XM_866313 LOC519018 ref|XM_866313 unmapped PREDICTED: Bos taurus similar to S-phase kinase-associated protein 2 isoform 1 (LOC519018) ATCGTACCAGACGGTACCCTTCAATTGTTAAAGGAAGCCCTCCCTCATCTACAGATTAAT A_73_101280 A_73_101280 FALSE BI976828 BI976828 gb|Bos taurus similar to Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2) unmapped Unknown GTTTTGAATAATGTACCAATCAGAGTGATGTTATCTGCGACTATCTCCAGTTTTAAGCTG A_73_101281 A_73_101281 FALSE NM_001035314 NM_001035314 MGC128092 ref|NM_001035314 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein S10 (MRPS10), nuclear gene encoding mitochondrial protein AGTATATAAGATGGTGTTAAGGTCTGTCTTAAACTATTGGTAGACTCAAACTTGTTCAGC A_73_101282 A_73_101282 FALSE XM_881544 XM_881544 LOC512670 ref|XM_881544 unmapped Bos taurus similar to Homo sapiens phosphorylase kinase, gamma 2 (testis) (PHKG2) CCTTATCTGTGCTGCCTGCACCACGTATGCAATAAAACCTGCTACACGCCAGATAAAAAA A_73_101283 A_73_101283 FALSE AW314927 AW314927 gb|Bos taurus similar to PREDICTED: Homo sapiens KIAA1912 protein (KIAA1912) unmapped Unknown AAAGTTTTGTGCCTGCAGTAGAACCTGCAGAAGCTAATACAAGGCACACTGGTCTTTTGA A_73_101284 A_73_101284 FALSE NM_001015552 NM_001015552 KCNA5 ref|NM_001015552 unmapped Bos taurus potassium voltage-gated channel shaker-related subfamily 5 (KCNA5) AGGGTCCTTGGAAAACACGGATGGCTCTCGAAGGGGCAGTTGCTCCCTGGAGAAGTGTAA A_73_101285 A_73_101285 FALSE XM_612608 XM_612608 LOC540676 ref|XM_612608 unmapped PREDICTED: Bos taurus similar to zinc finger protein, subfamily 1A, 3 (Aiolos) isoform 1 (LOC540676) AGGAACAACCCACCCGGAAGTTTTTTATCTCCTTCGTGGAGTATTGGTGTACAAACCCAA A_73_101286 A_73_101286 FALSE XM_601685 XM_601685 LOC523388 ref|XM_601685 unmapped Bos taurus similar to Homo sapiens within bgcn homolog (Drosophila) (WIBG) TCTCCTATCCCCAGTATTCAAGATCTCAGTGACTATCCCAGGTACCTTTGCTGCTGATTT A_73_101287 A_73_101287 FALSE NM_001037628 NM_001037628 SELPG ref|NM_001037628 unmapped Bos taurus similar to Homo sapiens selectin P ligand (SELPLG) TGGGGGCTGGGTAGGTTCCTTAGGGGACTCTGTGGACCTACAAGCTATTGTCTAGTGCCA A_73_101288 A_73_101288 FALSE BF041480 BF041480 gb|Bos taurus similar to Homo sapiens apoptosis inhibitor 5 (API5) unmapped Unknown TCTTTTGCAAGACACCTGTTTATCACTTTGTTCAAATGTAAATGTTCCCCTATGCTTTTG A_73_101289 A_73_101289 FALSE XM_609087 XM_609087 LOC530612 ref|XM_609087 unmapped PREDICTED: Bos taurus similar to Ryanodine receptor 3 (Brain-type ryanodine receptor) (RyR3) (RYR-3) (Brain ryanodine receptor-calcium release channel) (LOC530612), partial mRNA. CTACCTGTCCTTCCTGAGGTTTGCCGTCTTCGTGAACAGTGAGTCTCAGTTTCCCATGCC A_73_101290 A_73_101290 FALSE NM_001038111 NM_001038111 MGC134078 ref|NM_001038111 unmapped Bos taurus similar to Homo sapiens phosphoglycerate mutase 2 (muscle) (PGAM2) TGTGGCTGCTCAGGGAAAGGCTAAGTGAAGGGTGGGTGCTGCCAATAAAGGCACCTCCTT A_73_101291 A_73_101291 FALSE XM_585659 XM_585659 LOC508825 ref|XM_585659 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L23 (MRPL23), nuclear gene encoding mitochondrial protein TGCAGCTGGCACACGGGCAGACCTTCACATTCCCAGATCTGTTTCCCAAGGGGAAGCGGC A_73_101292 A_73_101292 FALSE XM_866526 XM_866526 LOC614884 ref|XM_866526 unmapped Bos taurus similar to Homo sapiens sperm acrosome associated 1 (SPACA1) CAACTTCTCTTGACCAGTCACCAACAGATATACCTGGACATGAAGATGATGCTTTAAGTG A_73_101293 A_73_101293 FALSE NW_928278 NW_928278 gb|Putative orthologue of human miRNA hsa-mir-216 on chr 2, (-) strand. Mature length 21 nt, stem-loop length 110 nt. Source: NW_928278.1:c635263-635157 unmapped Unknown TAATCTCAGCTGGCAACTGTGTATCCTACTATACGTATCACATAG A_73_101294 A_73_101294 FALSE XM_583545 XM_583545 LOC507007 ref|XM_583545 unmapped Bos taurus similar to Homo sapiens nucleotide binding protein 1 (MinD homolog, E. coli) (NUBP1) TCGTTGCCAAAGTCCAAGGACACATCCTCGGTATCATCCACCAGGGCCTGCTTCATCCTT A_73_101295 A_73_101295 FALSE XM_607483 XM_607483 LOC529043 ref|XM_607483 unmapped Bos taurus similar to Homo sapiens Rho guanine nucleotide exchange factor (GEF) 10-like (ARHGEF10L), transcript variant 1 CCCGCCCACGTGGCTCGCGGGCACGGGCGCTGGCTCGGGAGCCGGCCCGTCCGGCTTGTC A_73_101296 A_73_101296 FALSE AW352902 AW352902 gb|Bos taurus similar to Homo sapiens tripartite motif-containing 32 (TRIM32) unmapped Unknown CTGTTGGGTCCTCATTGTGCATTTTCCCCAAGTGAGTGCATAATTTTTGGTTGTGGGATT A_73_101297 A_73_101297 FALSE XM_584100 XM_584100 LOC507484 ref|XM_584100 unmapped Bos taurus similar to Homo sapiens serine peptidase inhibitor, Kunitz type, 2 (SPINT2) TCTGTTTGTTCTTCCAGAAGGTGAGAGGGCTGCTCCCTTGCCCCCCAGATGGGTTTGCTT A_73_101298 A_73_101298 FALSE XM_868277 XM_868277 LOC616291 ref|XM_868277 unmapped PREDICTED: Bos taurus similar to Thioredoxin- like protein 2 (PKC-interacting cousin of thioredoxin) (PKC-theta- interacting protein) (PKCq-interacting protein) (HUSSY-22) (LOC616291) CCCAAGTTAGAGGAAAGGCTCAAAGATGAAGAAGTTCAGCAAGGATTAAAAGCTTACTCC A_73_101299 A_73_101299 FALSE XM_586476 XM_586476 LOC509502 ref|XM_586476 unmapped Bos taurus similar to Homo sapiens FLJ20758 protein (FLJ20758) TGAGAACTGAACAATCACAGGGCTTTAGGCTGCACAGCTGGGAAGATGAAAGCTGTAAAT A_73_101300 A_73_101300 FALSE XM_596817 XM_596817 LOC518623 ref|XM_596817 unmapped PREDICTED: Bos taurus similar to glycine-N-acyltransferase isoform a (LOC518623), partial mRNA. TTTGTGGGCTTTATGATGAATTTTTCCCCTCTGACTTTCTATGACTTTTTAATTGGCTGG A_73_101301 A_73_101301 FALSE XM_591786 XM_591786 LOC514005 ref|XM_591786 unmapped Bos taurus similar to Homo sapiens protein phosphatase 1D magnesium-dependent, delta isoform (PPM1D) ACGGAGAGTACATCAACTCAGGCTAAATATACAATAAGAATATGATTAGGTCAGTTATGG A_73_101302 A_73_101302 FALSE XM_881689 XM_881689 LOC515124 ref|XM_881689 unmapped Bos taurus similar to Homo sapiens DKFZP564J0863 protein (DKFZP564J0863) AAAGCTCAGTAGCATCCTAATGAGAGGATCAGACAAGAACCCTTCTAGCTCCCTCTGATT A_73_101303 A_73_101303 FALSE BF602744 BF602744 gb|Bos taurus similar to Homo sapiens desmocollin 2 (DSC2), transcript variant Dsc2b unmapped Unknown AAATGGGGGATAATAAATAGAACTCCTTTTCTAGGGTTCTCCTGGGGTGGCTGTAAGACA A_73_101304 A_73_101304 FALSE XM_865356 XM_865356 LOC515537 ref|XM_865356 unmapped Bos taurus similar to Homo sapiens claudin domain containing 1 (CLDND1), transcript variant 2 TGGCGTTGCCAGTTCCTTTTACCTTTTGTTAGTCTAGGTTTGATGTGCTTTGGGGCTTTG A_73_101305 A_73_101305 FALSE BE668999 BE668999 gb|Unidentified transcripts on BTA19 position 50506354-50507483 unmapped Unknown CTTGTGTCTCTCCAGTTACATACCTGTGAATCCTGTACTTACTACTGGTTTGGGGTTGTT A_73_101306 A_73_101306 FALSE XM_607445 XM_607445 LOC529007 ref|XM_607445 unmapped PREDICTED: Bos taurus similar to Ciliary neurotrophic factor (CNTF) (LOC529007) CGACAAAGTGGGGTCCCCGCATGTGGGAGCCGTTGTGCCACCAAGGACAAGAGAATGTAG A_73_101307 A_73_101307 FALSE XM_590786 XM_590786 LOC613831 ref|XM_590786 unmapped Bos taurus similar to Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 5 GTTCTCCCAGTTTATTATGCCATCGGATGGTAAATGAGAACACTACAACTGTAGTTAGCT A_73_101308 A_73_101308 FALSE XM_581707 XM_581707 LOC505420 ref|XM_581707 unmapped PREDICTED: Bos taurus similar to Serine /threonine-protein kinase PAK 1 (p21-activated kinase 1) (PAK-1) (P68-PAK) (Alpha-PAK) (Protein kinase MUK2) (LOC505420), partial mRNA. ATGGAATATTTGGCTGGAGGTTCTTTGACAGACGTGGTAACAGAAACTTGCATGGACGAA A_73_101309 A_73_101309 FALSE XM_869627 XM_869627 LOC617379 ref|XM_869627 unmapped Bos taurus similar to Homo sapiens ring finger protein 170 (RNF170) GATTTTGTACCCGAAGCCTTGTTTGGAATTCTCGGCTTTCTCGATGATTTCTTTGTCATC A_73_101310 A_73_101310 FALSE NW_001030331 NW_001030331 gb|Bovine miRNA bta- miR-222 on chr 30, (-) strand. Mature length 24 nt, stem-loop length 110 nt. Source: NW_001030331.1:c3897-3788 unmapped Unknown AGCTACATCTGGCTACTGGGTCTCTATCCTACTATACGTATCACA A_73_101311 A_73_101311 FALSE XM_587451 XM_587451 LOC510322 ref|XM_587451 unmapped Bos taurus similar to Homo sapiens PRP3 pre- mRNA processing factor 3 homolog (S. cerevisiae) (PRPF3) GAGATGAAGTTCAAACAGTGCCCTACAGAGAACATGGCTCGGGAGCATTTCAAAAAGCAT A_73_101312 A_73_101312 FALSE XM_869254 XM_869254 LOC617072 ref|XM_869254 unmapped Bos taurus similar to Homo sapiens zinc finger CCHC-type and RNA binding motif 1 (ZCRB1) CTTATTCATGATTGGTTTATATAAGAACTTTTGAAATAAATTTCATCTTTAAAATTAAAA A_73_101313 A_73_101313 FALSE NM_001034403 NM_001034403 MGC128928 ref|NM_001034403 unmapped Bos taurus similar to Homo sapiens transmembrane protein 97 (TMEM97) TGTTTTGCTTACAAGCCCTAATGGTCTGATTTTGGGGAATATCATCTGACTCGTGTGTCT A_73_101314 A_73_101314 FALSE NM_001034791 NM_001034791 MAPBPIP ref|NM_001034791 unmapped Bos taurus similar to Homo sapiens mitogen- activated protein-binding protein-interacting protein (MAPBPIP) CTCCCTGGGGAAACCTTCCTGGACTGTTGCAGGAGATTGGAGTGGGGGGACTTTGTTCTT A_73_101315 A_73_101315 FALSE XM_869978 XM_869978 LOC617674 ref|XM_869978 unmapped Bos taurus similar to Homo sapiens 5-hydroxytryptamine (serotonin) receptor 3A (HTR3A), transcript variant 2 GCATCTACCTACTGGCAGTGCTGGCCTACAGCATCACCCTGGTCACACTCTGGTCCATTT A_73_101316 A_73_101316 FALSE NM_173989 NM_173989 AMBP ref|NM_173989 unmapped Bos taurus inter-alpha-trypsin inhibitor (protein HC), light (AMBP) AGAAGGAGTGTAAGGAGTACTGTGGCATTCCTGGTGAAGCGGATGAGGAGTTGTTGCGCT A_73_101317 A_73_101317 FALSE XM_594524 XM_594524 LOC516371 ref|XM_594524 unmapped Bos taurus similar to Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 4 (ERCC4) GATTCCGAGACTCTCCCCGAGGCAGAGAAGTATAACCCCGGTCCCCAGGACTTCTTGTTA A_73_101318 A_73_101318 FALSE XM_589701 XM_589701 DNASE2 ref|XM_589701 unmapped Bos taurus similar to Homo sapiens deoxyribonuclease II, lysosomal (DNASE2) ATCTCTGACTCATCTGTACAATGGGAATCATAACACCTTACTTAGAATTGCTGAGTAATA A_73_101319 A_73_101319 FALSE XM_588333 XM_588333 LOC511073 ref|XM_588333 unmapped PREDICTED: Bos taurus similar to Gastric inhibitory polypeptide precursor (GIP) (Glucose-dependent insulinotropic polypeptide) (LOC511073) TTCAGCTCCACTCCAAGATACTCCAAAGAAATCAAACTAAGTTTAAGCTGAAATAAATGT A_73_101320 A_73_101320 FALSE XM_867143 XM_867143 LOC529507 ref|XM_867143 unmapped Bos taurus similar to Homo sapiens RAD51-like 3 (S. cerevisiae) (RAD51L3), transcript variant 4 GCTCCTTTCCCCCTAACTCTGTCTTTGACTTACTGGGTGGAAGTAACCTTGTAAATGCAA A_73_101321 A_73_101321 FALSE XM_867225 XM_867225 LOC517617 ref|XM_867225 unmapped PREDICTED: Bos taurus similar to Rho GTPase activating protein 12 (LOC517617), partial mRNA. TTCATGTCATCACTGGAGCCCTCAAAATGTTTTTTCGAGAATTACCAGAACCTCTCTTTA A_73_101322 A_73_101322 FALSE BE758159 BE758159 gb|Bos taurus similar to Homo sapiens microtubule-associated protein, RP/EB family, member 1 (MAPRE1) unmapped Unknown GACTTTTGTTGCCCTAAAATTTCATTTTATTGGAAGCCCGCATTTTCCACCTGGTATTTC A_73_101323 A_73_101323 FALSE NM_001012669 NM_001012669 FASN ref|NM_001012669 unmapped Bos taurus fatty acid synthase (FASN) CCTTCTTCTTTGACTTCAAAGGGCCCAGCATCACCCTGGACACGGCATGCTCCTCCAGCC A_73_101324 A_73_101324 FALSE XM_584441 XM_584441 LOC507766 ref|XM_584441 unmapped Bos taurus similar to Homo sapiens zinc finger protein 217 (ZNF217) CAGCATGCTGCAAAAGAGGAACTATGAGAATTTTATTGGGAACGCACATTATCGACCAAA A_73_101325 A_73_101325 FALSE XM_614279 XM_614279 LOC541046 ref|XM_614279 unmapped Bos taurus similar to Homo sapiens leucine- rich repeat LGI family, member 2 (LGI2) CATTCTCCCACTTAAAAAGACATCCTAAAGCCTGTAATTACTGAGAAAAGAGTACAGCAT A_73_101326 A_73_101326 FALSE EE911485 EE911485 gb|Bos taurus similar to Homo sapiens KIAA0776 (KIAA0776) unmapped Unknown AACAAAAACTGTTAAATGTTTACTGTGCTCTTAATGGGCAGATTTAAGAATGTTATTTAG A_73_101327 A_73_101327 FALSE CB169939 CB169939 gb|Bos taurus similar to Homo sapiens peptidase (mitochondrial processing) alpha (PMPCA), nuclear gene encoding mitochondrial protein unmapped Unknown CTGGGTGCAGGAGTGATTTCAGGCCGTCAAATAAATGTTTCAGCTTCGGCGTCATCCGTC A_73_101328 A_73_101328 FALSE AV606275 AV606275 gb|Bos taurus similar to Homo sapiens serine/threonine kinase 3 (STE20 homolog, yeast) (STK3) unmapped Unknown ACCATTAAAAAGAAACTCATTTCTAAGCTAAATGAACATTTGCATGATTGAACCGGGACC A_73_101329 A_73_101329 FALSE XM_592640 XM_592640 LOC514743 ref|XM_592640 unmapped Bos taurus similar to Homo sapiens keratin 16 (focal non-epidermolytic palmoplantar keratoderma) (KRT16) TCCCAGAAACAATCTGGCCAAAACTGCTTCCTGAGAAGTTTGGATTGGCATCGGTCTCCC A_73_101330 A_73_101330 FALSE XM_865028 XM_865028 LOC538771 ref|XM_865028 unmapped Bos taurus similar to PREDICTED: Homo sapiens kinesin family member 5C, transcript variant 1 (KIF5C) AGGTGGGGACTCCTGCTCCATCACCACAACTGTCTGGTTTCCTGTAAAATAAACACATTA A_73_101331 A_73_101331 FALSE XM_865110 XM_865110 LOC613905 ref|XM_865110 unmapped Bos taurus similar to Homo sapiens glutathione S-transferase omega 2 (GSTO2) AAGCCTGTCGTGATTCTGCACTTCTTTTGGTGGGGCAGTCAGTCTCTCTTCATTTTCTTT A_73_101332 A_73_101332 FALSE NM_175824 NM_175824 RAP1B ref|NM_175824 unmapped Bos taurus RAP1B, member of RAS oncogene family (RAP1B) GTGGTGCAATTTTGTATAACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAG A_73_101333 A_73_101333 FALSE EE893448 EE893448 gb|Unidentified transcripts on BTA11 position 84659444-84658287 unmapped Unknown TGGGGCCCGTGTGCACTTGGCGTCATGTGTGGTCCTGTCTCCAATAAAAAGTCTCGTGGT A_73_101334 A_73_101334 FALSE EE901140 EE901140 gb|Unidentified transcripts on BTA16 position 34260612-34260047 unmapped Unknown AGGCCCAATTGAACTTGAATTTTGTGTCACATGGAGAAGTAGCCAGCATTTCTAATAGAA A_73_101335 A_73_101335 FALSE XM_590428 XM_590428 LOC539939 ref|XM_590428 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 54 (CCDC54) TTTCACTGGGCCTATCACAAACTTGACCACCATCTGTGTCTCTGTTTTCAACTACATTTA A_73_101336 A_73_101336 FALSE XM_865949 XM_865949 LOC514465 ref|XM_865949 unmapped Bos taurus similar to Homo sapiens stromal membrane-associated protein 1-like (SMAP1L) CTTTCTCCTGTGTATGTGTAAATTCCTTAATAAACATTGCAGGGAAGCAGTGCTCACTCG A_73_101337 A_73_101337 FALSE XM_605322 XM_605322 LOC526939 ref|XM_605322 unmapped PREDICTED: Bos taurus similar to Zinc finger protein 208 (LOC526939) ATGCATGCTGGAGAGCGACCTTATGAATGTACTCAATGTAGCAAAGCCTTTAGTCGAAGT A_73_101338 A_73_101338 FALSE XM_877283 XM_877283 LOC539911 ref|XM_877283 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 111 (C6orf111) CCCTCCCCGTCGTAAACGCTGAGGAATGATGTGGCAACAATGCCATGATGTTTAAAAAAT A_73_101339 A_73_101339 FALSE XM_872207 XM_872207 LOC506884 ref|XM_872207 unmapped Bos taurus similar to Homo sapiens synaptotagmin-like 3 (SYTL3) TGAGAGATGTACAAAATGACCAGATTTCAATAAATGTTCACCAGGTACCCTGGTCCCCCT A_73_101340 A_73_101340 FALSE XM_615218 XM_615218 LOC535203 ref|XM_615218 unmapped Bos taurus similar to Homo sapiens nth endonuclease III-like 1 (E. coli) (NTHL1) CGCCACTCTGGCCACTGTCTGTCTGTGCCTTTGCTGGGGAGCCGTAGCCTGTTTATAATA A_73_101341 A_73_101341 FALSE XM_866654 XM_866654 LOC532674 ref|XM_866654 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 116 (GPR116) ACTGCAACACTGAAAAATGACTCCAAAATGAAAACTGAAAATTAGCCATGGAGAAAGTTC A_73_101342 A_73_101342 FALSE NM_001034492 NM_001034492 C2 ref|NM_001034492 unmapped Bos taurus similar to Homo sapiens complement component 2 (C2) CCTCTGCTGTACTTGGCTCACTCTCCTTCTCCTTACATAGGAAATTACCCAGTTATGAAA A_73_101343 A_73_101343 FALSE XM_870606 XM_870606 LOC618274 ref|XM_870606 unmapped Bos taurus similar to Homo sapiens solute carrier family 16, member 11 (monocarboxylic acid transporter 11) (SLC16A11) TCACTCCACTCTGGACACCACTTGTTGAGCCCCTCCCCTAATAAAGACTTTTTATCTGCT A_73_101344 A_73_101344 FALSE XM_865269 XM_865269 LOC613989 ref|XM_865269 unmapped PREDICTED: Bos taurus similar to Sarcospan (K-ras oncogene-associated protein) (Kirsten-ras-associated protein) (LOC613989) ATCACTGGCACTTTAAAACTGTTCCTACTCATCCAGATGATTCTGAACTTGGTCTGTGGC A_73_101345 A_73_101345 FALSE XM_581156 XM_581156 LOC538565 ref|XM_581156 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 19 (C9orf19) TTGTAAGACATGATGTCATCTGCACGCCTCCTGGAATTCTCTAGTGGGATTGCCAAAGAA A_73_101346 A_73_101346 FALSE XM_881956 XM_881956 LOC615854 ref|XM_881956 unmapped PREDICTED: Bos taurus similar to nasal embryonic LHRH factor, transcript variant 2 (LOC615854) GGCTATGAACAATGTACGACACCCCGTAGAGTGACCATTAAATCTGACCCTCTGCCGCGC A_73_101347 A_73_101347 FALSE XM_872706 XM_872706 LOC538494 ref|XM_872706 unmapped Bos taurus similar to Homo sapiens zinc finger RNA binding protein (ZFR) GCTCTGGTATACAGATGTCATTTTGTTGTCACAGCACTACAGTGAAATACACAAATAAAA A_73_101348 A_73_101348 FALSE XM_580347 XM_580347 LOC538439 ref|XM_580347 unmapped Bos taurus similar to Homo sapiens arginine vasopressin receptor 1A (AVPR1A) TACAAGACTGTGTTTCTCCTTGCATTTTTCACATTGCTACAAGCAAAAGCAATGAATTGT A_73_101349 A_73_101349 FALSE NM_001034668 NM_001034668 BLA-DQB ref|NM_001034668 unmapped Bos taurus MHC class II antigen (BLA-DQB) TCTACTCAGATCCCAAAAGCTTCCTTTGCTCCCATTTTTACCCAACAGAGTGTGCAAAAG A_73_101350 A_73_101350 FALSE XM_591410 XM_591410 P2RX7 ref|XM_591410 unmapped Bos taurus similar to Homo sapiens purinergic receptor P2X, ligand- gated ion channel, 7 (P2RX7) AACCCTGTATTAGGATGGTAAATGAAAGACTGCTTGGGACAAGTCTGCAAGCTGTCAAAG A_73_101351 A_73_101351 FALSE NM_001037596 NM_001037596 NRM ref|NM_001037596 unmapped Bos taurus similar to Homo sapiens nurim (nuclear envelope membrane protein) (NRM) CTTGTCTTCGACTATGCAGAGCTCATGGGCCTGAAACAGGTGTACTACCATGTGCTGGGG A_73_101352 A_73_101352 FALSE XM_590492 XM_590492 LOC512890 ref|XM_590492 unmapped Bos taurus similar to Homo sapiens uncharacterized hematopoietic stem/progenitor cells protein MDS032 (MDS032) GCTGATAGTCGTCTGCTTCATCTTCATCAGCATGATCCTCTTCATCCGCATCATGCCCAA A_73_101353 A_73_101353 FALSE XM_868469 XM_868469 LOC616443 ref|XM_868469 unmapped PREDICTED: Bos taurus similar to transmembrane protein 10 (predicted) (LOC616443) GGTTCAATATTTCTTTCACCTTTTTTCTGCTGTGATGCACAAGGGCTTATTTTGGAATAA A_73_101354 A_73_101354 FALSE XM_598393 XM_598393 LOC520158 ref|XM_598393 unmapped PREDICTED: Bos taurus similar to flavin containing monooxygenase 5 (LOC520158) TCCATGCTGTGTGCCACTTTGGCTTAAAAGTATCTGTGTAGCCCTTCTCCTCTTTGTTCT A_73_101355 A_73_101355 FALSE BE809147 BE809147 gb|Bos taurus similar to Homo sapiens B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB (BDP1) unmapped Unknown GAGGCACAGATAAAAATATGATATCCACTGCTTACCACCATGTTTTTTGAAATATAGGTC A_73_101356 A_73_101356 FALSE NM_174357 NM_174357 IL1RN ref|NM_174357 unmapped Bos taurus interleukin 1 receptor antagonist (IL1RN) TGGAAAGTGTCCTGTTCTCTGTGACTTAAGCTTTGTTTTAAGATAAAAACTTGAAACCTC A_73_101357 A_73_101357 FALSE XM_868777 XM_868777 LOC616685 ref|XM_868777 unmapped Bos taurus similar to Homo sapiens tripartite motif-containing 50 (TRIM50) TACTCGTTCCAGGCTGACTTCCAGGGCAAGCTGTACCCCATCCTGGACACGTGCTGGCAT A_73_101358 A_73_101358 FALSE EE894538 EE894538 gb|Unidentified transcripts unmapped Unknown TAAGGCTATTGGAAACCTAAGAGTTTCAACTCTCTAGAGAGATTGGGTAGAGAGAAAAGA A_73_101359 A_73_101359 FALSE XM_581491 XM_581491 LOC505236 ref|XM_581491 unmapped PREDICTED: Bos taurus similar to NMDA receptor 1 isoform NR1-2 precursor (LOC505236), partial mRNA. AACTTGCATGCTCAGTGCAAAAGCGGAGAAGGTGCTGCAGTTCGACCCGGGGACCAAGAA A_73_101360 A_73_101360 FALSE XM_590696 XM_590696 LOC513072 ref|XM_590696 unmapped Bos taurus similar to Homo sapiens matrix metallopeptidase 17 (membrane-inserted) (MMP17) TCGCCACACACAGGTGCGTCCCCAAGCTGGGGCCGTGGTGGTCTTGTGACGCATTTCAAA A_73_101361 A_73_101361 FALSE NM_001015657 NM_001015657 LOC534750 ref|NM_001015657 unmapped Bos taurus similar to hypothetical protein MGC10540 (LOC534750) GGGACGGGGCCTGGCCGTGAGAGCTGGGGCCCAGCACTGATTTATGATTATTAAAAAGCT A_73_101362 A_73_101362 FALSE NM_173978 NM_173978 ACP1 ref|NM_173978 unmapped Bos taurus phosphatase 1, soluble (ACP1) CTGGGGAAATTACAAAAATGCTGAAAATAGTCATTAATATTCCCCAAGTCTTCAGAGAAG A_73_101363 A_73_101363 FALSE NM_174327 NM_174327 GNGT1 ref|NM_174327 unmapped Bos taurus guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 (GNGT1) CCCGTGGAATATCTTGAGCTTTAATGATGTACTAATGTTTGGTCACATGTAATAATATGG A_73_101364 A_73_101364 FALSE BM430374 BM430374 gb|Bos taurus similar to Homo sapiens acyl-Coenzyme A binding domain containing 3 (ACBD3) unmapped Unknown TATTGTTCCTGGGAGCAGTGTATGTTACTTCACATAGCAGCAATTCCTGTCACATGTTCA A_73_101365 A_73_101365 FALSE BI534496 BI534496 gb|Bos taurus similar to Homo sapiens zinc finger protein 90 homolog (mouse) (ZFP90) unmapped Unknown TTAGTCCCAGCAACCACACACCATGCATTTACGAACACCGAGCTTTCTAGGCAATATGAA A_73_101366 A_73_101366 FALSE AW669333 AW669333 gb|Unidentified transcripts on BTA11 position 52871509-52870624 unmapped Unknown TCAAGAAAGACTATTGGCCCTTCAGGATGACCTCAGACTATTATATGGGGGAAAAATAAA A_73_101367 A_73_101367 FALSE EE928117 EE928117 gb|Unidentified transcripts on BTA7 position 47391180-47392298 unmapped Unknown GAATGCTATGTCAACTCTCAAGAGCTAAAGAGAACAGACCAATTGCTAAATTACTGACCC A_73_101368 A_73_101368 FALSE XM_588567 XM_588567 LOC511267 ref|XM_588567 unmapped Bos taurus similar to Homo sapiens START domain containing 3 (STARD3) CACCCCCACCCCCCAGTGCCTCCTTGGGGACCTTTGTAATTTGAGCCAATTAAAAACAGG A_73_101369 A_73_101369 FALSE NM_001034445 NM_001034445 NADK ref|NM_001034445 unmapped Bos taurus similar to Homo sapiens NAD kinase (NADK) GAGAGGGGATCAGAATGAACGGGTCTATCCTACAGTCTTGAAAATAAATATGTCTCACGG A_73_101370 A_73_101370 FALSE EE908991 EE908991 gb|Unidentified transcripts on BTA2 position 25669341-25669962 unmapped Unknown TGTTAAAGTATTTGCAATGAGAAATAGCTAGCCTGATTGCAGAGGCAATTCTTGAGCACT A_73_101371 A_73_101371 FALSE XM_614744 XM_614744 SIAT4A ref|XM_614744 unmapped Bos taurus similar to Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 1 (ST3GAL1), transcript variant 1 CCAAAGACCCTTTTGACTGACAAATGCTTGTCAATTGCTGTGAGGTCATGATTCCCAGCA A_73_101372 A_73_101372 FALSE XM_591710 XM_591710 LOC513944 ref|XM_591710 unmapped Bos taurus similar to Homo sapiens staufen, RNA binding protein, homolog 1 (Drosophila) (STAU1), transcript variant T4 TCCCAACCTGCCCCTGACCCCTTTTTTATTTTTAAGAGAAAAACTTTGTAATGCTTGTGA A_73_101373 A_73_101373 FALSE NM_001035482 NM_001035482 MGC127609 ref|NM_001035482 unmapped Bos taurus similar to Homo sapiens NAD(P) dependent steroid dehydrogenase-like (NSDHL) CACGAAACCCATTGACTACTACACGGAGACAAAGATCTTACAAGAGAGAGAACGGAAAGA A_73_101374 A_73_101374 FALSE CB419917 CB419917 gb|Unidentified transcripts unmapped Unknown ACGTGTCTTCAGAGCATTGCTTTCGTGACTTGACTATTCTTCCTCTATGCTAAAGTCTAT A_73_101375 A_73_101375 FALSE EE903538 EE903538 gb|Unidentified transcripts on BTA1 position 41109953-41110785 unmapped Unknown GGGTCCAATGTTGGAAGGAAGACACTTTCTTCTGTGTATTCCTTTAAACCCTTTGCATTT A_73_101376 A_73_101376 FALSE XM_589610 XM_589610 LOC539805 ref|XM_589610 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein LOC113230 (LOC113230) TCCTTCTGGCCTTGTCTGTTAGAGGACAGGGATCCTCGGCTGGGCCTACTCCCCAATAAA A_73_101377 A_73_101377 FALSE CB538551 CB538551 gb|Unidentified transcripts on BTA16 position 51799535-51799051 unmapped Unknown TTGTGTGCCTTCCATCTTCTCTTAAACTGAATGTATGTGCAGTATATATGCAAGCTTGTG A_73_101378 A_73_101378 FALSE XM_613433 XM_613433 CLIC4 ref|XM_613433 unmapped Bos taurus similar to Homo sapiens chloride intracellular channel 4 (CLIC4) TAACAATTTGGGGTAAAAGTGTTTATTTGAGACTATCTTTTGTTTTTCTTGAGGGGGCAG A_73_101379 A_73_101379 FALSE XM_868955 XM_868955 LOC616839 ref|XM_868955 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 93 (CCDC93) TGCTCAGCAACCTTAATGGTGTAGCAACTAGAATGAAAACTCAGTGTCTGCCCTTGGCTT A_73_101380 A_73_101380 FALSE XM_880280 XM_880280 LOC506365 ref|XM_880280 unmapped Bos taurus similar to Homo sapiens zinc finger protein 76 (expressed in testis) (ZNF76) TTTTTTCCTGCTCTGGATGGTGGTGGCAAATGGGTGAATGAGTATTTAATAAAAGTTCCA A_73_101381 A_73_101381 FALSE XM_588744 XM_588744 LOC539687 ref|XM_588744 unmapped Bos taurus similar to Homo sapiens par-6 partitioning defective 6 homolog beta (C. elegans) (PARD6B) TTTGCTACTGAAATGATGTGCTTTTGCTATTTTGTCTATAGAGAACTGGATGTTAGCACA A_73_101382 A_73_101382 FALSE NM_001038540 NM_001038540 MGC133671 ref|NM_001038540 unmapped Bos taurus similar to Homo sapiens prefoldin subunit 4 (PFDN4) GCATAACAGTTATATCAACTGTAGGGGCTTCATGTCATGTTATTAAAATCAGTTAAGCAG A_73_101383 A_73_101383 FALSE XM_865882 XM_865882 LOC614025 ref|XM_865882 unmapped Bos taurus similar to Homo sapiens RNA, U3 small nucleolar interacting protein 2 (RNU3IP2) ACCAGCTCTACAGCACATCCCACGACCGCTCTGTGAAGGTGTGGAATGTGGCAGAGAACT A_73_101384 A_73_101384 FALSE NM_001012669 NM_001012669 FASN ref|NM_001012669 unmapped Bos taurus fatty acid synthase (FASN) TTTCACGAACCTGGTAAAGATGTTGTCTCCCATGATTAAATCTCTCCTTCGCTTCAAAAA A_73_101385 A_73_101385 FALSE AW658075 AW658075 gb|Bos taurus similar to Homo sapiens TBK1 binding protein 1 (TBKBP1) unmapped Unknown GGGGACTGGAAAGGGGAGGTGGGGCCCCTGAGCTCTCTGAACAAGTTGAAAGTCCAAATA A_73_101386 A_73_101386 FALSE NM_174081 NM_174081 HMCS ref|NM_174081 unmapped Bos taurus molybdenum cofactor sulfurase (HMCS) TGCTGAAAGAAAACATGGAACACCACGATATACCGGCTACCGAGTAATGTCAGGATGCTA A_73_101387 A_73_101387 FALSE XM_584929 XM_584929 LOC508185 ref|XM_584929 unmapped PREDICTED: Bos taurus similar to periplakin (LOC508185) ACCGGCCTGCGCTGTGCGCCACAGGGTTTTAGAAGCTGTTTTTCCCAGGTGGTGTTCATT A_73_101388 A_73_101388 FALSE NM_001034429 NM_001034429 MGC128335 ref|NM_001034429 unmapped Bos taurus similar to Homo sapiens similar to DNA segment, Chr 11, Brigham & Womens Genetics 0434 expressed (MGC71993) CCCATTCTGGCGCCCTCTGCGGACTAGGTTTTCTTGGCGAGAGACTCAATCCCTTGTTCT A_73_101389 A_73_101389 FALSE XM_591459 XM_591459 LOC513723 ref|XM_591459 unmapped Bos taurus similar to Homo sapiens ral guanine nucleotide dissociation stimulator (RALGDS), transcript variant 1 TACCAGTTGGGGAGGGGCAATATTTATTTGTTGTAAATAGCAGATGCTAGACTTGAATCT A_73_101390 A_73_101390 FALSE NM_001037444 NM_001037444 HDAC1 ref|NM_001037444 unmapped Bos taurus similar to Homo sapiens histone deacetylase 1 (HDAC1) CTCTCTCTGTCTTTCCCCCAGTTCTGCAGGTGAAGATTGGTAGTCTAGTTTCCATTTTGA A_73_101391 A_73_101391 FALSE XM_877987 XM_877987 LOC533403 ref|XM_877987 unmapped Bos taurus similar to Homo sapiens protein inhibitor of activated STAT, 2 (PIAS2), transcript variant beta ATTCAGCTGTAACTGTATCCTCCTGAGAGATGGATTTCAAGTTCATGTTACTGGATAGAT A_73_101392 A_73_101392 FALSE XM_870184 XM_870184 LOC617860 ref|XM_870184 unmapped Bos taurus similar to Homo sapiens spermatogenesis associated, serine-rich 2 (SPATS2) CTATGACCTTAGGCTGCAAACCAGTCTAGGGAAGTCTATGGGAAAGTAGCATTAATTCAA A_73_101393 A_73_101393 FALSE XM_613486 XM_613486 LOC540864 ref|XM_613486 unmapped Bos taurus similar to Homo sapiens small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta (SGTB) ATACAGCAGCAGAATCCTGAACTCATAGAGCAACTTAGAAATCACATCCGGAGCAGGTCA A_73_101394 A_73_101394 FALSE XM_586246 XM_586246 LOC509309 ref|XM_586246 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 4, subfamily M, member 1 (OR4M1) ATCTACACACTGCGAAACAAGGAAGTAAAAATGGCCATGAGGAAGCTAGTCAACCGATAC A_73_101395 A_73_101395 FALSE XM_608833 XM_608833 LOC530363 ref|XM_608833 unmapped Bos taurus similar to Homo sapiens kinase suppressor of ras 2 (KSR2) TCATGGACATGCTGGAGAAACTGCCAAAGCGAAACCGCCGCCTGTCTCACCCTGGACATT A_73_101396 A_73_101396 FALSE XM_869012 XM_869012 LOC539286 ref|XM_869012 unmapped Bos taurus similar to Homo sapiens La ribonucleoprotein domain family, member 4 (LARP4), transcript variant 1 CTCAGTGAATACAGTTGTAACTCTTATATGAAATAGGCAAGTTTACATGCTGGTGTTTAG A_73_101397 A_73_101397 FALSE XM_615420 XM_615420 LOC541272 ref|XM_615420 unmapped PREDICTED: Bos taurus similar to Iduronate 2-sulfatase precursor (Alpha-L-iduronate sulfate sulfatase) (Idursulfase) (LOC541272) TTCATGCAGGGGAACTGTATTTTGTAGCTTCTGACCCTTTGCAGGATCACAATGTGTATA A_73_101398 A_73_101398 FALSE XM_588946 XM_588946 LOC511583 ref|XM_588946 unmapped Bos taurus similar to Homo sapiens hypothetical protein BC001096 (LOC92689) CTTCTTAGCAATTTATTTTGCAATATCCTGCATTTCATTTGTGAATCTCCTGAAACAGCC A_73_101399 A_73_101399 FALSE XM_594044 XM_594044 LOC515935 ref|XM_594044 unmapped Bos taurus similar to Homo sapiens N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase (NAGPA) GCTCTCTCTTTTGCCCTGCCGCTGAGAGGGTTTTTCTACCACTTGAATAAATTGATAAAA A_73_101400 A_73_101400 FALSE NM_174769 NM_174769 SMT3H2 ref|NM_174769 unmapped Bos taurus MIF2 suppressor (SMT3H2) TCTTTCATTTTCCCCTTCCCCATTCCTTTATTGTACATAAAGTAACTGGTGTATGTGCAC A_73_101401 A_73_101401 FALSE XM_595830 XM_595830 LOC517656 ref|XM_595830 unmapped Bos taurus similar to Homo sapiens NFS1 nitrogen fixation 1 (S. cerevisiae) (NFS1), nuclear gene encoding mitochondrial protein, transcript variant 1 TGACCTAATGGAGCTAGAAATATCTGTATGACTGAGTCTACCTAGTCTTGTAGTAATTTA A_73_101402 A_73_101402 FALSE CB465298 CB465298 gb|Unidentified transcripts on BTA14 position 1720704-1719619 unmapped Unknown AGTTTGGTGCAAGTCTATCTGCGCCTATTAAAAAGTGATGTATATACTTCCTTCTTATTC A_73_101403 A_73_101403 FALSE CB440569 CB440569 gb|Bos taurus similar to Homo sapiens mastermind-like 1 (Drosophila) (MAML1) unmapped Unknown TACTTCCTTAACTCTGGTATACACCAAAAAGAAGTCTTTACTTTCCTGTTTTATCACTAT A_73_101404 A_73_101404 FALSE XM_590284 XM_590284 LOC512718 ref|XM_590284 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ14981 (FLJ14981) GGGGCTCAGATTATATAATAAAGGAGAAACGGGCCAGGTGTCTCTCAGGTGCTGTGACTG A_73_101405 A_73_101405 FALSE BF073980 BF073980 gb|Unidentified transcripts on BTA7 position 929303-930152 unmapped Unknown CTTGGGAGCCTGCAACCTTTACCTTTGTCCTCTTGCTTTTCTCCAAATGTACTGTTCTTT A_73_101406 A_73_101406 FALSE BM285494 BM285494 gb|Unidentified transcripts on BTA3 position 64087049-64086499 unmapped Unknown CTGGTAGTGTGAAGCTTAAATGAATTAGTGTTTGTGGTGCTCTTAGTACCAAGCATTAAT A_73_101407 A_73_101407 FALSE NW_928976 NW_928976 gb|Putative orthologue of human miRNA hsa-mir-130a on chr 11, (+) strand. Mature length 22 nt, stem-loop length 89 nt. Source: NW_928976.1:c304291-304208 unmapped Unknown CAGTGCAATGTTAAAAGGGCATTATCCTACTATACGTATCACATA A_73_101408 A_73_101408 FALSE BM031304 BM031304 gb|Unidentified transcripts on BTA5 position 68112781-68112208 unmapped Unknown GCCAAGGGACCTGATCCCCCCACTCCCTGAGCTTGTGTGAGATTAAACACTTCCTGGGAA A_73_101409 A_73_101409 FALSE AF317556 AF317556 gb|Bos taurus MHC class I-like family A1 (MHCLA1) unmapped Unknown AAATGGAATCACATGAATTTTTTCATTTCCACGGCACATAATACTGTGTTGACATGGAAG A_73_101410 A_73_101410 FALSE CB454209 CB454209 gb|Unidentified transcripts unmapped Unknown TGTTTCACTGATTGTATTTGGAATGTAATTTTCCCACACATGGATTTGTTATGAATGCCG A_73_101411 A_73_101411 FALSE XM_612893 XM_612893 LOC540740 ref|XM_612893 unmapped Bos taurus similar to Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 1 CCCAGCTGTCTGGCAGCATTCTGCTATGAGAACGAACTTGCTCTGAGCTGCTGCCAGGAA A_73_101412 A_73_101412 FALSE XM_605293 XM_605293 LOC526910 ref|XM_605293 unmapped PREDICTED: Bos taurus similar to HIV TAT specific factor 1 (LOC526910) GAGGGGAAACTGGATTAACTCAGAAATGTTTACTGAACATCCACTATGTGCCAGGTGGTG A_73_101413 A_73_101413 FALSE XM_592388 XM_592388 LOC540222 ref|XM_592388 unmapped Bos taurus similar to Homo sapiens KIAA0423 (KIAA0423) GGTGCTTCTCTAGCTTTTCTCAGAATTCTTGGGCTACAAGTACTGTGATGCATCTTAAAA A_73_101414 A_73_101414 FALSE XM_610880 XM_610880 LOC532366 ref|XM_610880 unmapped Bos taurus similar to Homo sapiens ADAM metallopeptidase domain 21 (ADAM21) AATTGCTGTGTTTATGTATCTTCAAAAACGTTTTAGACCCAAGAAGACTAAGACTCACTC A_73_101415 A_73_101415 FALSE CB431529 CB431529 gb|Unidentified transcripts on BTA11 position 15791640-15792436 unmapped Unknown TATTTGTACCATTCCTTTTAGGGTAGCCACTTTTACAAAATGTCTCCTTTCAAAAGTCTC A_73_101416 A_73_101416 FALSE XM_612564 XM_612564 LOC533229 ref|XM_612564 unmapped Bos taurus similar to Homo sapiens ethanolamine kinase 2 (ETNK2) TCATCATTTCCTGCATTAAAATGGTCACGTATGGGCCAACCTGACAGCCACTAGTTTGGA A_73_101417 A_73_101417 FALSE XM_586029 XM_586029 LOC539265 ref|XM_586029 unmapped Bos taurus similar to Homo sapiens zinc finger protein 502 (ZNF502) AGGGACGAAGGCTGTGAGAAAACCAAGCCTGATGGCACAGTGTTAAATGACTTGAAAAGA A_73_101418 A_73_101418 FALSE XM_603011 XM_603011 LOC524681 ref|XM_603011 unmapped PREDICTED: Bos taurus similar to EMSY protein (LOC524681) CTGTGAAAATAACCTTCACCAAACCATCAACACAGACGACAAACTCAACAACACAGAAGT A_73_101419 A_73_101419 FALSE XM_581225 XM_581225 LOC505006 ref|XM_581225 unmapped Bos taurus similar to Homo sapiens chromosome 21 open reading frame 6 (C21orf6) TTTTTTCATTCTGCAAGTGGCTTTCTGTAAATCTGCTTTCAGCAAATTGACCCACTCAAA A_73_101420 A_73_101420 FALSE NM_001034540 NM_001034540 MGC128107 ref|NM_001034540 unmapped Bos taurus similar to Homo sapiens peroxisomal biogenesis factor 19 (PEX19) CCTGACAAATAAATATTCTGAGTGAGGACGGTAGTCTGTATTTCATCCAGCTCTTTTCCT A_73_101421 A_73_101421 FALSE XM_587802 XM_587802 LOC539510 ref|XM_587802 unmapped Bos taurus similar to Homo sapiens growth differentiation factor 10 (GDF10) AAGAACCTCTGTTTAAATAATCGGTTTAAAACACTTTGGGCCACAGAGTGATGCTGGAAA A_73_101422 A_73_101422 FALSE NM_001038203 NM_001038203 MGC134438 ref|NM_001038203 unmapped Bos taurus similar to Homo sapiens chromosome 12 open reading frame 50 (C12orf50) AAATTACAAACAGCTGCCTGTGTATTTGTATAGGTCTGGGATTCATTTTGATGCATTGCC A_73_101423 A_73_101423 FALSE NM_001038048 NM_001038048 NUP50 ref|NM_001038048 unmapped Bos taurus similar to Homo sapiens nucleoporin 50kDa (NUP50), transcript variant 3 GGCTCCCTGTGCTTTGTCACGTCGCTTTACAGCTGGGATGTTTGCCTTCAGCAGAGGAGT A_73_101424 A_73_101424 FALSE BE756863 BE756863 gb|Bos taurus similar to Homo sapiens ubinuclein 1 (UBN1) unmapped Unknown GCTTTTGTGCAGCGACTATGTTGGTGTTGGGGGTGGTGTGGAAATTGTTAATCTTGTATA A_73_101425 A_73_101425 FALSE NM_001038677 NM_001038677 MGC134498 ref|NM_001038677 unmapped Bos taurus similar to Putative protein C21orf56 homolog (MGC134498) TACAACCGCGACGTGCACCCTGTGTTCAGCGAGTTCCTCATCAACACCTACGGCATTCTG A_73_101426 A_73_101426 FALSE CB223242 CB223242 gb|Bos taurus similar to Homo sapiens mucin 2, oligomeric mucus/gel-forming (MUC2) unmapped Unknown CTCTGCAGGTATTTATTTTCTGAGCCTTTGTTCGATTCTTTGCTTTCCAAAATAAACTTG A_73_101427 A_73_101427 FALSE BF076063 BF076063 gb|Bos taurus similar to Homo sapiens ABI gene family, member 3 (NESH) binding protein (ABI3BP) unmapped Unknown ATGCTGCATTGGTGCCCTCATTCTTAAAGGACCTTTCTGTGCTTACCTTTGAACATGCTT A_73_101428 A_73_101428 FALSE XM_603994 XM_603994 LOC525641 ref|XM_603994 unmapped Bos taurus similar to Homo sapiens glutamate receptor, metabotropic 8 (GRM8) AGAGAGTGGTGTGGAGGCCTTCACTCAGATCTCGAGGGAGATTGGTAAGTGTATATTTAT A_73_101429 A_73_101429 FALSE XM_595416 XM_595416 LOC517248 ref|XM_595416 unmapped PREDICTED: Bos taurus similar to imprinted and ancient (LOC517248) AGCTCCACCTATTTATCAACTGAATGCTCCTTGGCTTAAAGGGCAAGAACGGGCAGATTT A_73_101430 A_73_101430 FALSE XM_585363 XM_585363 LOC508571 ref|XM_585363 unmapped Bos taurus similar to Homo sapiens ATG3 autophagy related 3 homolog (S. cerevisiae) (ATG3) GGTTCTGATTTTTAAGGAATTAACCCATAGATGTGACCATTGACCATATTCACCAATATG A_73_101431 A_73_101431 FALSE XM_869842 XM_869842 LOC617564 ref|XM_869842 unmapped Bos taurus similar to Homo sapiens dihydrodiol dehydrogenase (dimeric) (DHDH) AGGAAGGCCATTGGAATCACCTTCCCCCAAGACAAACACTGATGTATGCTCTGAACAAAT A_73_101432 A_73_101432 FALSE BM251639 BM251639 gb|Bos taurus similar to Homo sapiens phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha) (PIK3R1), transcript variant 2 unmapped Unknown GGGGACTGTGCCTCCTTGACATTTGTTCAAGCTATAGGTTCAATGGAGCTATGTCTTGTT A_73_101433 A_73_101433 FALSE NM_001008663 NM_001008663 KRT5 ref|NM_001008663 unmapped Bos taurus keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types) (KRT5) AAACAGAGTCCTCACCCCAATCCCATCTGGTCTGACTATCTCCAGATTGTGTTCAATAAA A_73_101434 A_73_101434 FALSE NM_001037602 NM_001037602 ALKBH3 ref|NM_001037602 unmapped Bos taurus similar to Homo sapiens alkB, alkylation repair homolog 3 (E. coli) (ALKBH3) AGCCACGAGTGATTGAAAAAGAGGGTGTGTATGAAATCAGCATGTCACCCACAGGCATAT A_73_101435 A_73_101435 FALSE BI536702 BI536702 gb|Bos taurus similar to Homo sapiens suppression of tumorigenicity 14 (colon carcinoma) (ST14) unmapped Unknown AGGGTGGGGTTCACTGTGTGTATTTGTGTGTATGAGTAAAACGCTTTATTTCTTTTTAAA A_73_101436 A_73_101436 FALSE XM_596084 XM_596084 LOC517903 ref|XM_596084 unmapped Bos taurus similar to Homo sapiens rhomboid 5 homolog 2 (Drosophila) (RHBDF2), transcript variant 1 TGGTCCTAATTTTTTAAAGTAACGCTAACTTTGTATGGACAACGTCTGAAATGAATTAAA A_73_101437 A_73_101437 FALSE XM_864613 XM_864613 CLCN5 ref|XM_864613 unmapped Bos taurus similar to Homo sapiens chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) (CLCN5) GAAGGAAAGCCAGAAGGAAAATAGTAATGGTATTTTCCAGACTGTGAATTCAGTTCAAAT A_73_101438 A_73_101438 FALSE XM_618115 XM_618115 LOC537927 ref|XM_618115 unmapped PREDICTED: Bos taurus similar to membrane- associated RING-CH protein IX (LOC537927) GGAATGTAATTGCAATGAATGGCAAAACCATAGCACTTCTAAAAACACACATCTATGAAC A_73_101439 A_73_101439 FALSE CB451465 CB451465 gb|Unidentified transcripts unmapped Unknown TGTTACCGTCTACATACCAACTCTGCCTTTCTGACAATAAATACACCTGACCCTGGAGAA A_73_101440 A_73_101440 FALSE BM251685 BM251685 gb|Unidentified transcripts on BTA2 position 69070053-69070737 unmapped Unknown CTTGGTTTGACTGTATCCAGGGCTCTTGTACCCACAAATTCAACCAACAGCACCGAAAAT A_73_101441 A_73_101441 FALSE CB422192 CB422192 gb|Unidentified transcripts unmapped Unknown TTGCCTTCCCCACCCCACCCTAACTTGGAAATCTTTTTTAAATAAAGCTTTAGCCTGAAA A_73_101442 A_73_101442 FALSE XM_612430 XM_612430 LOC533125 ref|XM_612430 unmapped Bos taurus similar to Homo sapiens RAS guanyl releasing protein 1 (calcium and DAG-regulated) (RASGRP1) CCTAATGTAAGTTTTCTTTGTGTAATATTTATATGATAAAAGACAGTAGAATCCCTACGA A_73_101443 A_73_101443 FALSE XM_602377 XM_602377 LOC524059 ref|XM_602377 unmapped PREDICTED: Bos taurus similar to protein tyrosine phosphatase, receptor type, T (LOC524059) CAACATGGTGGAGACCCTGGACCAGTATAAATTTGTATACGAGGTGGCGCTGGAATATTT A_73_101444 A_73_101444 FALSE XM_616567 XM_616567 LOC536436 ref|XM_616567 unmapped Bos taurus similar to Homo sapiens leucine- rich repeat kinase 2 (LRRK2) AAGGTACACAACACCAAAAAGAGATACAGTCTTGCTTGTCTGTTTGGGACATCAATCTTC A_73_101445 A_73_101445 FALSE BM483215 BM483215 gb|Unidentified transcripts on BTA4 position 19997982-19998661 unmapped Unknown GATTTATCAACATCAACTTCCAGTATAGCTATTTACTTAACAAAGTGAGTTATGCCCCTG A_73_101446 A_73_101446 FALSE XM_608015 XM_608015 LOC529564 ref|XM_608015 unmapped PREDICTED: Bos taurus similar to ring finger protein 12 (LOC529564) AGATTCAGAAGCTAGCACACTGATGACGTTTGAAGACAGTGAAGAAAGAAGCTCATCAAC A_73_101447 A_73_101447 FALSE XM_590101 XM_590101 LOC512562 ref|XM_590101 unmapped Bos taurus similar to Homo sapiens melanoma antigen family D, 1 (MAGED1), transcript variant 2 TTGCTTACCCCCTCCCTTGTGTGCTGTCAAGTTTTGGTATCAGAAATAAACGTTGAAACT A_73_101448 A_73_101448 FALSE CB422416 CB422416 gb|Bos taurus similar to Homo sapiens zinc finger protein 365 (ZNF365), transcript variant A unmapped Unknown TAAACCTTAAAATCATTTGTCTTGTATAATGTACACAGAGTAGATAGGGCATTACGGTGC A_73_101449 A_73_101449 FALSE XM_614351 XM_614351 LOC534547 ref|XM_614351 unmapped PREDICTED: Bos taurus similar to Serine /threonine-protein kinase 3 (STE20-like kinase MST2) (MST-2) (Mammalian STE20-like protein kinase 2) (Serine/threonine-protein kinase Krs-1) (LOC534547), partial mRNA. AAGGAATCTGGTCAAGTTGTGGCAATTAAACAAGTACCTGTTGAGTCAGATCTTCAGGAA A_73_101450 A_73_101450 FALSE EE890065 EE890065 gb|Unidentified transcripts on BTA15 position 23878964-23878277 unmapped Unknown CTTATCTTTCCCAGCAGAAATTAAGTCCTCAGAGTTAGTGTTGACACATCTCTGTCCCCA A_73_101451 A_73_101451 FALSE NM_001034395 NM_001034395 HNRPC ref|NM_001034395 unmapped Bos taurus similar to Homo sapiens heterogeneous nuclear ribonucleoprotein C-like 1 (HNRPCL1) TTTTTGTTGAGTGCTGAATTGTTTCATCCTTAAGTAGAAGAGGTTCAAACATGTCAAGAG A_73_101452 A_73_101452 FALSE XM_614683 XM_614683 CDH3 ref|XM_614683 unmapped Bos taurus similar to Homo sapiens cadherin 3, type 1, P-cadherin (placental) (CDH3) TAGAACTTTTTTATTAAAGGAACTTTTTCCCAGAGGTGGCAGGGGAGTGAAGTTTTGGGG A_73_101453 A_73_101453 FALSE XM_590135 XM_590135 LOC512593 ref|XM_590135 unmapped Bos taurus similar to Homo sapiens FYVE, RhoGEF and PH domain containing 2 (FGD2) TGATTCTCAGTCCCGGCTGTGCATGAACTGACAGAAAAATAAAGATAAAAATAAGTTAAA A_73_101454 A_73_101454 FALSE NM_001034280 NM_001034280 LTA4H ref|NM_001034280 unmapped Bos taurus similar to Homo sapiens leukotriene A4 hydrolase (LTA4H) ACTGCCATGCTTGTGGGGAAAGATTTAAAAGTGGATTAAGGACCTGCCCATTGCTGATGT A_73_101455 A_73_101455 FALSE CB467551 CB467551 gb|Unidentified transcripts on BTA20 position 14534102-14535384 unmapped Unknown GCATGTTTGTACATGAAGTGTCACACAGTTCATTTGATTTCTAAGAAACAACCAAATTGG A_73_101456 A_73_101456 FALSE NM_174331 NM_174331 GPRK5 ref|NM_174331 unmapped Bos taurus G protein-coupled receptor kinase 5 (GPRK5) TGTTCTCCTGCTGCTCTGAATCTTTGTATGTTTCCTCGAATATGTCACAGTGCTGCTGTA A_73_101457 A_73_101457 FALSE CB535812 CB535812 gb|Unidentified transcripts on BTA18 position 51375637-51375176 unmapped Unknown ATTTGGGGGGAAATCACAATCCTTTGTATCTCTGTTTTCCAACTACTTGTGAGTCAGTTT A_73_101458 A_73_101458 FALSE XM_609742 XM_609742 LOC531254 ref|XM_609742 unmapped Bos taurus similar to Homo sapiens collagen, type XXIV, alpha 1 (COL24A1) ACGTGTTGCCTTTTTGTGTTGCTTGGTGCTCTTTCTAAAACAAGGTGCTTGTGGCTTTCA A_73_101459 A_73_101459 FALSE XM_617874 XM_617874 LOC537697 ref|XM_617874 unmapped PREDICTED: Bos taurus similar to Thyrotropin- releasing hormone degrading ectoenzyme (TRH-degrading ectoenzyme) (TRH-DE) (TRH-specific aminopeptidase) (Thyroliberinase) (Pyroglutamyl-peptidase II) (PAP-II) (LOC537697) CTTGGGCAATTTGCAACTTCACATACAGAGAAACTACCACCAAGAGTGGGGTTGCAGTAA A_73_101460 A_73_101460 FALSE NM_001017940 NM_001017940 bubp43 ref|NM_001017940 unmapped Bos taurus putative ubiquitin-specific protease (bubp43) TGTATTGATCACCTACTTTGTGAAATGGTATGCCAGACAGTAATGAATACAATCTTTCTG A_73_101461 A_73_101461 FALSE EE930536 EE930536 gb|Unidentified transcripts on BTA1 position 40993844-40993456 unmapped Unknown AGATGCTTCCAGTTTTGGCCATTAGGAGCTCAGTCTGAGTTTAAGTGACCTGTACGTGTA A_73_101462 A_73_101462 FALSE NM_001037629 NM_001037629 TIMM8B ref|NM_001037629 unmapped Bos taurus similar to Homo sapiens translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B) TTCCAAGGCCATTAGTAGTGCAAATGAGAGATCTTAGGTTTTGAAGAGCCATCCTAAGCC A_73_101463 A_73_101463 FALSE XM_864393 XM_864393 LOC504847 ref|XM_864393 unmapped Bos taurus similar to Homo sapiens cyclin I (CCNI) AGCTCCCTGTGCAGTCTGAAGAAGGTATTGCAGTCAGAACCATGTACTGATGATAAAAGC A_73_101464 A_73_101464 FALSE XM_863937 XM_863937 LOC613340 ref|XM_863937 unmapped PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript variant 1 (LOC613340) GAGGTGGTCAATAAATTGATTCCAGATAGCATTGGAAAAGACATAGAAAAGGCTTGCCAA A_73_101465 A_73_101465 FALSE XM_617869 XM_617869 LOC537692 ref|XM_617869 unmapped PREDICTED: Bos taurus similar to C03A3.3 (LOC537692) TCAAAAGCTGGGATATGCCATAAAGTCTCTACTTTTGCCATGCGATCTCTTGCAAGTTTA A_73_101466 A_73_101466 FALSE AW653997 AW653997 gb|Unidentified transcripts unmapped Unknown GTTTGAAATTGCTGAGGGTAATGAAACATCAAAGCTCACATCAGAAGAAAAACGTTCTAT A_73_101467 A_73_101467 FALSE NM_174642 NM_174642 HSD11B2 ref|NM_174642 unmapped Bos taurus hydroxysteroid (11-beta) dehydrogenase 2 (HSD11B2) AAGCCCCCCAAGGCACAGGGAGGCTACATACTCACCTTATTGCCACTTTTTTAATAAAGA A_73_101468 A_73_101468 FALSE XM_595107 XM_595107 LOC516947 ref|XM_595107 unmapped PREDICTED: Bos taurus similar to Forkhead box protein G1B (Forkhead-related protein FKHL1) (Transcription factor BF-1) (Brain factor 1) (BF1) (LOC516947) TCCGGGGGACTGTCTGATTATTTCACACATCAAAATCAGGGGTCTTCTTCCAACCCTTTA A_73_101469 A_73_101469 FALSE XM_608055 XM_608055 LOC529603 ref|XM_608055 unmapped Bos taurus similar to Homo sapiens hypocretin (orexin) receptor 2 (HCRTR2) AGTAGTATAATACCAAATCACTCTGGGTCCCATATTGGACAGGTTAATGTCATGGAGAGT A_73_101470 A_73_101470 FALSE XM_611868 XM_611868 LOC532712 ref|XM_611868 unmapped Bos taurus similar to Homo sapiens cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), transcript variant 1 GGTTATCTTCCCCACCTTCCCCAAATCCTAATTCTTGTAGATTTCATTAGTGTTGAACCA A_73_101471 A_73_101471 FALSE XM_869311 XM_869311 LOC617120 ref|XM_869311 unmapped PREDICTED: Bos taurus similar to phospholipase D family, member 3 (LOC617120), partial mRNA. AACACAAGCATCATTAAGCAACTCAAGGATGTGTTTGAGAGGGACTGGTACTCGCCCTAT A_73_101472 A_73_101472 FALSE NM_001034565 NM_001034565 TRMT5 ref|NM_001034565 unmapped Bos taurus similar to Homo sapiens TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5) TTGCTTCAGCCACTTAACTGGAAATATTTTCTCCATCTCCCCACTAGACCTTTGTGATAG A_73_101473 A_73_101473 FALSE NM_001015565 NM_001015565 PCBP1 ref|NM_001015565 unmapped Bos taurus poly(rC) binding protein 1 (PCBP1) TCATCCGCTAAGAATTTAAAAATCACATTCTCTGTTCAGCTGTTAATGCTGGGATCCATA A_73_101474 A_73_101474 FALSE XM_613187 XM_613187 LOC533703 ref|XM_613187 unmapped PREDICTED: Bos taurus similar to CG11388-PA (LOC533703) TCTATAGCTTGAGTGGACTTTATCATTGCAAGGAAAAAGCAATAAACTGATCAAAATGGG A_73_101475 A_73_101475 FALSE XM_868561 XM_868561 LOC616527 ref|XM_868561 unmapped PREDICTED: Bos taurus similar to leucyl-tRNA synthetase, mitochondrial (LOC616527) TTCAGCTGGGACAGGGTGGTGCTAGTGGTAAAGAACCTCCTGGCGATGCTGAAGACTTAA A_73_101476 A_73_101476 FALSE XM_870392 XM_870392 LOC618062 ref|XM_870392 unmapped Bos taurus similar to Homo sapiens tryptophan hydroxylase 2 (TPH2) GCAGCGATTTGAACACCGTGTGTGATGCCTTGAACAAAATGAACCAGTATCTGGGGATTT A_73_101477 A_73_101477 FALSE CB442659 CB442659 gb|Bos taurus similar to PREDICTED: Homo sapiens hypothetical LOC440309 (LOC440309) unmapped Unknown GGAGAAAAAGATGGCACATTAACAGATGATAGTTTGTATGCCTGGAATTTTTTCAGTTTG A_73_101478 A_73_101478 FALSE XM_609018 XM_609018 LOC530544 ref|XM_609018 unmapped Bos taurus similar to Homo sapiens calpain 12 (CAPN12) TGCGTGTGGACTTTGAGCGCTTCGTGTCCTGCATGGCCCAGCTCATCTGCGTCTTCCGCT A_73_101479 A_73_101479 FALSE XM_868433 XM_868433 LOC513253 ref|XM_868433 unmapped Bos taurus similar to Homo sapiens ER degradation enhancer, mannosidase alpha-like 2 (EDEM2) TTTACGTCGAAGCTGGCATTACTGGGACAGGTTTTCCTAGATTCCTCATAACCACTGGAT A_73_101480 A_73_101480 FALSE BE667665 BE667665 gb|Unidentified transcripts on BTA1 position 30127504-30126230 unmapped Unknown TTTCCCTTTCCCCATTCCCTTGTAAATACATTTCGTTCTATGTGACTTGGTTTGGAAATA A_73_101481 A_73_101481 FALSE NM_001035111 NM_001035111 MGC127792 ref|NM_001035111 unmapped Bos taurus similar to Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 (PSMD8) CCAGGCCAAGGTACCAGTGTTCAGTGAAGGGGGTGAAATGTCCTGATATTGAAAAATACT A_73_101482 A_73_101482 FALSE XM_864419 XM_864419 LOC613531 ref|XM_864419 unmapped PREDICTED: Bos taurus similar to CUB and sushi multiple domains protein 1 precursor (LOC613531) TTCAACATCACCTACACCACATTTGGTCAAAATGAGTGTCATGATCCTGGCATCCCCATA A_73_101483 A_73_101483 FALSE XM_866426 XM_866426 LOC614796 ref|XM_866426 unmapped Bos taurus similar to Homo sapiens chromosome 14 open reading frame 101 (C14orf101) TTCTATCCTCCATGCCTCGTGATGCAATTATCTTACTCAGAGGAGATCTGCCAGGGAATT A_73_101484 A_73_101484 FALSE BF775397 BF775397 gb|Bos taurus similar to Homo sapiens S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2 unmapped Unknown AGGATCCGGTTGGCCTCTTATTTCCGGATACCCTCACACATACAGTACTTCAAAACTCAA A_73_101485 A_73_101485 FALSE XM_585895 XM_585895 LOC509019 ref|XM_585895 unmapped Bos taurus similar to Homo sapiens zinc finger and BTB domain containing 7B (ZBTB7B) ACCACACCTCAGGCTGAAGGTGCCATGGACACCTCTTAAAGAGGGACGAGTGGCCGAGCT A_73_101486 A_73_101486 FALSE XM_606689 XM_606689 LOC528273 ref|XM_606689 unmapped Bos taurus similar to Homo sapiens glucocorticoid receptor DNA binding factor 1 (GRLF1) TATGTCATCTCTCACCTGAACAAAGTCAGCCACAACAACAAGGTGAACCTCATGACCAGT A_73_101487 A_73_101487 FALSE XM_618056 XM_618056 LOC537869 ref|XM_618056 unmapped PREDICTED: Bos taurus similar to Glutamate receptor, ionotropic kainate 1 precursor (Glutamate receptor 5) (GluR-5) (GluR5) (LOC537869) ACCACATTAACCTACGATATCCAGAAAATTAACCTTTTTGATAGTTTCGAAGCCTCACGG A_73_101488 A_73_101488 FALSE NM_001038069 NM_001038069 MGC134304 ref|NM_001038069 unmapped Bos taurus similar to Homo sapiens tektin 4 (TEKT4) AGTCCCTGCGCAACCTGGAGGACACGCGCATGAGCCTGGAGAAGGACATCGCGATCAAGA A_73_101489 A_73_101489 FALSE XM_587895 XM_587895 LOC510718 ref|XM_587895 unmapped Bos taurus similar to Homo sapiens kazrin (KIAA1026), transcript variant B GATGACTATGGCTCTCTTCAAAATGAAGATTGCGGAGACGAGGACTCCCAGGGCAGGCCG A_73_101490 A_73_101490 FALSE NM_176627 NM_176627 PAG17 ref|NM_176627 unmapped Bos taurus pregnancy-associated glycoprotein 17 (PAG17) TGGTCCAGAATCAAGTAAGGCCTCTCCTAAATAATTCACTCACCCTTTGAGCACTCCTTC A_73_101491 A_73_101491 FALSE NM_001034257 NM_001034257 APOM ref|NM_001034257 unmapped Bos taurus similar to Homo sapiens apolipoprotein M (APOM) CTTCACCTATGCCCCCCAGATGGATACAGTGGGAACTTGTATGGTGAGAGGAGAAGCTGG A_73_101492 A_73_101492 FALSE XM_869476 XM_869476 LOC617251 ref|XM_869476 unmapped PREDICTED: Bos taurus similar to CH-TOG protein (Colonic and hepatic tumor over-expressed protein) (Ch-TOG protein) (LOC617251) TTCAAAGAAGCAAGCGGACCGAGAACCCAGACGACATCAAGTCATTGTTGCTCTAAGATA A_73_101493 A_73_101493 FALSE BM429308 BM429308 gb|Bos taurus similar to Homo sapiens transducin (beta)-like 1X-linked receptor 1 (TBL1XR1) unmapped Unknown TGCAATTACTCCTCTGATGTTCTTTTGTAGAATAAAGTTTTTTGCTCTGAGTTAGCCTTC A_73_101494 A_73_101494 FALSE XM_870583 XM_870583 LOC618254 ref|XM_870583 unmapped PREDICTED: Bos taurus similar to coiled-coil- helix-coiled-coil-helix domain containing 6 (LOC618254) TCACCATCATTCAGTGCTCCAGGAGGCAGGTCTGGAGCACTGCTGAGGGGAAGACCGGAG A_73_101495 A_73_101495 FALSE NM_174829 NM_174829 SLC21A2 ref|NM_174829 unmapped Bos taurus prostaglandin transporter (SLC21A2) GCTGGCGGGTGAAGAAGAACAAAGAGTACAATGTTCAGGAGAAGGCGGCCGGCCTCATCT A_73_101496 A_73_101496 FALSE XM_593457 XM_593457 LOC515434 ref|XM_593457 unmapped Bos taurus similar to Homo sapiens acrosin binding protein (ACRBP) ACTCTCCATTGCTTTCAGACCCTGGATTGTCTCTTACTTGGCCCGAATCACATGTCTTTT A_73_101497 A_73_101497 FALSE NM_001007076 NM_001007076 GPR100 ref|NM_001007076 unmapped Bos taurus G protein-coupled receptor 100 (GPR100) TAAAGGAAATGGGCAGGCGGTGGACGGAGAGCACCCCTCAGGAGGGTGGCCTTTCTACCA A_73_101498 A_73_101498 FALSE NM_001034368 NM_001034368 ABHD4 ref|NM_001034368 unmapped Bos taurus similar to Homo sapiens abhydrolase domain containing 4 (ABHD4) AATAGTATTAACTCCTGGTGCTTTGTACTACTGGTCCAGCTGCCTTGGGCTCCTTTTCTA A_73_101499 A_73_101499 FALSE XM_866060 XM_866060 LOC614521 ref|XM_866060 unmapped Bos taurus similar to Homo sapiens RAB35, member RAS oncogene family (RAB35) TGGACCAGCGTCCTGGTGGACCTGATGTGAACTTCCTGTCAAACAACAACACTTTTAAAT A_73_101500 A_73_101500 FALSE XM_598222 XM_598222 LOC519992 ref|XM_598222 unmapped Bos taurus similar to Homo sapiens ubiquitin specific peptidase 16 (USP16), transcript variant 1 CTCAATAATATGTCTGCGTGGTGGTTTGCAACACATCAATAAAATTAATTACCCTCGAAA A_73_101501 A_73_101501 FALSE XM_584193 XM_584193 LOC539008 ref|XM_584193 unmapped Bos taurus similar to PREDICTED: Homo sapiens KIAA1107 (KIAA1107) TCCAGGAGATAAAGTATGTAGTGGAAGCAATGTGGATAATGACTTTGAGACACACAGCAA A_73_101502 A_73_101502 FALSE NM_174516 NM_174516 CHRNB1 ref|NM_174516 unmapped Bos taurus cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) (CHRNB1) TACACACTGATATGTTTTGTTTGGCTCATGTTGTTGGCCAAAATTTTAAATCTGGTTTGC A_73_101503 A_73_101503 FALSE XM_598202 XM_598202 LOC519972 ref|XM_598202 unmapped Bos taurus similar to Homo sapiens contactin associated protein-like 5 (CNTNAP5), transcript variant 1 ACCTTTCCAAGTGTACTGCAACATCACAGAGGACAAGATCTGGACATTGATGCAGCACAA A_73_101504 A_73_101504 FALSE XM_872655 XM_872655 LOC516584 ref|XM_872655 unmapped Bos taurus similar to Homo sapiens hippocampus abundant transcript 1 (HIAT1) GACAGCAATAGCTTTGCTAGATATTTGTTTTATCCTGGTTGCCGTGCCGGAGTCATTACC A_73_101505 A_73_101505 FALSE XM_866228 XM_866228 LOC614657 ref|XM_866228 unmapped PREDICTED: Bos taurus similar to src family associated phosphoprotein 2 (LOC614657), partial mRNA. CTCCAGACACTATTTCATTAGCCTCAGAAAGATATGATAAAGATGATGAAGCTCCCTCTG A_73_101506 A_73_101506 FALSE XM_864281 XM_864281 LOC540329 ref|XM_864281 unmapped Bos taurus similar to Homo sapiens protein phosphatase 1K (PP2C domain containing) (PPM1K) AACTGATTAGATTTAAAAAGTGAACTGTAAGTGGTGACCCTAGAACTCACTAGACCAGTA A_73_101507 A_73_101507 FALSE BE685553 BE685553 gb|Bos taurus similar to Homo sapiens TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa (TAF1), transcript variant 1 unmapped Unknown AGATTGGAAGGGAAGGGGCTAAATGTTTATTTGTATACTGGGTGGGGCACTGTGCTTTTA A_73_101508 A_73_101508 FALSE NM_001015676 NM_001015676 MYOZ2 ref|NM_001015676 unmapped Bos taurus myozenin 2 (MYOZ2) CTTACTGGCAAAGCCACTAACACTCTTCAATAGTAGCAATAATTAATAGCAATTTAGCAC A_73_101509 A_73_101509 FALSE XM_870345 XM_870345 LOC618014 ref|XM_870345 unmapped PREDICTED: Bos taurus similar to Germ cell- less protein-like 2 (mGclh) (LOC618014) TGAAAAGGATGAGGAACAAATGGTAATGAAACTGGATAGCGTAGCTTTGAGCTTCCCTTT A_73_101510 A_73_101510 FALSE XM_610075 XM_610075 LOC531577 ref|XM_610075 unmapped PREDICTED: Bos taurus similar to UDP glycosyltransferase 1 family, polypeptide A3 precursor (LOC531577) TTTATCTCAGGTATTAGGGGTGGTCACTGGAGACTTCAACCCCAAAAGGAAGCAGAAGTT A_73_101511 A_73_101511 FALSE XM_617927 XM_617927 LOC537745 ref|XM_617927 unmapped Bos taurus similar to Homo sapiens F-box protein 28 (FBXO28) TTTAATCCGTCCAACATGATATGGTTATGCATCCTTGAGATTAACTTCACCAAATGAAAC A_73_101512 A_73_101512 FALSE XM_595571 XM_595571 LOC517402 ref|XM_595571 unmapped Bos taurus similar to Homo sapiens pyruvate dehydrogenase complex, component X (PDHX) CTGCTCGCTTACCTTCATACTGAGTTGGAATATATTAAAATAAATCATGCAATTTCCTGC A_73_101513 A_73_101513 FALSE XM_584963 XM_584963 LOC508216 ref|XM_584963 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L28 (MRPL28), nuclear gene encoding mitochondrial protein TGTTGAGGAGGGTCACCACCCTCCGGGGCCAGTGTGAGTAAAGTCTGAGCCAGGTAAAAA A_73_101514 A_73_101514 FALSE XM_615432 XM_615432 LOC535364 ref|XM_615432 unmapped Bos taurus similar to Homo sapiens EPH receptor B1 (EPHB1) ATCCACTGGCAAGAAGAAAGGGAAGGAGGTCGAGGGAAGAAACAGAAGTAATTTCCCATT A_73_101515 A_73_101515 FALSE XM_605604 XM_605604 LOC527214 ref|XM_605604 unmapped Bos taurus similar to Homo sapiens phospholipase A2, group XIIA (PLA2G12A) AACGCGGCGCGTGGTAAGGGGGGCATTTTTTAAAGAAAGAGTATGACTCAGTTTTCACAA A_73_101516 A_73_101516 FALSE XM_587315 XM_587315 LOC510197 ref|XM_587315 unmapped Bos taurus similar to Homo sapiens vacuolar protein sorting 33 homolog A (S. cerevisiae) (VPS33A) ATAATCTGTTCAGCCATAAATGGGGCCAGTTCTTAAGAACGCAGGGACCAACCAGGTAAA A_73_101517 A_73_101517 FALSE BI536274 BI536274 gb|Unidentified transcripts on BTA11 position 31151821-31151175 unmapped Unknown ATGTTGTCTCCCATCTCAAGAGTTAATGTTCTTTCATCCCATCAGTTTCATTGCCAAGTA A_73_101518 A_73_101518 FALSE NM_001014930 NM_001014930 C20orf30 ref|NM_001014930 unmapped Bos taurus hypothetical protein LOC515498 (C20orf30) TAGAGGACTGGACTGCCTTAGCTTGATCTGCCTCCTAGCTTGCAAAAAGTGACTTGTATT A_73_101519 A_73_101519 FALSE XM_868734 XM_868734 LOC511703 ref|XM_868734 unmapped Bos taurus similar to Homo sapiens zinc finger protein 652 (ZNF652) AGTACTTCGACGAGCACATGAAAACACACACTGGAGAGAAACCCTTTATCTGTGAAATCT A_73_101520 A_73_101520 FALSE XM_863976 XM_863976 LOC613325 ref|XM_863976 unmapped Bos taurus similar to Homo sapiens suppressor of hairy wing homolog 3 (Drosophila) (SUHW3) ATTGTGAATTCTAAGGTATAAAGAATTGACAACACCTCTTCTTCCAGACCTTAAAACACG A_73_101521 A_73_101521 FALSE XM_868238 XM_868238 LOC616260 ref|XM_868238 unmapped PREDICTED: Bos taurus similar to Apical-like protein (APXL protein) (LOC616260) TCGAACAGCGCGAGCTGGAAGACAAAATACACCTGGGTGAGGAGCAGCTGAAGTGCCTCT A_73_101522 A_73_101522 FALSE NM_001038150 NM_001038150 MGC134142 ref|NM_001038150 unmapped Bos taurus similar to transmembrane protein 30B (MGC134142) AAGGGGAGGAGGCATGATTAGGTATAGTAAAATGTCCTTGGAATGGGGAGGATAAATCAT A_73_101523 A_73_101523 FALSE EE907915 EE907915 gb|Unidentified transcripts on BTA10 position 55826169-55825491 unmapped Unknown CCAGTAACGTGTTGTAGTCTAGGGTTGGGGGGATTACCATGTTTACCAAATGTTTGGCAA A_73_101524 A_73_101524 FALSE NM_182987 NM_182987 FUT10 ref|NM_182987 unmapped Bos taurus fucosyltransferase 10 (alpha (1,3) fucosyltransferase) (FUT10) TCTAGGTTGCCTTGCTGTTTGAATATAATAGCTGCTCTGTTGACGATCCATTAGGATGAG A_73_101525 A_73_101525 FALSE XM_868560 XM_868560 LOC616526 ref|XM_868560 unmapped Bos taurus similar to Homo sapiens BET1 homolog (S. cerevisiae) (BET1) GTCTGTATTGCTACTGTTTGGAATTTGCTCATTGATGGGCTTCAGAAATAAAACTTTTAG A_73_101526 A_73_101526 FALSE XM_613935 XM_613935 LOC540974 ref|XM_613935 unmapped Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family C (with FERM domain) member 1 (PLEKHC1) TATGTGCACTAACAAGCACGACTATTAATCTGCTATCATGATACAATGTACGGACTTGAA A_73_101527 A_73_101527 FALSE XM_589440 XM_589440 GNAI2 ref|XM_589440 unmapped PREDICTED: Bos taurus guanidine nucleotide binding protein, (G protein) , alpha inhibiting activity polypeptide 2, transcript variant 1 (GNAI2) CCAAGCCACTTGGAGGCCCCAAAGGAAAAAGCACAAGAAGCGTGAGACGCCACCATTCCT A_73_101528 A_73_101528 FALSE XM_865518 XM_865518 LOC538628 ref|XM_865518 unmapped Bos taurus similar to Homo sapiens runt- related transcription factor 1; translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 2 CCGATGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTTGAAAGCAAAAATGC A_73_101529 A_73_101529 FALSE NM_001015614 NM_001015614 RABGGTA ref|NM_001015614 unmapped Bos taurus Rab geranylgeranyltransferase, alpha subunit (RABGGTA) TAAGAGGCCCTGCCCCCACCCTTGCCCTTTAACTTATTGGAACTGAATAAACAATGAAGA A_73_101530 A_73_101530 FALSE XM_871092 XM_871092 LOC618766 ref|XM_871092 unmapped PREDICTED: Bos taurus similar to CG30010-PA (LOC618766) TTGCCTCTGCCTAGACGAAAACAATTACATTAAAACTTTCACTGTGCTTGCTTCTGTTCA A_73_101531 A_73_101531 FALSE XM_592173 XM_592173 LOC514339 ref|XM_592173 unmapped Bos taurus similar to Homo sapiens solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 (SLC6A12) CCTGGCCACTTTTTTCTTCTCCTTGAGCAAGTACACACCTCTCAAATACAACAACGTCTA A_73_101532 A_73_101532 FALSE XM_590002 XM_590002 LOC512480 ref|XM_590002 unmapped Bos taurus similar to Homo sapiens caspase recruitment domain family, member 12 (CARD12) TTTTCTGCAAGAGGTTCAGCTTGTTGGGTGGCAACTTGATGACGATGATGTCAGTGTTCT A_73_101533 A_73_101533 FALSE XM_613052 XM_613052 LOC533597 ref|XM_613052 unmapped Bos taurus similar to PREDICTED: Homo sapiens carbonic anhydrase VB-like, transcript variant 1 (CA5BL) AAATTTAGGAACTGACAATTCAGTTATTGGAAAAGTTTAGAATGTCTGGAACAGCTTGGG A_73_101534 A_73_101534 FALSE XM_582720 XM_582720 LOC506294 ref|XM_582720 unmapped Bos taurus similar to Homo sapiens kinesin family member 22 (KIF22) CCTTCAGCCAGGTTGAGGACCTGGAACGCGTGGAGGGTATATCAGGGAAACAGATGGAGT A_73_101535 A_73_101535 FALSE XM_605788 XM_605788 LOC527397 ref|XM_605788 unmapped Bos taurus similar to Homo sapiens DEP domain containing 1 (DEPDC1) AACCTCTGAAAGTGAAGCAGCACTTTTCGGTGACAAACCTACAATCAAGCAACCAATGCT A_73_101536 A_73_101536 FALSE XM_877513 XM_877513 LOC515925 ref|XM_877513 unmapped Bos taurus similar to Homo sapiens fatty acid desaturase 3 (FADS3) CTGTACTTCTTCCTGATCGGCCCGCCGCTGCTCACGCTGGTGAACTTCGAAGTGGAAAAT A_73_101537 A_73_101537 FALSE XM_585730 XM_585730 LOC508885 ref|XM_585730 unmapped Bos taurus similar to Homo sapiens SET domain, bifurcated 1 (SETDB1) ACCTTAGTTTATTTAGTTGATCACTCTTCTCAGTTCATAAGAGTCTCAAACACTTGTTGC A_73_101538 A_73_101538 FALSE NM_001034496 NM_001034496 MGC128215 ref|NM_001034496 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 50, member B (FAM50B) AGCCCCTCACCCCCCTTAGTCTATTTCCTGTCTGTTTGGATTTGCTTATTCTGGAAGTTT A_73_101539 A_73_101539 FALSE NM_001038109 NM_001038109 TSPAN6 ref|NM_001038109 unmapped Bos taurus similar to Homo sapiens tetraspanin 6 (TSPAN6) TCCACCTTTTGTCCCATTCATGTTACATCATTGAAATCTCCATATCACTCTGAAACACTG A_73_101540 A_73_101540 FALSE XM_591352 XM_591352 LOC513638 ref|XM_591352 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 8, subfamily I, member 2 (OR8I2) CCCATGCTGAATCCACTTATCTATAGTTTGAGGAACAAAGATGTAAAAAATGCTCTCCTG A_73_101541 A_73_101541 FALSE NM_001014392 NM_001014392 b3gat2 ref|NM_001014392 unmapped Bos taurus beta-3-glucuronyltransferase-S (b3gat2) ACGGAGAAGGTGAACCTCGCCAACGAGCCCAAGTACCACTTGGACACCGTGACGATTGAT A_73_101542 A_73_101542 FALSE XM_618236 XM_618236 LOC538044 ref|XM_618236 unmapped Bos taurus similar to Homo sapiens hypothetical protein DKFZp666G057 (DKFZp666G057) AAACTACAAATTCCCAAGGTCATAAATTCTTCCGCAAGATCGCTCCCGCGGTGAAGGCCT A_73_101543 A_73_101543 FALSE NM_174266 NM_174266 CD79A ref|NM_174266 unmapped Bos taurus CD79A antigen (immunoglobulin-associated alpha) (CD79A) CTCCCCTCTGCCTGCTCTGTCATGGCCACTTAGTGATAATAAATCCTTCCCAACGGCAAA A_73_101544 A_73_101544 FALSE XM_580318 XM_580318 LOC504233 ref|XM_580318 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily A, member 1 (OR2A1) GAACAAAGAGGTCAAGGGTGCCCTGAGGAGAGCACTGTTCAAGGAGAATGTGATTTTATT A_73_101545 A_73_101545 FALSE XM_588893 XM_588893 LOC511540 ref|XM_588893 unmapped Bos taurus similar to Homo sapiens keratin 24 (KRT24) GAAGAGGTGGTGGATGGCAAAGTCATCTCATCTCAAGTCAGCAATGTTTCTGAGGTGAAA A_73_101546 A_73_101546 FALSE XM_606509 XM_606509 LOC528098 ref|XM_606509 unmapped PREDICTED: Bos taurus similar to Proprotein convertase subtilisin/kexin type 5 precursor (Proprotein convertase PC5) (Subtilisin/kexin-like protease PC5) (PC6) (Subtilisin-like proprotein convertase 6) (SPC6) (LOC528098) CTGTTGGATGATGACAATGAAGATGACCTGGAATACGATGATGAGAGCTACTCCTACCAG A_73_101547 A_73_101547 FALSE XM_615958 XM_615958 LOC535844 ref|XM_615958 unmapped Bos taurus similar to Homo sapiens oculocerebrorenal syndrome of Lowe (OCRL), transcript variant b TGTTATATTTCCCAAAAATGTCTTGGTCACTAAGCAAAGCTGCTAGTGGGATTCTGTATT A_73_101548 A_73_101548 FALSE XM_617286 XM_617286 LOC537130 ref|XM_617286 unmapped Bos taurus similar to Homo sapiens Sad1 and UNC84 domain containing 1 (SUNC1), transcript variant 1 TGGGGACACCCAAACTATACTTGTTTATATAGATTCAGGGTTCATGGCACCCCAAAAGAT A_73_101549 A_73_101549 FALSE NM_001015670 NM_001015670 C14orf108 ref|NM_001015670 unmapped Bos taurus chromosome 14 open reading frame 108 (C14orf108) TTTGTTACAGAATACCAGAGACCGATTAGAAACAACTGTAAATCTCTTGAGAAAATAGCC A_73_101550 A_73_101550 FALSE NM_001040481 NM_001040481 BOLA-DMB ref|NM_001040481 unmapped Bos taurus major histocompatibility complex, class II, DM beta-chain, expressed (BOLA-DMB) TCACAGAGGGCGTGAGTCACTGTTGATTGTCTCTGAGGAATAAACTGGTAGAATCCTGTT A_73_101551 A_73_101551 FALSE XM_867336 XM_867336 LOC533248 ref|XM_867336 unmapped Bos taurus similar to Homo sapiens KIAA1212 (KIAA1212) TACAAGAGCTGTAACATTTCCTTTAAAATAACGCTACTGAGAAATCTGGAGTTAAATGGC A_73_101552 A_73_101552 FALSE NM_181667 NM_181667 ADAMTS4 ref|NM_181667 unmapped Bos taurus a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4 (ADAMTS4) AGGATTAAATACTGTAAATAAAGAACTAGCATAATGCCTAGCACTCAGTAAGTGCTCAAC A_73_101553 A_73_101553 FALSE XM_869968 XM_869968 LOC617418 ref|XM_869968 unmapped Bos taurus similar to Homo sapiens kallikrein 5 (KLK5) CCAGTGCTTCCTTCCTCAGGTCCAGAGTCCACCTTCTGTGCAGCTGTGACCCAGATTTGA A_73_101554 A_73_101554 FALSE XM_583622 XM_583622 LOC507069 ref|XM_583622 unmapped PREDICTED: Bos taurus similar to Breast cancer type 2 susceptibility protein (Fanconi anemia group D1 protein) (LOC507069) CGACCAGTTCTTCATCCTTAAGTCAGCATGACTACAAGAAAAACAGAACCCTCTGTGCAC A_73_101555 A_73_101555 FALSE NM_173916 NM_173916 GCG ref|NM_173916 unmapped Bos taurus glucagon (GCG) AAGGGGAAGGACTGGTAGCCACAGTTGTGAAATGGGAAAGAGAATTTTCTTCTTGAAACT A_73_101556 A_73_101556 FALSE XM_866198 XM_866198 LOC614634 ref|XM_866198 unmapped PREDICTED: Bos taurus similar to glutamate receptor delta-1 subunit (LOC614634) TCCATGAATCATGTCAGGGAGAAAGCAAAGAACAAGGTTTGTGGTCCACGGTTAGAGACA A_73_101557 A_73_101557 FALSE NW_929533 NW_929533 gb|Putative orthologue of human miRNA hsa-mir-338 on chr 17, (-) strand. Mature length 23 nt, stem-loop length 67 nt. Source: NW_929533.1:c305500-305437 unmapped Unknown TCCAGCATCAGTGATTTTGTTGATATCCTACTATACGTATCACAT A_73_101558 A_73_101558 FALSE NM_001035388 NM_001035388 MGC127089 ref|NM_001035388 unmapped Bos taurus similar to Homo sapiens transmembrane protein 86A (TMEM86A) GGAAGGGGCTCCAATGACACTCTAGGGTCATAAGACCCAAGGCACATTCAATGCAAGGGG A_73_101559 A_73_101559 FALSE BM252119 BM252119 gb|Bos taurus similar to Homo sapiens forkhead box K1 (FOXK1) unmapped Unknown TTGTTGTATGTGGACGGGGAAGTTTTGTCTTTCCTCTTAGCATTTGTTTCTATAACCAGA A_73_101560 A_73_101560 FALSE XM_602626 XM_602626 LOC524304 ref|XM_602626 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 9, subfamily I, member 1 (OR9I1) TATAGCCTGAGAAACACAGATGTGAAAGCAGCCTTTAGAAAGGTCGCTGGTAGGTTCCAG A_73_101561 A_73_101561 FALSE NM_001035082 NM_001035082 SUCLG1 ref|NM_001035082 unmapped Bos taurus similar to Homo sapiens succinate- CoA ligase, GDP-forming, alpha subunit (SUCLG1) AGTGTCCTACACTGAGGTGTTTTCACCTCACTAAATAAGAGGAGCAGCCAATAAATCTAC A_73_101562 A_73_101562 FALSE XM_596982 XM_596982 LOC518781 ref|XM_596982 unmapped Bos taurus similar to Homo sapiens vacuolar protein sorting protein 18 (VPS18) CAGAGAGCCTCCTGGAGGACAGTGGGAGATGGTGATGAGGTGGAGAGCATTAAACTGTCT A_73_101563 A_73_101563 FALSE XM_867226 XM_867226 LOC517544 ref|XM_867226 unmapped PREDICTED: Bos taurus similar to Ubiquitin conjugation factor E4 A, transcript variant 2 (LOC517544) AGTGTAATACAGAGAACCACTTTATATTGTCTCTTCCGTGGTAAGATGTATGCAGTATGT A_73_101564 A_73_101564 FALSE XM_871382 XM_871382 LOC619066 ref|XM_871382 unmapped Bos taurus similar to Homo sapiens ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) (RAC3) CTGTCCTTGTGCCCCATGATGGGGCAGCCCCTTCTTATTTTATACAATAAACCTTCATCA A_73_101565 A_73_101565 FALSE NM_001034520 NM_001034520 CLUL1 ref|NM_001034520 unmapped Bos taurus similar to Homo sapiens clusterin- like 1 (retinal) (CLUL1), transcript variant 1 TCTTGAAGAAAGTGCTGAGAGTTCCGACTTCATTAGCTACATGCTGGCCAAAGCTGTACA A_73_101566 A_73_101566 FALSE XM_584449 XM_584449 LOC507774 ref|XM_584449 unmapped PREDICTED: Bos taurus similar to UDP- glucuronosyltransferase 2B7 precursor (UDPGT) (3,4-catechol estrogen specific) (UDPGTh-2) (LOC507774) TTTCTACAAAGAGAAGGCTATGTGGTTATCCACCATTCAACGCAATCAGCCTATAAAGCC A_73_101567 A_73_101567 FALSE XM_586019 XM_586019 LOC509125 ref|XM_586019 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 9, subfamily G, member 9 (OR9G9) AAAGCTGCTCTGAAAAAACTCTCCAGTGAAAACAGACTGCTTCAGGGGAAGTTTGGGAAG A_73_101568 A_73_101568 FALSE XM_593669 XM_593669 LOC515619 ref|XM_593669 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 52, subfamily H, member 1 (OR52H1) ACCCCATTGTTTATGGAGTGAAGACCAAACAGATCAGAGAGAAGGTCACCATTTTGTTTT A_73_101569 A_73_101569 FALSE NM_001034265 NM_001034265 MGC127964 ref|NM_001034265 unmapped Bos taurus similar to Homo sapiens motile sperm domain containing 3 (MOSPD3), transcript variant 1 TTCTTCCTGCCCATCTCCCCCCAGACTTAGGGATTTGTTATCTTTTTCCAAGTTGAATCA A_73_101570 A_73_101570 FALSE XM_869019 XM_869019 LOC616888 ref|XM_869019 unmapped Bos taurus similar to Homo sapiens v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) (MYCN) ACAGCGGTTGAAGCCTGTGACCGTTGGGAGCCTTCTGGGGCTGTTGAAGTCACCTTGTTT A_73_101571 A_73_101571 FALSE AF013068 AF013068 gb|Bos taurus similar to Homo sapiens sel-1 suppressor of lin-12-like (C. elegans) (SEL1L) unmapped Unknown GAGAGATGTACAGATTCGTTTTGTACTGTATCTTGAAACTTGTGAAATAAAGATTCCACC A_73_101572 A_73_101572 FALSE XM_584676 XM_584676 LOC507971 ref|XM_584676 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily T, member 3 (OR2T3) TCTGAGGAGCAGGATGCAATTAGGACTGAGCCTAGAGAAAGTTGTAAAGGGGAAAGTCTA A_73_101573 A_73_101573 FALSE XM_591012 XM_591012 LOC513343 ref|XM_591012 unmapped Bos taurus similar to Homo sapiens transmembrane protease, serine 4 (TMPRSS4), transcript variant 1 CAGAAGGCATTGCTAAGCCAAGAACTTTCTACTCTATTGAATGGAAACAGACGCTCTTCT A_73_101574 A_73_101574 FALSE XM_875439 XM_875439 LOC534234 ref|XM_875439 unmapped Bos taurus similar to Homo sapiens FIP1 like 1 (S. cerevisiae) (FIP1L1) TTAAAGAGCTATGTTTAGCTGTGTACATACACAATATCTGATAAAAGTCAAGGTTCCCTC A_73_101575 A_73_101575 FALSE XM_603415 XM_603415 LOC525072 ref|XM_603415 unmapped PREDICTED: Bos taurus similar to Cytosolic phospholipase A2 (cPLA2) (Phospholipase A2 group IVA) (LOC525072), partial mRNA. GAACTAGAAAATATTACAGCAAAGCATATTGTGAGTAATGATAGCTCAGACAGTGATGAC A_73_101576 A_73_101576 FALSE XM_591317 XM_591317 LOC513610 ref|XM_591317 unmapped Bos taurus similar to Homo sapiens cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa (CRSP3), transcript variant 2 CATCTCTGTGTTGAGAGTACTGCACTCAGGCTTATAACAGCACTAGGTAGCTCAGAAGTA A_73_101577 A_73_101577 FALSE XM_592401 XM_592401 LOC514533 ref|XM_592401 unmapped Bos taurus similar to Homo sapiens melanoma antigen family H, 1 (MAGEH1) CTTTCTGAAACCTGTGTCTCCTTTTGTGTAAAGAATACAGACAACCATCTTGATTTTGTA A_73_101578 A_73_101578 FALSE NM_173968 NM_173968 TXN ref|NM_173968 unmapped Bos taurus thioredoxin (TXN) TTACACAAAGGAAAGATCAAGTATGAAGATTATATACCTTACTGCCATCTGATAGGTGAC A_73_101579 A_73_101579 FALSE XM_600216 XM_600216 LOC521943 ref|XM_600216 unmapped PREDICTED: Bos taurus similar to zinc finger and BTB domain containing 8, transcript variant 3 (LOC521943) ATCTGGAGGGAAAGGGAAGGTTAGTAGAAGAACAGGTTTTTAAAACCAGTCTGTTCTTTA A_73_101580 A_73_101580 FALSE AV606802 AV606802 gb|Bos taurus similar to Homo sapiens talin 1 (TLN1) unmapped Unknown GGGGCCAGGGGTGTAAGCCCCAAACAGGTCATGCTCCAATAAAGGTGATTCTGCCTGCAA A_73_101581 A_73_101581 FALSE NM_001034569 NM_001034569 PLEKHJ1 ref|NM_001034569 unmapped Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family J member 1 (PLEKHJ1) AGAGCTGGAAGGCTTGCCTTTGGGGTGGCCAGTATATTCTGTTCAAATAAAGGTACTCTT A_73_101582 A_73_101582 FALSE XM_867539 XM_867539 LOC615672 ref|XM_867539 unmapped Bos taurus similar to Homo sapiens vacuolar protein sorting 8 homolog (S. cerevisiae) (VPS8), transcript variant 2 TTGCCTCACGTTTGTGTTGAAGCCCGTTTGAGTGTTAGCATCTGCCGTCTCTAACAATAA A_73_101583 A_73_101583 FALSE XM_594169 XM_594169 LOC516039 ref|XM_594169 unmapped Bos taurus similar to Homo sapiens mitogen- activated protein kinase kinase 3 (MAP2K3), transcript variant B TTTTTTGAAAAAAGGACTGCCTGTCCAGGGTCCTGTCCCTGATGGGTTGGGGCAGTTGGC A_73_101584 A_73_101584 FALSE XM_870945 XM_870945 LOC618612 ref|XM_870945 unmapped Bos taurus similar to Homo sapiens cysteine- rich secretory protein 2 (CRISP2) TTTGCCAATACTGTCCTGCTGGTAATATTGTTGGCAGACAACATGTCCCTTACCAAAAGG A_73_101585 A_73_101585 FALSE XM_867789 XM_867789 LOC615870 ref|XM_867789 unmapped PREDICTED: Bos taurus similar to parkin isoform 1 (LOC615870) TTTTCTGTGAGGGACCATGGTGCCCATTCCAGATTCATTATGCTTGTCCTGGGAAAAGTT A_73_101586 A_73_101586 FALSE XM_584163 XM_584163 LOC539003 ref|XM_584163 unmapped Bos taurus similar to Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1) AGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGGAGT A_73_101587 A_73_101587 FALSE NM_177505 NM_177505 PNMT ref|NM_177505 unmapped Bos taurus phenylethanolamine N-methyltransferase (PNMT) CCAATGGCCCTCACCCGCCTAGACTCCCTGTTGTCCGAGGTGGCCTCAATAAAGGAATAA A_73_101588 A_73_101588 FALSE XM_868183 XM_868183 LOC615514 ref|XM_868183 unmapped PREDICTED: Bos taurus similar to Glutathione S-transferase Mu 1 (GSTM1-1) (GST class-mu 1) (GSTM1a-1a) (GSTM1b-1b) (HB subunit 4) (GTH4), transcript variant 1 (LOC615514) GATGTCCTTGACCGGCACCGCATATTTGAACCTACATGTCTGGATGAATTTCCAAACTTG A_73_101589 A_73_101589 FALSE XM_581997 XM_581997 LOC505672 ref|XM_581997 unmapped Bos taurus similar to Homo sapiens FCH domain only 1 (FCHO1) CCAATTCCCATGCAGGTCCTCGACCTTTTGATGTTCTTTACATAAACACTCTATTTTCTA A_73_101590 A_73_101590 FALSE CB168793 CB168793 gb|Bos taurus similar to Homo sapiens ring finger protein (C3H2C3 type) 6 (RNF6), transcript variant 1 unmapped Unknown CAACAAAAGTAAGAGAATGTAGAACAAACACAAAGTATGCGTTGAAGATCTGTTTCTACC A_73_101591 A_73_101591 FALSE XM_617960 XM_617960 LOC537776 ref|XM_617960 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ25393 (FLJ25393) TGAGACATTCTTTGGACTTAAAATGCAAATGCCAAGTCTGTATAGAAGAGTAATAGCATG A_73_101592 A_73_101592 FALSE CB170705 CB170705 gb|Unidentified transcripts unmapped Unknown CATCAAAGATGCCAAAGGGTATATGAAATAAGCTACAGTAATAGTCAACAGAACTTAACC A_73_101593 A_73_101593 FALSE XM_585239 XM_585239 LOC539151 ref|XM_585239 unmapped Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 4 gamma, 1 (EIF4G1), transcript variant 5 CCTGGGGTCCTTTTTTATTTTCTGAAAATCACTCTTGGGACTGCCGTCCTCGCTGCTGGG A_73_101594 A_73_101594 FALSE CB166836 CB166836 gb|Bos taurus similar to Homo sapiens importin 7 (IPO7) unmapped Unknown AGAAAATGTATTGGCATGTCTTTGAGATCAAGTTTTATTGTCTCCTCTGTCATACAATCC A_73_101595 A_73_101595 FALSE XM_585689 XM_585689 LOC508853 ref|XM_585689 unmapped Bos taurus similar to Homo sapiens inner membrane protein, mitochondrial (mitofilin) (IMMT) AGGAGCAGGTTGACAACTTTACTCTGGATATAAACACTGCCTATGCCAGACTGAGAGGAA A_73_101596 A_73_101596 FALSE XM_612476 XM_612476 LOC533161 ref|XM_612476 unmapped Bos taurus similar to Homo sapiens kinesin family member 2C (KIF2C) TAGTTCAGCTCTGCTGGCTCTGGCCTGCCTTCCACACCCTTGGTCCGGCCACTAATATAT A_73_101597 A_73_101597 FALSE XM_607020 XM_607020 LOC528593 ref|XM_607020 unmapped Bos taurus similar to Homo sapiens CD5 molecule-like (CD5L) CTCAGCCCCTAAGCAAGAATCTGAGACTGAGTTGAGTACCTGTTATGTGTCTGCGTTTAT A_73_101598 A_73_101598 FALSE BF774616 BF774616 gb|Bos taurus similar to Homo sapiens anthrax toxin receptor 2 (ANTXR2) unmapped Unknown CTTGAATCTTTTGCTCGAGTTTATTTATGTCACTGGCTGGCTGGATCCAAAGTCATGTGT A_73_101599 A_73_101599 FALSE XM_615918 XM_615918 LOC535804 ref|XM_615918 unmapped PREDICTED: Bos taurus similar to 3-oxoacid CoA transferase 1 (LOC535804) GAATCATTTGCAATGATTAGAGGGTATGTAATAATGGAGCTCCTCATGTTTCCCACGGTG A_73_101600 A_73_101600 FALSE NM_176788 NM_176788 CEBPB ref|NM_176788 unmapped Bos taurus CCAAT/enhancer binding protein beta (CEBPB) CTATGAGAAAAGAGGCATCTGTATATTTGGGAATCTTTTCCGTTTCGAGCATTAAGAACA A_73_101601 A_73_101601 FALSE NM_001040506 NM_001040506 LOC505387 ref|NM_001040506 unmapped Bos taurus similar to Homo sapiens CGI-115 protein (CGI-115) ACTTCATCAGTGTTCTGAGAGGGATGGACGGAAGTGCAAGTGAGAGCTCAAAATGCATTT A_73_101602 A_73_101602 FALSE XM_582033 XM_582033 LOC538688 ref|XM_582033 unmapped PREDICTED: Bos taurus similar to Gamma crystallin E (LOC538688) GGGGGCTGTGGATGCCCGAGTGGGCTCCTTGAGGAGGGCTGTGGATTTCTATTGAAATAT A_73_101603 A_73_101603 FALSE NM_205787 NM_205787 PTP ref|NM_205787 unmapped Bos taurus pancreatic thread protein (PTP) TCCCCAGACTCAATTCAGTCTCTTCTGTGTGTTCCATAACCTGACTTTGCAAAGTTCACA A_73_101604 A_73_101604 FALSE BE668745 BE668745 gb|Bos taurus similar to Homo sapiens KIAA1586 (KIAA1586) unmapped Unknown GCCCATGTCTGCTAGAGTAGGCCGAATATGTATTTCATGGACTCTATAAGAACATCCAAT A_73_101605 A_73_101605 FALSE XM_863833 XM_863833 LOC538509 ref|XM_863833 unmapped Bos taurus similar to Homo sapiens chromosome 10 open reading frame 97 (C10orf97) TGTATTGCCAACTACACATTTCCAAATTTGTCCCAACAGCCCTGTAAGCCAGCTTTCTTG A_73_101606 A_73_101606 FALSE BI541727 BI541727 gb|Bos taurus similar to Homo sapiens carbohydrate (chondroitin) synthase 1 (CHSY1) unmapped Unknown CTGTCATTACACCAGAATAGTTTGTTTTAGACTCACTAGAACAAAGTGTGCCTCTAATAA A_73_101607 A_73_101607 FALSE XM_869702 XM_869702 LOC520058 ref|XM_869702 unmapped Bos taurus similar to Homo sapiens mitogen- activated protein kinase kinase kinase kinase 2 (MAP4K2) TGCCCCTGCGCTCCATCCTGGGGAACATGGTATTTAAAAGAGAGACTATATTGGCATTAA A_73_101608 A_73_101608 FALSE XM_864059 XM_864059 LOC541218 ref|XM_864059 unmapped Bos taurus similar to Homo sapiens polymerase (DNA directed) kappa (POLK) AGAATTTTTAGCACTTAACCACTTTGTTGGCACTGGATGCTCTGCTTGATCTTAGTATCT A_73_101609 A_73_101609 FALSE XM_590923 XM_590923 LOC513262 ref|XM_590923 unmapped Bos taurus similar to Homo sapiens testis expressed sequence 2 (TEX2) TGCATTGTTTCACAAATAAATATCTCATGTCAAATACTAGATTAGCATCCAAGCGGACGC A_73_101610 A_73_101610 FALSE XM_616380 XM_616380 LOC536255 ref|XM_616380 unmapped Bos taurus similar to Homo sapiens patatin- like phospholipase domain containing 6 (PNPLA6) CCTTGGGGCCTCTCCTGCTGGAGCCCTCGTGTTTCTGCTTTGCCTGTCAATAAAGGTAGA A_73_101611 A_73_101611 FALSE CB462702 CB462702 gb|Bos taurus similar to Homo sapiens ATG12 autophagy related 12 homolog (S. cerevisiae) (ATG12) unmapped Unknown TTAACAGATGGCAAGAATGTGTTTAACCTCTGTGTATATTATGTTTGCTGCTAAGGTTTC A_73_101612 A_73_101612 FALSE XM_613542 XM_613542 LOC533964 ref|XM_613542 unmapped Bos taurus similar to Homo sapiens integrator complex subunit 9 (RC74) GTGCTTAACTTGATCTGAGCTGTATCTGTATGGAAAACAGCAGCACAGACCGCTAACACT A_73_101613 A_73_101613 FALSE XM_866950 XM_866950 LOC615210 ref|XM_866950 unmapped PREDICTED: Bos taurus similar to Prolactin precursor (PRL) (LOC615210) ATGACGTTGTCTTGGGTGCTGACCAGTCACGAAGCTTTGGAGTATAAAAATGTTTCAGAG A_73_101614 A_73_101614 FALSE XM_871648 XM_871648 LOC513719 ref|XM_871648 unmapped Bos taurus similar to Homo sapiens high- mobility group 20A (HMG20A) TCAGCATCTCCTCCCCTGATTTCTTTCTTAACCCAAAGGAAACAAAACAACAGCAAAAAA A_73_101615 A_73_101615 FALSE XM_584102 XM_584102 LOC538988 ref|XM_584102 unmapped Bos taurus similar to Homo sapiens zinc finger protein 214 (ZNF214) TAAATGCCATGAGTATTACAAGGGGTTCAATCAGAATTCACATCTTTACAATAACTGCAG A_73_101616 A_73_101616 FALSE AV598274 AV598274 gb|Bos taurus similar to Homo sapiens citron (rho-interacting, serine/threonine kinase 21) (CIT) unmapped Unknown TTTTTTAAAGACAGAGCGTGAAACTCCAAAGTATCTCCCCTGTCAGCCTGAGCTTGTGAG A_73_101617 A_73_101617 FALSE CB170450 CB170450 gb|Bos taurus similar to Homo sapiens hypothetical protein from clone 643 (LOC57228) unmapped Unknown CTGGAACTTTTGTGACAGTTTGCTCTGTCGTTTTTGTTCAGCCTCTCAATCATGTCCGAC A_73_101618 A_73_101618 FALSE XM_606693 XM_606693 LOC528277 ref|XM_606693 unmapped Bos taurus similar to Homo sapiens WD repeat domain 31 (WDR31), transcript variant 1 CGTCTCCTTATTGTGTGTGAGTTTCAGCAGAGGAATTCACTTACTCAGGGTGGACCGCAG A_73_101619 A_73_101619 FALSE NM_001038035 NM_001038035 MGC134318 ref|NM_001038035 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 118, member A (FAM118A) ACGGCCCATATTCACGGATTTGCACAGTGAAGACTTGACAGAGACTTGTCAGAACACTAT A_73_101620 A_73_101620 FALSE NM_001034550 NM_001034550 MGC127087 ref|NM_001034550 unmapped Bos taurus similar to Homo sapiens chromatin modifying protein 2A (CHMP2A), transcript variant 1 AGGGAGCCAGTGGATGGCCTAGCATTTTCATTGTACCTTCTGTAATAAAAGAGGTTGGGA A_73_101621 A_73_101621 FALSE CB420095 CB420095 gb|Bos taurus similar to Homo sapiens neural precursor cell expressed, developmentally down- regulated 4 (NEDD4), transcript variant 1 unmapped Unknown GCAAAGTATCTCAAAACTCATTCTGCAGCTGGAAGTAAATAGGGTCATTTTCTTAAAGCA A_73_101622 A_73_101622 FALSE XM_606855 XM_606855 LOC528432 ref|XM_606855 unmapped Bos taurus similar to Homo sapiens MUS81 endonuclease homolog (S. cerevisiae) (MUS81) GGTGTTGCAATGTTGAATCTAGTTCATGTCATCAGAGTTCTCTGATCAAATAAAATTTCC A_73_101623 A_73_101623 FALSE CB460130 CB460130 gb|Bos taurus similar to Homo sapiens mastermind-like 3 (Drosophila) (MAML3) unmapped Unknown AGTTTTCTGGTTTTCCTTTGTACATTGAGCATTGCTTCTTTCCTTTTGAGAAATGTACAG A_73_101624 A_73_101624 FALSE XM_602536 XM_602536 LOC524215 ref|XM_602536 unmapped Bos taurus similar to Homo sapiens SH3 and cysteine rich domain (STAC) TCCAGCCTCCTCCTAGCATTCAGACTCGCATCTTATTAATACAGTTAAACTTCGGTTCAG A_73_101625 A_73_101625 FALSE XM_582447 XM_582447 LOC506055 ref|XM_582447 unmapped PREDICTED: Bos taurus similar to urotensin 2 preproprotein, isoform b (LOC506055) GTAAAATAAAGATGCTTGATTTGAAAGCAGTATAGATGAAAAACTAGGCAAGCTAGACCC A_73_101626 A_73_101626 FALSE XM_583632 XM_583632 LOC507078 ref|XM_583632 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 51, subfamily I, member 2 (OR51I2) AACCCTCTCATTTATAGCGCCAAGACAAAGGAGATCCGTCGAGCCATTGTTCACATGTTT A_73_101627 A_73_101627 FALSE XM_601985 XM_601985 LOC523683 ref|XM_601985 unmapped Bos taurus similar to Homo sapiens cut-like 1, CCAAT displacement protein (Drosophila) (CUTL1), transcript variant 2 ACCACCTCAAAGCTAGAAGAAGCCGAACATAAAGTCCAGACTCTGCAAACAGCCATGAAA A_73_101628 A_73_101628 FALSE XM_591423 XM_591423 LOC540090 ref|XM_591423 unmapped Bos taurus similar to Homo sapiens ring finger protein 2 (RNF2) TTGTGAATATAAGCTTTGTGCTTAGAGAATGTATGTGTTTTTATCCATCAGTATGGGAGG A_73_101629 A_73_101629 FALSE XM_869164 XM_869164 LOC616995 ref|XM_869164 unmapped PREDICTED: Bos taurus similar to heterogeneous nuclear ribonucleoprotein K (LOC616995) ACAACACAACTATTCCCCAAAATTTGGCTGGATCTTATGGGCAAAGGTGGTAAGTGGATT A_73_101630 A_73_101630 FALSE NM_174381 NM_174381 LHCGR ref|NM_174381 unmapped Bos taurus luteinizing hormone/choriogonadotropin receptor (LHCGR) CTGCTGTGCTTTTAGAAACTTGCCAACAAACGATTATTCTGCCATCTTTGCTGAGAGTGA A_73_101631 A_73_101631 FALSE XM_616682 XM_616682 LOC536549 ref|XM_616682 unmapped Bos taurus similar to Homo sapiens KPL2 protein (FLJ23577), transcript variant 1 AGTGAGCATGTACAAGGAAGTGATGAAGAGAGGTCTCCTTCAAGACTTACAGAGGAAAAG A_73_101632 A_73_101632 FALSE NM_001015600 NM_001015600 LOC514812 ref|NM_001015600 unmapped Bos taurus cytokeratin 19 (LOC514812) CATGGGAGGGGAGGGACCCTTACCCTTGCCTCTCCCCCTGACCTGCCAATAAAACTTTAT A_73_101633 A_73_101633 FALSE NM_205802 NM_205802 LAPTM4B ref|NM_205802 unmapped Bos taurus similar to lysosomal associated protein transmembrane 4 beta (LAPTM4B) AACGGCTGCTGCTTCAGAATGAAGAGTTTGGCTCAAAACAGCATGATGGACTAAAGTTTT A_73_101634 A_73_101634 FALSE AW462541 AW462541 gb|Bos taurus similar to Homo sapiens Cdon homolog (mouse) (CDON) unmapped Unknown TGGTCGATATGATTTTCTATTAAAAGAGAATGCTGCTTTCATGTAGAGTAGCTCATGAAG A_73_101635 A_73_101635 FALSE XM_869899 XM_869899 LOC617606 ref|XM_869899 unmapped Bos taurus similar to Homo sapiens DEP domain containing 6 (DEPDC6) GAGGAAGACGTTCACGTTCTGGAAGAGTTCCAGAGAACATGCCCCCTTAGGGCGAGTGGA A_73_101636 A_73_101636 FALSE XM_612082 XM_612082 LOC540559 ref|XM_612082 unmapped PREDICTED: Bos taurus similar to LanC-like protein 1 (40 kDa erythrocyte membrane protein) (p40) (LOC540559) CCTCTTTGAAGGAATGGCTGGAACAATATATTTCTTGGCTGACCTCCTAGTGCCCACAAA A_73_101637 A_73_101637 FALSE NM_001034352 NM_001034352 MGC127113 ref|NM_001034352 unmapped Bos taurus similar to Homo sapiens bolA-like 1 (E. coli) (BOLA1) ATTTCACATTAAGGTTAAGCTAAGAAGAGGGGACAATCCCTACTATTCAGGAAAAGCTGC A_73_101638 A_73_101638 FALSE XM_584435 XM_584435 LOC507760 ref|XM_584435 unmapped Bos taurus similar to Homo sapiens PR domain containing 10 (PRDM10), transcript variant 2 GACAGCAACTTCATAGTTGGAGAATGATGTCTCTTCAAACTGCTTTTGATAAGCAGAAGA A_73_101639 A_73_101639 FALSE XM_608892 XM_608892 LOC530421 ref|XM_608892 unmapped PREDICTED: Bos taurus similar to putative membrane protein Re9 (LOC530421) GACAGTGAGGAGCTTGGGCAGTTCAGAGCAGAGGCCGTGCTGCAGGATGAAGTCATCTAA A_73_101640 A_73_101640 FALSE XM_590631 XM_590631 LOC513015 ref|XM_590631 unmapped PREDICTED: Bos taurus similar to C15A7.2 (LOC513015) ACGTCTATGGGAACGTGACGTTCATCAGCGACTCGGTGCCCAACTTCACGGAGCTCTTCT A_73_101641 A_73_101641 FALSE EE935096 EE935096 gb|Unidentified transcripts unmapped Unknown CAAGACAGATAAAGTACCAGCCTTCGTGGATCTTATACTTTAGCAAGGGAAGATGCGCTA A_73_101642 A_73_101642 FALSE XM_874367 XM_874367 LOC533569 ref|XM_874367 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 70, member A (FAM70A) CCAAGACATCTCAGAAGGAAGCTGAGGAGGTGAACTGCCCTCACCTCAGCCGTGGATTCT A_73_101643 A_73_101643 FALSE BE664952 BE664952 gb|Bos taurus similar to Homo sapiens KIAA0427 (KIAA0427) unmapped Unknown TTCCCTCCCTTGGTATGTCCTGCTTTCCAGCTCAACCCAAACTACAAGTGGGTTTAAAAA A_73_101644 A_73_101644 FALSE AW483578 AW483578 gb|Unidentified transcripts on BTA10 position 5904615-5904047 unmapped Unknown TGACCTCCGCTAGTTCCTTCTGGCTTCTGCCCCTTATACCCCGTCCACTCTCAGCAGGAG A_73_101645 A_73_101645 FALSE XM_866981 XM_866981 LOC615229 ref|XM_866981 unmapped Bos taurus similar to Homo sapiens SET and MYND domain containing 2 (SMYD2) GCTGTAGTTATTTTTCCCTTCATGACTACTGTAATGTTCTGAACAAACATGAATGAAGAG A_73_101646 A_73_101646 FALSE XM_588766 XM_588766 LOC511433 ref|XM_588766 unmapped Bos taurus similar to Homo sapiens deleted in liver cancer 1 (DLC1), transcript variant 1 AAAGCTGCTTCTTGTTTGTGTAAGGTCTGTATTATGGACCTTGACTGGAATATATGACTG A_73_101647 A_73_101647 FALSE NM_001034335 NM_001034335 MGC128433 ref|NM_001034335 unmapped Bos taurus similar to Homo sapiens KIAA0174 (KIAA0174) TCTGTACATACTCCATTCAAGCAACTTTAATGTTTTTGGTTGATTTGTATCTCATGGCTC A_73_101648 A_73_101648 FALSE XM_611979 XM_611979 LOC532797 ref|XM_611979 unmapped Bos taurus similar to Homo sapiens inositol monophosphatase domain containing 1 (IMPAD1) AATTTCTGTGTGTGTGTGTATTGTTTCGTTTTGGTTTGTTTTTATAAAGAGACGTGTGCC A_73_101649 A_73_101649 FALSE XM_595660 XM_595660 LOC517489 ref|XM_595660 unmapped Bos taurus similar to Homo sapiens integrator complex subunit 12 (INTS12) ACAGATGGTCAAGAAGAAGGCTGCCCAAAAGAAACTCAAGAAGTAATGTGGCCAAGTAGG A_73_101650 A_73_101650 FALSE XM_867055 XM_867055 LOC615290 ref|XM_867055 unmapped PREDICTED: Bos taurus similar to Kinase-like domain containing soluble guanylyl cyclase (48 kDa chain) (KSGC) (LOC615290) TTCCTACACCTCCATCCTGGATGATTAACCCACCCGGGGCGGTCATCTCTGGAGGTGAAA A_73_101651 A_73_101651 FALSE XM_876512 XM_876512 LOC513678 ref|XM_876512 unmapped Bos taurus similar to Homo sapiens CHK1 checkpoint homolog (S. pombe) (CHEK1) TGATTGGTCTTTCAAATAGAAGTTGAGCATAAACTCTAGTGCTTAACTACCTTTACTTGG A_73_101652 A_73_101652 FALSE NM_174195 NM_174195 TCN2 ref|NM_174195 unmapped Bos taurus transcobalamin II (TCN2) CTGCGTTGTAGCGGCTGGTGAGGGTTTCTGCAGAGCTCTCAGCTCACCTCTAGAAGGATT A_73_101653 A_73_101653 FALSE XM_581538 XM_581538 LOC505276 ref|XM_581538 unmapped Bos taurus similar to Homo sapiens DEAD (Asp- Glu-Ala-Asp) box polypeptide 41 (DDX41) CCAGAATTACTATTTTTGCTCCCCTTTAGCCTAGCTGCCATTAAAGCACAAGCCTTTCTG A_73_101654 A_73_101654 FALSE NM_174702 NM_174702 Aqp1 ref|NM_174702 unmapped Bos taurus aquaporin 1 (Aqp1) TCTGCTCTGCATATATGCCTCTTTGGAATTGGAATTTCATTATATGTTAAGAAAATAAAC A_73_101655 A_73_101655 FALSE XM_617616 XM_617616 LOC537451 ref|XM_617616 unmapped PREDICTED: Bos taurus similar to glycogen synthase 2 (liver) (LOC537451) AGGAAGAGGCCGAAAGGGATCGGTTAAATATCAAGTCTCCGTTTTCTCTGAGTCACGTTT A_73_101656 A_73_101656 FALSE XM_583558 XM_583558 LOC507017 ref|XM_583558 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to CG4768-PA (LOC389895) TGGCCGCCGAAGAAGTAGCTTCCTCGAGGATGACTTGAGCCCGATCGACTGTGAAGAACT A_73_101657 A_73_101657 FALSE NW_001029622 NW_001029622 gb|Putative orthologue of human miRNA hsa-mir-99b on chr 19, (+) strand. Mature length 22 nt, stem-loop length 70 nt. Source: NW_001029622.1:c3653-3584 unmapped Unknown CACCCGTAGAACCGACCTTGCGTATCCTACTATACGTATCACATA A_73_101658 A_73_101658 FALSE XM_598303 XM_598303 LOC520072 ref|XM_598303 unmapped Bos taurus similar to Homo sapiens FERM and PDZ domain containing 1 (FRMPD1) GAGTTCAGTTGGAAACAGGATTGGGATCTCTGTTTATAAATCCTATGCCAGAAACTGCCC A_73_101659 A_73_101659 FALSE XM_599120 XM_599120 LOC520870 ref|XM_599120 unmapped PREDICTED: Bos taurus similar to obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (LOC520870) TGAATTTAGAAATGGAAAGGAAAAAGTCACAGCTGCCACGTCAGTTGGCATCGCTAACGA A_73_101660 A_73_101660 FALSE XM_605509 XM_605509 LOC527120 ref|XM_605509 unmapped PREDICTED: Bos taurus similar to Nucleolar transcription factor 1 (Upstream binding factor 1) (UBF-1) (LOC527120) GATGGAGATTTTGAACCCGAGGAGCACAGCTCCAGCTCATCGTCCTCAAGGGACTCCTCT A_73_101661 A_73_101661 FALSE XM_870923 XM_870923 LOC618591 ref|XM_870923 unmapped PREDICTED: Bos taurus similar to Killer cell lectin-like receptor subfamily F member 1 (Lectin-like receptor F1) (Activating coreceptor NKp80) (LOC618591) TTTGTCTGACTAAGAGACACCACATGAAGTTTGAGCTCAGATCATAAGAAAGCTCAGAGG A_73_101662 A_73_101662 FALSE XM_590302 XM_590302 LOC512732 ref|XM_590302 unmapped Bos taurus similar to Homo sapiens stathmin- like 4 (STMN4) TGTGACGGGGGGATGAGGTGTGAATGTGTGTGCGTGTGTTAACCATTATCTTTTGATCAT A_73_101663 A_73_101663 FALSE XM_864615 XM_864615 LOC535171 ref|XM_864615 unmapped Bos taurus similar to Homo sapiens membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) (MPP6) CAGGGTCTGCTTCATGTGGGAGATATCATTAAAGAAGTCAATGGCCATGAAGTTGGAAAC A_73_101664 A_73_101664 FALSE NM_174494 NM_174494 ACADVL ref|NM_174494 unmapped Bos taurus acyl-coenzyme A dehydrogenase, very long chain (ACADVL) CCATGACTGTGCCTGCTCTCAGAGGAAGCACTTACTGCCTCACAAATAAAGTTTCTAACA A_73_101665 A_73_101665 FALSE NM_001035386 NM_001035386 MGC128112 ref|NM_001035386 unmapped Bos taurus similar to Homo sapiens catalase (CAT) GAGGAAGAACACATTGCTGTCTTTTGAAAATAACTTCAGCACCATCATGGCTTGATGTTT A_73_101666 A_73_101666 FALSE NM_174576 NM_174576 PIK3R2 ref|NM_174576 unmapped Bos taurus phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) (PIK3R2) TATGTAGGCAAGATCAACCGCACCCAAGCTGAGGAAATGCTGAGTGGCAAGCGGGACGGT A_73_101667 A_73_101667 FALSE XM_592471 XM_592471 LOC514598 ref|XM_592471 unmapped Bos taurus similar to Homo sapiens hypothetical protein MGC3265 (MGC3265) CCTCCGGTGTGGGTCCTGGTGACCCACTCTCTGCCTTTCCATCTTAAGGATTCTCACAGT A_73_101668 A_73_101668 FALSE XM_866767 XM_866767 LOC511930 ref|XM_866767 unmapped Bos taurus similar to Homo sapiens PDZ domain containing 7 (PDZD7) ACTTACTAATTGGTTTTAAAACCCACTCACTTGTTAAATCATCTCATTCTATGCAATAAT A_73_101669 A_73_101669 FALSE XM_588909 XM_588909 LOC511554 ref|XM_588909 unmapped Bos taurus similar to Homo sapiens chromosome 18 open reading frame 19 (C18orf19) ATGTGTGATTCCAAATTGACAGCCCTTTTTCAAATCCAGACACAGTGAACCTGTTTTAAC A_73_101670 A_73_101670 FALSE XM_618251 XM_618251 LOC538058 ref|XM_618251 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ37357 (FLJ37357) AGAATTGGAGATGAAATGTCTTTGCCAGGTGTATTTTGGAAGAGCAAGACCAGACAGCAT A_73_101671 A_73_101671 FALSE EE944090 EE944090 gb|Unidentified transcripts unmapped Unknown CAGAGTTTAGGTTCCAGGCGAGCAAAGTTGAAAGCCAGCCATGTATTTGTACCATCAGAA A_73_101672 A_73_101672 FALSE XM_868676 XM_868676 LOC535138 ref|XM_868676 unmapped Bos taurus similar to Homo sapiens CDC91 cell division cycle 91-like 1 (S. cerevisiae) (CDC91L1) GAAAGGGGATGAAGCAGGTGAGCAGGGTTTGTTAGGTTGTGGCTAATTAATAAATGTTTT A_73_101673 A_73_101673 FALSE XM_593680 XM_593680 LOC515627 ref|XM_593680 unmapped PREDICTED: Bos taurus similar to Tripartite motif 40 protein (RING finger protein 35) (LOC515627) AAGAATCAATGAGTCACTTGTCCAGCCATCCTCAGCGGCTCTGACCTGTTCATCCCTGGG A_73_101674 A_73_101674 FALSE AV664724 AV664724 gb|Bos taurus similar to Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (ELAVL3), transcript variant 2 unmapped Unknown TTCATCCTGTTATTTATTTGGATGGGTTCAAATCAAGACAGAGTCCATGTTGGAGGTGAT A_73_101675 A_73_101675 FALSE XM_615938 XM_615938 LOC535824 ref|XM_615938 unmapped Bos taurus similar to Homo sapiens myosin IIIA (MYO3A) CACATCGGATACTTTTTGCCAACTTTATAAAACGGTGTGTGAACTTCTTTTTAAGTTTCC A_73_101676 A_73_101676 FALSE XM_870636 XM_870636 LOC618305 ref|XM_870636 unmapped Bos taurus similar to Homo sapiens spermatogenesis and centriole associated 1 (SPATC1) TGCTGCTGCTCTCCTGCCTCAGCCAGCTGGCCCACGATGATGGCAAGCCCATGTTCATCT A_73_101677 A_73_101677 FALSE NM_001024528 NM_001024528 MGC5297 ref|NM_001024528 unmapped Bos taurus similar to hypothetical protein MGC5297 (MGC5297) CATCTTTTTGCCATGAAGTGATGGGACCTGATGCTGTGATCTTAGTTTTTTGAATGTTGA A_73_101678 A_73_101678 FALSE BM366252 BM366252 gb|Unidentified transcripts on BTA19 position 13980789-13979951 unmapped Unknown GCTGTCTTTCCACAAAGCCAGTTCCTTCCTTTGCCCAACAGCAGACCTTAGCCTTGAGTT A_73_101679 A_73_101679 FALSE BE723649 BE723649 gb|Unidentified transcripts on BTA19 position 14299101-14300648 unmapped Unknown AGTGTCAGTTACGTGATGATCTTCCTTTATTGATGTCTTACTTCATGTTCAGTGTTTCAA A_73_101680 A_73_101680 FALSE XM_874563 XM_874563 LOC613966 ref|XM_874563 unmapped Bos taurus similar to Homo sapiens phospholipase A2, group X (PLA2G10) ATTTCTTGTGTGGGAACTACTCACCCGAGTGTGACTGACTAGCCTGACTTGAAACGTTTT A_73_101681 A_73_101681 FALSE XM_872416 XM_872416 LOC540705 ref|XM_872416 unmapped Bos taurus similar to Homo sapiens ethanolamine kinase 1 (ETNK1), transcript variant 1 CAAGAAATATACCTACTGCTTTCAGTATGTGGTGGGTTAGAAGTTTGTTAAATCGGCAAA A_73_101682 A_73_101682 FALSE XM_606127 XM_606127 LOC527730 ref|XM_606127 unmapped PREDICTED: Bos taurus similar to F40B5.2b (LOC527730) CACGGCCTATTATGGGATACCCATGCGTCTGGGCAGCAGGGCAGAAATTACCCAGCTCAT A_73_101683 A_73_101683 FALSE XM_868565 XM_868565 LOC615690 ref|XM_868565 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 3, member C (FAM3C), transcript variant 1 ACTTTATACTTAGTTTATACATATTATAAATAAATTGACCCCTCCAAAAAGATGATAGTC A_73_101684 A_73_101684 FALSE XM_581644 XM_581644 LOC505368 ref|XM_581644 unmapped PREDICTED: Bos taurus similar to transmembrane protein 41A, transcript variant 1 (LOC505368) CTTGACTTCGCAACAATGTGCCTTAGCAGTTGTGACTTTACAGGCAAAGCAGTTTCCCAA A_73_101685 A_73_101685 FALSE XM_581016 XM_581016 LOC504835 ref|XM_581016 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L1 (MRPL1), nuclear gene encoding mitochondrial protein TTTTGGATGATGAAATTCAAGCAGATTTTTATATAGCTGTTCCAGAAATAATGCCCGAGC A_73_101686 A_73_101686 FALSE XM_597409 XM_597409 LOC519196 ref|XM_597409 unmapped PREDICTED: Bos taurus similar to Netrin receptor DCC precursor (Tumor suppressor protein DCC) (Colorectal cancer suppressor) (LOC519196) CTGCAGAGCTCACAGTCTTGGGAAAAGTGTCAAAGAAAATTTATATTCTCACCAGCAGTA A_73_101687 A_73_101687 FALSE XM_589261 XM_589261 LOC539767 ref|XM_589261 unmapped PREDICTED: Bos taurus similar to Ras association (RalGDS/AF-6) domain family 5 isoform C (LOC539767) CAACAAGTTCAGGCAGAAACTGGAGGAGGCCTTGAGAAAAGCCCAGGGCAAACCTGCCTA A_73_101688 A_73_101688 FALSE AW660846 AW660846 gb|Unidentified transcripts on BTA8 position 14281052-14281352 unmapped Unknown TTTCACCTTCTTGATCATCTCCTTCTTCTTCAGAATCAGAGGTTGATGTAACCCCTGTTT A_73_101689 A_73_101689 FALSE XM_580543 XM_580543 LOC538470 ref|XM_580543 unmapped PREDICTED: Bos taurus similar to epsin 2 (LOC538470) TTAATGTCATCAGTAGCCGTCTGGTAAGCATGAGTGGCTCCAGTCCACAAATAAGCAAGT A_73_101690 A_73_101690 FALSE XM_866049 XM_866049 LOC524427 ref|XM_866049 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 42 (C20orf42) ATGAAGGTCTGAGATTAGATGGCCTCTAAGGCAGTGGCTTGAAAAACCTTGCTATACCCT A_73_101691 A_73_101691 FALSE XM_613553 XM_613553 LOC540879 ref|XM_613553 unmapped Bos taurus similar to Homo sapiens chromosome 21 open reading frame 7 (C21orf7) ATACATGAGTAAATTCAGGATTAATATGATCTTCCCGTTGTTCGTATCACAATGTTTCCC A_73_101692 A_73_101692 FALSE AW654484 AW654484 gb|Unidentified transcripts on BTA5 position 58377744-58376965 unmapped Unknown TTGCCCATGAATACAGCCCCACGTCAGCTGTAATAACACACCAGTCATTTCCAGAAAAAT A_73_101693 A_73_101693 FALSE NM_174097 NM_174097 LAGY ref|NM_174097 unmapped Bos taurus homeodomain only protein (LAGY) GAAAGCACTCAGGCTGGAAGACAAAAATCCCAACTGGCAAAAATCAAATAACTAAGGGGG A_73_101694 A_73_101694 FALSE NM_001035030 NM_001035030 MGC126934 ref|NM_001035030 unmapped Bos taurus similar to Homo sapiens myotubularin related protein 11 (MTMR11) TGAAATATACACGGGACACCCTATCTCTTCCAATTATCTATTTTCGTCGTGACATTTCTA A_73_101695 A_73_101695 FALSE NM_001035371 NM_001035371 ZNF262 ref|NM_001035371 unmapped Bos taurus similar to Homo sapiens zinc finger, MYM-type 1 (ZMYM1) CATTGGCAGATACTCATGATGCCCTGCCCATTGTGAACTCTGATGTATTACAAGGTAAAA A_73_101696 A_73_101696 FALSE XM_604513 XM_604513 LOC526153 ref|XM_604513 unmapped Bos taurus similar to Homo sapiens bromodomain containing 7 (BRD7) CTGGGGCTGAATCGGAGGAGGAAGTGATAGAGAAAAGCTTGGAGAATAAAACAGCCTTTT A_73_101697 A_73_101697 FALSE NM_001038090 NM_001038090 CYC1 ref|NM_001038090 unmapped Bos taurus similar to Homo sapiens cytochrome c-1 (CYC1) CTCCAGTTCCAGATCGTTCAGCGCCCACTGTGGAAATAAATTAAGTTTCTCAACACACCT A_73_101698 A_73_101698 FALSE XM_600561 XM_600561 LOC522282 ref|XM_600561 unmapped Bos taurus similar to Homo sapiens zinc finger protein 406 (ZNF406), transcript variant ZFAT-1 AAGATAGGTTTTGATATCAAAGTTTTACAAAAGAAGGAGAACGGGAGTGTGGCTGGGGGA A_73_101699 A_73_101699 FALSE XM_872882 XM_872882 LOC539014 ref|XM_872882 unmapped Bos taurus similar to Homo sapiens chromosome 8 open reading frame 76 (C8orf76) AACAAAAAACATCTTGTACTGTATTAAGTGTTCTGGTTTACTTCAGACAGAATCCTCTGC A_73_101700 A_73_101700 FALSE XM_613470 XM_613470 LOC533908 ref|XM_613470 unmapped Bos taurus similar to Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 1 (RPS6KA1), transcript variant 1 CTGGTAACTCAGGGTTCATCTGTCCATGGCCTTTCTAATAAACTTACAGTTGAATTGAAG A_73_101701 A_73_101701 FALSE XM_617657 XM_617657 LOC537489 ref|XM_617657 unmapped Bos taurus similar to Homo sapiens chromosome X open reading frame 53 (CXorf53), transcript variant 1 AGGTTTTGTAGGACTTATCTTTTCCTGCTTCATAGAAGATAAAAATACAAAGACTGGACG A_73_101702 A_73_101702 FALSE XM_586436 XM_586436 LOC509471 ref|XM_586436 unmapped Bos taurus similar to Homo sapiens ubiquitin- conjugating enzyme E2L 6 (UBE2L6), transcript variant 1 TTTAGGTGCAAAACCTTTCCGTTTCCACTGATGAATCATAAAGTGAAGAATCTCCTCTCC A_73_101703 A_73_101703 FALSE XM_866557 XM_866557 LOC614906 ref|XM_866557 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L3 (MRPL3), nuclear gene encoding mitochondrial protein TTTGTCTGTCTTTGTGAAAGGGTGGTTGTGGAATGGTGTCAAGTCATATGGAGACTAAAT A_73_101704 A_73_101704 FALSE XM_587570 XM_587570 LOC510430 ref|XM_587570 unmapped Bos taurus similar to Homo sapiens receptor transporter protein 1 (RTP1) CAATTTCTTCTCCATCCCCTGGTGCTTGTTTTGGGCCACGGTCCTGCTGCTGATCATCTA A_73_101705 A_73_101705 FALSE XM_866515 XM_866515 LOC614873 ref|XM_866515 unmapped PREDICTED: Bos taurus similar to Beta-1,3-galactosyltransferase 5 (Beta-1,3-GalTase 5) (Beta3Gal-T5) (b3Gal-T5) (UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase 5) (UDP-Gal:beta-GlcNAc beta-1,3-galactosyltransferase 5)... ACGGTTCAATAAGTGGTTTGTCAGTAAGTACGAATATCCGTGGGACAAGTACCCACCCTT A_73_101706 A_73_101706 FALSE XM_603481 XM_603481 LOC525134 ref|XM_603481 unmapped PREDICTED: Bos taurus similar to low density lipoprotein receptor-related protein 2 (LOC525134) GTGTGGTGAGTATGGAAATTTGTCTGGACATCTTTCAGGGATCTATACTTGGAGTTACTC A_73_101707 A_73_101707 FALSE XM_610012 XM_610012 LOC531514 ref|XM_610012 unmapped PREDICTED: Bos taurus similar to Cytoplasmic tyrosine-protein kinase BMX (Bone marrow tyrosine kinase gene in chromosome X protein) (Epithelial and endothelial tyrosine kinase) (ETK) (NTK38) (LOC531514) AGAAAAGCGTCCCACATTTCAGCAGCTCCTATCATCCATTGAACCACTTCGGGAAAAAGA A_73_101708 A_73_101708 FALSE XM_604089 XM_604089 LOC525734 ref|XM_604089 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 176 (GPR176) GACTCTAGGAGAAGCCCAAGATAGTCATGGAGCCATGTGACCATACAGAAAATGCCTATT A_73_101709 A_73_101709 FALSE AU278193 AU278193 gb|Bos taurus similar to Homo sapiens ring finger protein 4 (RNF4) unmapped Unknown ACTTTATCCATGTTCGTCAGTCTGTTTTTGACTTCTCTGCTAGTGTTACAGGTGAAAATA A_73_101710 A_73_101710 FALSE XM_864194 XM_864194 LOC613438 ref|XM_864194 unmapped Bos taurus similar to Homo sapiens lipocalin 9 (LCN9) ACGTGGTGAGAGAAAAAGGGATTCCAGAAGAAAATATCCGGAATTTCATCTACAATGACA A_73_101711 A_73_101711 FALSE XM_599038 XM_599038 LOC520788 ref|XM_599038 unmapped Bos taurus similar to Homo sapiens cation channel, sperm associated 4 (CATSPER4) CTCCATGAACAACTCTGCAGCTTTGGGAATTACAGAGTATTCCTCCACAACTTCAGCCCC A_73_101712 A_73_101712 FALSE BG688817 BG688817 gb|Bos taurus similar to Homo sapiens protein regulator of cytokinesis 1 (PRC1), transcript variant 1 unmapped Unknown ACAAGAACTGAAAATTCTTCAAGAACAAGATCAAGAACTGTGTGAAATTCTTTGCATGCC A_73_101713 A_73_101713 FALSE CB537097 CB537097 gb|Unidentified transcripts on BTA17 position 35069677-35071082 unmapped Unknown CCACATTCAGAATTTCCCCCATCCGCTAAGTGTACAGACAAAGCATTGGTCAAGAAGCTT A_73_101714 A_73_101714 FALSE XM_583921 XM_583921 LOC507330 ref|XM_583921 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 59, member A (FAM59A) TTGCACTGTTTCCAGAGCATTATCTATGGGCCCAATGTGTACCTCAAGATAAACATGGTT A_73_101715 A_73_101715 FALSE XM_606893 XM_606893 LOC528470 ref|XM_606893 unmapped PREDICTED: Bos taurus similar to beta globin (LOC528470) CAGTCTCCTTGGCAACATACTGGTAATTACACTGGCTCAAAACTTTGGCAAGGAATTCAC A_73_101716 A_73_101716 FALSE CB449329 CB449329 gb|Unidentified transcripts on BTA13 position 27906023-27906738 unmapped Unknown GTTACTCTGTAACAAATAGGCAAATCTCTTGGTTGTAGCTCATTTGTACAAAAATAATGT A_73_101717 A_73_101717 FALSE XM_868220 XM_868220 LOC616245 ref|XM_868220 unmapped PREDICTED: Bos taurus similar to doublesex and mab-3 related transcription factor 1 (LOC616245), partial mRNA. TGCCCAGCACGGCTGAACTGATGGTCAAGAGAGAGAACAGCAGCGGCAACCCGTGCCTGA A_73_101718 A_73_101718 FALSE CB455956 CB455956 gb|Unidentified transcripts on BTA10 position 68988298-68987873 unmapped Unknown GTATCATACACCAAAGCCAGTCTGATAAATAATGCCCTGCTCTGAATTATTATTCAAGGC A_73_101719 A_73_101719 FALSE NM_001038544 NM_001038544 GAMT ref|NM_001038544 unmapped Bos taurus similar to Homo sapiens guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 CCTACCCCTCTCTGCCAGAGGACCTAGGGATGAAATAAACGCTAATGCTGGTCTGGCCCA A_73_101720 A_73_101720 FALSE XM_586206 XM_586206 LOC509273 ref|XM_586206 unmapped Bos taurus similar to Homo sapiens fumarylacetoacetate hydrolase domain containing 1 (FAHD1), transcript variant 2 ATGAAGACCTCACTCATTTAGTTAGGGTGTGTATTCTGGCCCATAGAGTCTGAGTTTGGG A_73_101721 A_73_101721 FALSE XM_582593 XM_582593 LOC538773 ref|XM_582593 unmapped Bos taurus similar to Homo sapiens zinc finger protein 555 (ZNF555) CGCGTCATGGAAGTGGATCCATATGGAGTGTATTTCTAATTCTTTTTGATGAAAATTAAC A_73_101722 A_73_101722 FALSE AW447437 AW447437 gb|Unidentified transcripts on BTA1 position 55863813-55864578 unmapped Unknown AGGACAACAGTGGAAATTAAAGTCATAGACAATTTAGAACTTCAGTTTTTTCCCTCTTGG A_73_101723 A_73_101723 FALSE CB454766 CB454766 gb|Bos taurus similar to Homo sapiens chromosome 1 open reading frame 182 (C1orf182) unmapped Unknown CTGCCCCAATTCAGTAAATGAATTGTGGAACAAAGTTATTGTGTATGTTTTCCCTGCTGT A_73_101724 A_73_101724 FALSE XM_874694 XM_874694 LOC529109 ref|XM_874694 unmapped Bos taurus similar to Homo sapiens cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa (CRSP2) GACCGCTTTGAATCCTTACATGAAAATGTTCTGGGAGTTGTTATAAACACACCCCAAAGA A_73_101725 A_73_101725 FALSE NW_930895 NW_930895 gb|Bovine miRNA bta- mir-128a on chr 2, (-) strand. Mature length 22 nt, stem-loop length 82 nt. Source: NW_930895.1:c363255-363174 unmapped Unknown TCACAGTGAACCGGTCTCTTTTTATCCTACTATACGTATCACATA A_73_101726 A_73_101726 FALSE XM_868377 XM_868377 LOC616371 ref|XM_868377 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 150 (C9orf150) GTTTTCAGAGCAAGGGGTCAGGGATTACAAGATAAACTTTGCTAAATTTTACAATAAACC A_73_101727 A_73_101727 FALSE NM_001034272 NM_001034272 C1orf35 ref|NM_001034272 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 35 (C1orf35) CGTGGAGAGCAGTCGGCCAGGGACCTCCTTGGCTTTGGCCAAGAAGAAGCTTCGGTCAGA A_73_101728 A_73_101728 FALSE NM_174383 NM_174383 LOXL1 ref|NM_174383 unmapped Bos taurus lysyl oxidase-like 1 (LOXL1) GGAACTACATCCTCAAGGTGCATGTGAACCCAAAGTACATCGTTTTGGAGTCTGACTTCA A_73_101729 A_73_101729 FALSE XM_864900 XM_864900 LOC613788 ref|XM_864900 unmapped Bos taurus similar to Homo sapiens polymerase (RNA) II (DNA directed) polypeptide F (POLR2F) AGTCAGCCTGTGGACTGGGCCTCCGCCCTGGCTCGTCTCCTAGTCTTTTTATAGTCTTGA A_73_101730 A_73_101730 FALSE XM_869325 XM_869325 LOC617131 ref|XM_869325 unmapped Bos taurus similar to Homo sapiens chromosome 7 open reading frame 31 (C7orf31) AGGTAGCAGAGTTAACTGGACAGATAGGATTTGACCCAGAGCCTATTTTCTACTATGCTA A_73_101731 A_73_101731 FALSE XM_607672 XM_607672 LOC529229 ref|XM_607672 unmapped PREDICTED: Bos taurus similar to neurestin alpha (LOC529229) GTCGTGCGTTGCAACTGGCTGTTCCCTCAGGGACACAATGCTTCCTGCTGCCTCTCAAAT A_73_101732 A_73_101732 FALSE XM_612247 XM_612247 LOC533000 ref|XM_612247 unmapped Bos taurus similar to Homo sapiens guanosine monophosphate reductase (GMPR) CCAAACTCAAAGAGCTCAGCAGGAGGGCGACGTTCATCCGAGTGACCCAGCAACACAACA A_73_101733 A_73_101733 FALSE NM_001015517 NM_001015517 OTUB2 ref|NM_001015517 unmapped Bos taurus OTU domain, ubiquitin aldehyde binding 2 (OTUB2) AAGCTGGAAGGAAAGTTGTTTTGAGAGTTTGTCTTTACAACTGCATATGTGTTACCTTCC A_73_101734 A_73_101734 FALSE BI540940 BI540940 gb|Bos taurus similar to Homo sapiens proprotein convertase subtilisin/kexin type 2 (PCSK2) unmapped Unknown TAACAGTCTGAAAATAAACCAAAGGACATTAAGTGTGCATGTATGTTTAACTGCACACAG A_73_101735 A_73_101735 FALSE XM_868884 XM_868884 LOC616775 ref|XM_868884 unmapped Bos taurus similar to Homo sapiens beta-1,3-N-acetylgalactosaminyltransferase 2 (B3GALNT2) GTTTTTCTGAAGCTTTAGCTGGAAGTACAGCAATAGTGGGGTGTTCCTACAGATATCACA A_73_101736 A_73_101736 FALSE XM_606562 XM_606562 LOC528150 ref|XM_606562 unmapped Bos taurus similar to Homo sapiens mannosidase, alpha, class 1A, member 1 (MAN1A1) TCTGGAACATTGGATCTTCAACACCGAGGCACATCTTCTCCCTGTACTCTCTAGGAATTT A_73_101737 A_73_101737 FALSE XM_866963 XM_866963 LOC513049 ref|XM_866963 unmapped Bos taurus similar to Homo sapiens chromosome 12 open reading frame 44 (C12orf44) GCGGGCGGGGTTCCCCTTTCCTACACTGTACAGAGGACCCATCACTAGGATGGTGAATAA A_73_101738 A_73_101738 FALSE BE476534 BE476534 gb|Bos taurus similar to Homo sapiens vasohibin 1 (VASH1) unmapped Unknown CACTTCCAACTTGGACTTGACTTCCTGGCCCAAGGACTGGGTCTCCTTCTGACCAGGAGT A_73_101739 A_73_101739 FALSE XM_589637 XM_589637 LOC512180 ref|XM_589637 unmapped Bos taurus similar to Homo sapiens KIAA0494 (KIAA0494) TTTTTTCTCTTTCCCTTTTCTGAAGGGAGGAGACCTTATCTTTTAAAACTGGAAAATGTG A_73_101740 A_73_101740 FALSE EE899183 EE899183 gb|Unidentified transcripts on BTA22 position 32164609-32163871 unmapped Unknown GCATAAGTGTACGACTCTTCCCCAAAAACCTCCAGTAGTTCACACCATCAACAAGAATAG A_73_101741 A_73_101741 FALSE XM_581857 XM_581857 LOC505555 ref|XM_581857 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 27 (C6orf27) CCGGTCCTCAACACCTCACGCCCTGCCTTCCATTTTTTCACCTCAGTCACTCAGGGTGGG A_73_101742 A_73_101742 FALSE CB420762 CB420762 gb|Bos taurus similar to Homo sapiens chromosome 11 open reading frame2 (C11orf2) unmapped Unknown AGCGTATTGATGTGTTCAGCCCTGTGGAGTTCAATAAGGTGTCGGTGCTGACCGGCATCA A_73_101743 A_73_101743 FALSE XM_598046 XM_598046 LOC519819 ref|XM_598046 unmapped PREDICTED: Bos taurus similar to CG11156-PA (LOC519819) CCTTAAGAAAGCACATTTATAGAGATCAGAAAGAAAGGAAGAATTCTGTTTTTGCTGGTC A_73_101744 A_73_101744 FALSE XM_580300 XM_580300 LOC504219 ref|XM_580300 unmapped Bos taurus similar to Homo sapiens protein kinase, AMP-activated, gamma 2 non-catalytic subunit (PRKAG2), transcript variant a TGCAGTATTGTCATATGGTTGAGGAGAAACACAATGTTTCCTAGTGTAAGTGCTCTGAAA A_73_101745 A_73_101745 FALSE NM_001038543 NM_001038543 SPAG7 ref|NM_001038543 unmapped Bos taurus similar to Homo sapiens sperm associated antigen 7 (SPAG7) GGAATTTTCTTCCCCATGGGGCTGGGATTACTTTACATTCAATAAACACCGTTTGACCCA A_73_101746 A_73_101746 FALSE XM_874412 XM_874412 LOC535408 ref|XM_874412 unmapped Bos taurus similar to Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4) GTGCAGGGATTTTTACCCAGCCAGCTAACTTTACTACCTTCCTTGAAGGTGGATCTTTTT A_73_101747 A_73_101747 FALSE CB423328 CB423328 gb|Bos taurus similar to Homo sapiens ryanodine receptor 2 (cardiac) (RYR2) unmapped Unknown TTTTGAAAAAGACGGGTGGCCTGTCTCATGACGAGAGGAGGTTCTTCTCATTCATCCAAA A_73_101748 A_73_101748 FALSE XM_589392 XM_589392 LOC511963 ref|XM_589392 unmapped Bos taurus similar to Homo sapiens PDZ domain containing RING finger 4 (PDZRN4) TTGTCTCAGTAAAGTGTAGGTGGACAATCTTCCTGTGGTATGTAGTGACACTGTTTATGT A_73_101749 A_73_101749 FALSE XM_869051 XM_869051 LOC616913 ref|XM_869051 unmapped PREDICTED: Bos taurus similar to Frizzled 8 precursor (Frizzled-8) (Fz-8) (mFz8) (LOC616913) CATCCGCTCGGTCATCAAGCAGCAAGGTGGCCCCACCAAGACGCACAAGCTGGAGAAGCT A_73_101750 A_73_101750 FALSE EE890683 EE890683 gb|Unidentified transcripts on BTA2 position 21601676-21602675 unmapped Unknown AGGACCTCTTTCCTTAATGGACAAACTGTTTCTATATTTTATCCTCTAAGCTTCAGTTTC A_73_101751 A_73_101751 FALSE XM_864459 XM_864459 LOC515809 ref|XM_864459 unmapped Bos taurus similar to Homo sapiens galactosamine (N-acetyl)-6-sulfate sulfatase (Morquio syndrome, mucopolysaccharidosis type IVA) (GALNS) ACTGAATCAGTGTGTGCACCATACTCTATGAATTGTTTTTGTATCATTGAAAGATAAATT A_73_101752 A_73_101752 FALSE XM_868161 XM_868161 LOC616193 ref|XM_868161 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 4, subfamily D, member 5 (OR4D5) CTGAGAAACAAAGAAGTGATCATAGCCATGAAGAAGCTGTGGAGGAGGCAAAAGGACCTT A_73_101753 A_73_101753 FALSE BE722042 BE722042 gb|Bos taurus similar to Homo sapiens neurofascin homolog (chicken) (NFASC) unmapped Unknown GGCCGTAGAAGACCATCTAATATGTGGACTTATAAACTGACTGCATGAGCAATGGAAAGG A_73_101754 A_73_101754 FALSE BF043626 BF043626 gb|Bos taurus similar to Homo sapiens zyxin (ZYX), transcript variant 1 unmapped Unknown CCCAGCCCCAGCCCCTGTGCTGCCAGGTTGTGGCTACAGCTACAAATAAAAGACAGTGTT A_73_101755 A_73_101755 FALSE XM_585735 XM_585735 LOC508888 ref|XM_585735 unmapped Bos taurus similar to Homo sapiens phospholipase C, beta 2 (PLCB2) CATGTGCCCCCGACTCAGACTGTCTGACAAGGTCAGCACCTGTATGAAGTTTATTTATTT A_73_101756 A_73_101756 FALSE NM_001014911 NM_001014911 HSPBAP1 ref|NM_001014911 unmapped Bos taurus Hspb associated protein 1 (HSPBAP1) TCTCTGCATCAGCCTCAAGCAGGGGTCAGCCTGCTGCTTGTTTTTGTAAATAAAGTTGTA A_73_101757 A_73_101757 FALSE XM_580734 XM_580734 LOC504587 ref|XM_580734 unmapped Bos taurus similar to Homo sapiens chromosome 19 open reading frame 43 (C19orf43) ACCTCCCACCCTTTAGCCATCACTTCTGGGAAGTAAAGAACATGACTTAGTGCCAGAAAA A_73_101758 A_73_101758 FALSE XM_618301 XM_618301 LOC538107 ref|XM_618301 unmapped Bos taurus similar to PREDICTED: Homo sapiens KIAA1713, transcript variant 1 (KIAA1713) TTTTACCCAATTAGCTGCTCAGAAAATGCAGGTGCAGCAACAACAGCAGCTCTGTGGAAA A_73_101759 A_73_101759 FALSE AW652254 AW652254 gb|Bos taurus similar to Homo sapiens COX18 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX18) unmapped Unknown ACATAGCCATGGGGAGGAAATGATTCCATGATTCCTGTACATAATAACTGGCCTGCCATC A_73_101760 A_73_101760 FALSE XM_580505 XM_580505 LOC504393 ref|XM_580505 unmapped Bos taurus similar to Homo sapiens transmembrane protein 25 (TMEM25) GATACTGCCAAGGACAGTGCTGAGCACACAGTAGGTTCAATAAACTTGACTGAGTGAATG A_73_101761 A_73_101761 FALSE BM090269 BM090269 gb|Bos taurus similar to Homo sapiens zinc finger protein 507 (ZNF507) unmapped Unknown TTGTGTTCATGGTAGAACAGTTTATCTGTTCAATAAACAGCGAAGCAAGGTCTTAGCGCT A_73_101762 A_73_101762 FALSE XM_581757 XM_581757 LOC505468 ref|XM_581757 unmapped Bos taurus similar to Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 9 (CYP2C9) TGGGGGAATGATCTCTTGACAGTTTGGATGTATAATTTTGCCTTTTCCCAATGTTTATTA A_73_101763 A_73_101763 FALSE AV612908 AV612908 gb|Bos taurus similar to Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 unmapped Unknown GACCAAGGAATAACATTCTGTAGTTCCTAAAAATACTGACTTTTTTCACTACGTAAAGGG A_73_101764 A_73_101764 FALSE CB430575 CB430575 gb|Unidentified transcripts on BTA18 position 49043576-49044196 unmapped Unknown TCACTTTTCTCCAATGGACTTTTGTTAGAAACAACTCTTCCCGAATTCCTTGTTTTGTTT A_73_101765 A_73_101765 FALSE NM_174290 NM_174290 CRYAB ref|NM_174290 unmapped Bos taurus crystallin, alpha polypeptide 2 (CRYAB) TAAACGCATTTTTTAAAACAAGAAAAGTTCCCCACCAGTGAATGAAAACCTTGTGACTAG A_73_101766 A_73_101766 FALSE CB437429 CB437429 gb|Unidentified transcripts on BTA16 position 54918344-54917969 unmapped Unknown TCTTGTGTGTTCTGTGCAAAATTGGACTCCTGCCATATGTGTGTATTACTGTTTCAAGGA A_73_101767 A_73_101767 FALSE XM_864798 XM_864798 LOC614011 ref|XM_864798 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 149 (C6orf149) TTTCTCGGTCCTTGACAATAAATGGAAGCATCTCCCTGGCTTCTCTGCCAGAAAAGGAAA A_73_101768 A_73_101768 FALSE NM_174015 NM_174015 CD8A ref|NM_174015 unmapped Bos taurus CD8 antigen, alpha polypeptide (p32) (CD8A) CCTCAGGGATAATCCATTGTTAATATTATGGGCTACATTCTTCCTGATTATTTTCTGTGC A_73_101769 A_73_101769 FALSE XM_586149 XM_586149 LOC509231 ref|XM_586149 unmapped Bos taurus similar to Homo sapiens protein inhibitor of activated STAT, 1 (PIAS1) TCCCATCCCCACCCCAGATTAAAGGAACTTGGCAGAAAGAAGAGAACTTTGTGCTATGTT A_73_101770 A_73_101770 FALSE XM_582978 XM_582978 LOC506521 ref|XM_582978 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L41 (MRPL41), nuclear gene encoding mitochondrial protein GGTGGCGGGTGGAGAGGCGGTTCCCTCGTTTTCGTTTCTATTAAAGACCTTGGCTACCCA A_73_101771 A_73_101771 FALSE XM_583352 XM_583352 LOC404066 ref|XM_583352 unmapped Bos taurus similar to Homo sapiens transmembrane protein 43 (TMEM43) CCTTGACATCTGTGTGACTTTTTTCTAGTACAGATTTTAAGTTACTGCCAATTTCAAGTG A_73_101772 A_73_101772 FALSE AW479048 AW479048 gb|Unidentified transcripts on BTA2 position 83824827-83825394 unmapped Unknown AAGGGGATCCCCCGGTCCCAATTTTAAATTGGGGGACCCTTTTTTCCCCCTTTTCGGGGG A_73_101773 A_73_101773 FALSE EE910615 EE910615 gb|Bos taurus similar to Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type II, beta (PIP5K2B), transcript variant 1 unmapped Unknown CTCCATCCATTTGCTTCCTTCAGATCTTCTCCCAGGCATTCTCATTTGTAGGTGAGCTTT A_73_101774 A_73_101774 FALSE NM_001013582 NM_001013582 AK1 ref|NM_001013582 unmapped Bos taurus adenylate kinase 1, soluble (AK1) AGAGGAAGCCACTTTATCCTGTTTTCATGGACAGCCAAGCACTAAAGGAGTTTCCAAGGA A_73_101775 A_73_101775 FALSE XM_870204 XM_870204 LOC530870 ref|XM_870204 unmapped Bos taurus similar to PREDICTED: Homo sapiens F-box protein 46, transcript variant 1 (FBXO46) ATGACCCTTGCAAGCAGTGCCGCAAGAGATACGAGAAGGGCGACGTGTCGCTCTGCCGCT A_73_101776 A_73_101776 FALSE XM_609637 XM_609637 LOC531151 ref|XM_609637 unmapped PREDICTED: Bos taurus similar to glucosaminyl (N-acetyl) transferase 2 isoform C (LOC531151) GGGGAGGAGACAGAGCAAAGCAAATCGCTAAGAGTTCCTTCAGAAACTGAAGAAACTGTT A_73_101777 A_73_101777 FALSE XM_605694 XM_605694 LOC527304 ref|XM_605694 unmapped Bos taurus similar to Homo sapiens histone 1, H1b (HIST1H1B) AAAGCGGCGAAACCCAAAACCTCCAAGCCTAAGGCAGCAAAACCCAAAGCTGCAAAGGCG A_73_101778 A_73_101778 FALSE XM_591864 XM_591864 LOC514071 ref|XM_591864 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 4, subfamily D, member 10 (OR4D10) AGGAGATGAAGGCAGCCATGAAAAGACTAAGGAGAAGATTCATGCTGTTTGAAAAGGGAT A_73_101779 A_73_101779 FALSE XM_585883 XM_585883 LOC509009 ref|XM_585883 unmapped Bos taurus similar to Homo sapiens solute carrier family 35, member E3 (SLC35E3) AGTCACCTGAAGACAACAGAAAAAGTATTAGGTGGGCAAGTTACTTTCAAAGAAGAAATG A_73_101780 A_73_101780 FALSE CB439046 CB439046 gb|Bos taurus similar to Homo sapiens solute carrier family 15, member 4 (SLC15A4) unmapped Unknown CTGGCTCTGGGCGGTGGGGGTTTCTCGTTTTGTCTAATAAACTATTCCTTATTTGTTGCT A_73_101781 A_73_101781 FALSE AW326581 AW326581 gb|Unidentified transcripts unmapped Unknown TGCGATACCTAATTAGAGTGTAAAAAGTCCCTAACTAGCCCTCTTTCAAATTCAGTGATT A_73_101782 A_73_101782 FALSE XM_592676 XM_592676 LOC514771 ref|XM_592676 unmapped Bos taurus similar to Homo sapiens G patch domain containing 3 (GPATC3) AGCGAACAACCCGCCGCAGATGTGCCGGGTCTGCGACCTAACGGGAGAATAAAAAGGTTA A_73_101783 A_73_101783 FALSE XM_866538 XM_866538 LOC530029 ref|XM_866538 unmapped PREDICTED: Bos taurus similar to Neurabin-2 (Neurabin-II) (Neural tissue-specific F-actin binding protein II) (Protein phosphatase 1 regulatory subunit 9B) (Spinophilin) (p130) (PP1bp134) (LOC530029) CCCATGTTCCCAGGTGGCAACATGACCATTAAGATCCAGCAGCTGAAAAGAAAACTGCAG A_73_101784 A_73_101784 FALSE BE667837 BE667837 gb|Bos taurus similar to Homo sapiens nucleoporin like 1 (NUPL1), transcript variant 1 unmapped Unknown CCCGTGTTCACTGTGTCCCTACTCTGTCCAGAGCCTGTCATGATGTAAACAATAAACTTT A_73_101785 A_73_101785 FALSE AV600296 AV600296 gb|Unidentified transcripts on BTA11 position 83921781-83920582 unmapped Unknown GAGAGATACCCCAGGTACACACAACCTTTTCACATTCTTACAGGTTCTCTCTAGTAGTCC A_73_101786 A_73_101786 FALSE XM_614000 XM_614000 LOC540986 ref|XM_614000 unmapped Bos taurus similar to Homo sapiens eukaryotic translation elongation factor 1 gamma (EEF1G) ACCATCTTCTAGCCTAGCTGGGAAAGATTGGATGTAGTTAGGAGGTGGTGACACGGGGCT A_73_101787 A_73_101787 FALSE XM_612765 XM_612765 LOC540714 ref|XM_612765 unmapped Bos taurus similar to Homo sapiens diencephalon/mesencephalon homeobox 1 (DMBX1), transcript variant 1 CCCCGCAGGCCTGGCGCCTGCCTCAGCTGCCCTGAACAGTAAAACCACAAGCATTGAGAA A_73_101788 A_73_101788 FALSE XM_867256 XM_867256 LOC615450 ref|XM_867256 unmapped PREDICTED: Bos taurus similar to golgi autoantigen, golgin subfamily a-like (LOC615450) CATGGGCATTGCCCAGTATGGGATCTTAGAGCTTGCCTGGAAGAGCCTGCCAGAAGCTGA A_73_101789 A_73_101789 FALSE XM_612423 XM_612423 LOC533120 ref|XM_612423 unmapped Bos taurus similar to Homo sapiens astrotactin 2 (ASTN2), transcript variant 1 TCTTCCTGCTCCCCGTGGGTCTGCCCAGAGTCCCTGCAGGACTTCCCATGCATTAAAAAT A_73_101790 A_73_101790 FALSE XM_585577 XM_585577 LOC508750 ref|XM_585577 unmapped Bos taurus similar to Homo sapiens T-box 4 (TBX4) CTTCTCCTTGTCCCGGGAAGCCTCCTTACAATACCATTCAGGCATGGGGACCGTGGAGAA A_73_101791 A_73_101791 FALSE XM_602276 XM_602276 LOC523963 ref|XM_602276 unmapped Bos taurus similar to Homo sapiens interferon regulatory factor 2 binding protein 1 (IRF2BP1) CCCCCCATCTTACCCCCTTTTCCTCCTTCAATAAACCAAAAAATGGGTTTTTTCAAAAAA A_73_101792 A_73_101792 FALSE NM_001034413 NM_001034413 ASB11 ref|NM_001034413 unmapped Bos taurus similar to Homo sapiens ankyrin repeat and SOCS box-containing 11 (ASB11), transcript variant 1 GATTATGATGAATATAAGTCTTCCAAGATGGATTCTTGATTCTGTTATTCCCTTCTTCCC A_73_101793 A_73_101793 FALSE NM_174678 NM_174678 PROP1 ref|NM_174678 unmapped Bos taurus prophet of Pit1, paired-like homeodomain transcription factor (PROP1) CACTTCCAACAGGCCGTGCACGTCTGATAACATAAGAATAGCTCTCCAATGTGTTATAAC A_73_101794 A_73_101794 FALSE XM_869960 XM_869960 LOC617661 ref|XM_869960 unmapped Bos taurus similar to Homo sapiens suppressor of Ty 3 homolog (S. cerevisiae) (SUPT3H), transcript variant 1 CAAAATAAAATACAAGTTTACCCTCTCCGCAGCCTGGGAGATGGGTTGGTTTGGTGTACA A_73_101795 A_73_101795 FALSE XM_866530 XM_866530 LOC614888 ref|XM_866530 unmapped PREDICTED: Bos taurus similar to transient receptor protein 6 (LOC614888), partial mRNA. AGCTTACCTGTCATTGTCTAGCGAAGACCCAGTCATGACAGCTTTAGAGCTTAGCAATGA A_73_101796 A_73_101796 FALSE XM_581144 XM_581144 LOC504948 ref|XM_581144 unmapped Bos taurus similar to Homo sapiens glycerol-3-phosphate dehydrogenase 2 (mitochondrial) (GPD2) CTCATTTTCAGTGCACACTGATTTAATGTTTTGCTTTCATTTTGTGATCTGTTAGACTGG A_73_101797 A_73_101797 FALSE BP108685 BP108685 gb|Unidentified transcripts on BTA22 position 26723374-26722865 unmapped Unknown TGTCATCTCAACTGCAGCAAATATTCCATACCAGAGCACTGAGCTAAGAGGACAGTCACA A_73_101798 A_73_101798 FALSE XM_607726 XM_607726 LOC529282 ref|XM_607726 unmapped Bos taurus similar to Homo sapiens coenzyme Q9 homolog (S. cerevisiae) (COQ9) CAGGGTTATTAGTGAACTTAGAGTCTGTAAAATATTATAATAAATATCTTTGAAGCAGTC A_73_101799 A_73_101799 FALSE NM_174453 NM_174453 RPE65 ref|NM_174453 unmapped Bos taurus retinal pigment epithelium-specific protein (65kD) (RPE65) TAGATAAACATCAATCTGCTGGATTTTGTCTCTAGATGTGGCACGTGAACTTAATTCCAC A_73_101800 A_73_101800 FALSE XM_601774 XM_601774 LOC523474 ref|XM_601774 unmapped Bos taurus similar to Homo sapiens nucleolar protein 9 (NOL9) GACCACTGTTAGGATGAGGGTTTTTACGGCTTACGTCCATTTGAGGCGTTGATCATCATT A_73_101801 A_73_101801 FALSE XM_600004 XM_600004 LOC521737 ref|XM_600004 unmapped PREDICTED: Bos taurus similar to ring finger protein 30 (predicted) (LOC521737) ACCCATCTTATGCTTACTCAGTACAAGGAAGTGAGATTGGTTCTAGAGAATCAACCGTGT A_73_101802 A_73_101802 FALSE NM_001038671 NM_001038671 MGC133923 ref|NM_001038671 unmapped Bos taurus similar to Homo sapiens KIAA1333 (KIAA1333) GAGACTGTTTGCAGGTAAGATAGTTTGTAAACATTTTCTGATATAAAGTCTGTTGCTTGC A_73_101803 A_73_101803 FALSE XM_868878 XM_868878 LOC616769 ref|XM_868878 unmapped PREDICTED: Bos taurus similar to DNA mismatch repair protein Msh3 (Divergent upstream protein) (DUP) (Mismatch repair protein 1) (MRP1) (LOC616769), partial mRNA. ACATTATCACACCTTGTGTAAAGCAGTCCATCACCTAGCAACGATTGACTGCATTTTGTC A_73_101804 A_73_101804 FALSE XM_584684 XM_584684 LOC539080 ref|XM_584684 unmapped Bos taurus similar to Homo sapiens immunity- related GTPase family, cinema (IRGC) CCGCCGGAAGCTTGGCCTCCTCCTTAAGTACATTCTGGACAGCTGGAAGAAGCGAGACTT A_73_101805 A_73_101805 FALSE XM_606672 XM_606672 LOC528258 ref|XM_606672 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 44 (C20orf44), transcript variant 3 TGAATCAGGCTGGGTAACCACACACTGTCCTCCAGCTTTGAGCCATGGGCTTGAGTTGGC A_73_101806 A_73_101806 FALSE XM_587754 XM_587754 LOC539504 ref|XM_587754 unmapped Bos taurus similar to Homo sapiens leukemia inhibitory factor receptor alpha (LIFR) GGAAATAGGATCCTCCTCACTTGGAATTACGACCCCAACATGACCTGCGACTATGTAATT A_73_101807 A_73_101807 FALSE XM_611451 XM_611451 LOC539920 ref|XM_611451 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 21 (C6orf21) TGTATATGAGTGTATGTGTGTGTGTTAAGGGGCTGGGGGCTGAAGGAAAGAAGAAGCATT A_73_101808 A_73_101808 FALSE XM_585467 XM_585467 LOC539182 ref|XM_585467 unmapped Bos taurus similar to Homo sapiens scavenger receptor cysteine rich domain containing, group B (4 domains) (SRCRB4D) ACGACAGAGCCTCCATTTTGCAGATGCAAAGAACCCTGGGGGCCTGTAGCCACCCATTCA A_73_101809 A_73_101809 FALSE XM_595044 XM_595044 LOC516886 ref|XM_595044 unmapped PREDICTED: Bos taurus similar to tripartite motif-containing 62 (LOC516886) AAGTTTCCGGGCAAGCTCTGCTCCTACTTCAGCCCCGGGCAGAGCCACGCCAATGGCAAA A_73_101810 A_73_101810 FALSE EE899769 EE899769 gb|Unidentified transcripts on BTA4 position 45729919-45730733 unmapped Unknown TGTGCCTGAAAGAAGTATTTGAGTAGGGACCACATTTGTCATTCAAATTGGTTTACCAGT A_73_101811 A_73_101811 FALSE CB445920 CB445920 gb|Unidentified transcripts unmapped Unknown GTTTAACTGCCCAACAGCCCTCAGTCAGTCCTGTTATTCTCCAGTGAGCTCCTCACCTGT A_73_101812 A_73_101812 FALSE NM_001015629 NM_001015629 LOC522909 ref|NM_001015629 unmapped Bos taurus similar to RIKEN cDNA D330012F22 gene (LOC522909) ATAAGGGGAGGGATAAAGAACCGGTAAGTGTCTCTTTAAAGAGGGTGATTGTTGGAATAA A_73_101813 A_73_101813 FALSE BE723852 BE723852 gb|Bos taurus similar to Homo sapiens zinc finger protein 585A (ZNF585A), transcript variant 2 unmapped Unknown GCCTTATGAATGTAGTGATTGTGGAAAAGCCTTCACTCAGAAGTCTGCACTCACAGTGCA A_73_101814 A_73_101814 FALSE NM_001035402 NM_001035402 MGC127743 ref|NM_001035402 unmapped Bos taurus similar to Homo sapiens 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 1 GACAGCCATAGCTGTTCATGTTCTCTTTTGTTTTTAAACATTAATCTTGGGCTCCTTAAA A_73_101815 A_73_101815 FALSE L41691 L41691 gb|Bos taurus (clones L6, C15, C12, C8, C9, C17, C19, C12, C18, C5, C6, C3, C13, C10, C47) mRNA, 3' end of cds unmapped Unknown ACAGGTCTATACCATGTTCTTTGGTTAAAGATTTGCTTTATACTAGATTGTTGCAGTACC A_73_101816 A_73_101816 FALSE NM_001035103 NM_001035103 ALAS2 ref|NM_001035103 unmapped Bos taurus similar to Homo sapiens aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia) (ALAS2), nuclear gene encoding mitochondrial protein, transcript variant 1 GGGAACGTTCCTACTTTGGGAACATGGGGCCCCAGTATGTCACCACTTATGCCTAAGAAA A_73_101817 A_73_101817 FALSE NW_930646 NW_930646 gb|Putative orthologue of human miRNA hsa-mir-340 on chr 5, (-) strand. Mature length 23 nt, stem-loop length 95 nt. Source: NW_930646.1:126062-126156 unmapped Unknown TCCGTCTCAGTTACTTTATAGCCTATCCTACTATACGTATCACAT A_73_101818 A_73_101818 FALSE XM_589345 XM_589345 LOC511917 ref|XM_589345 unmapped Bos taurus similar to Homo sapiens fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus) (FSCN3) GCACCCAATGGCTTCTACATGCGATCCGACAGAAGTGGTACCCTGTTGGCAGACAGCGAA A_73_101819 A_73_101819 FALSE XM_587376 XM_587376 LOC510252 ref|XM_587376 unmapped Bos taurus similar to Homo sapiens lactamase, beta (LACTB), nuclear gene encoding mitochondrial protein, transcript variant 1 ACATACCTTAACATCACAGGTGCAAAACAAGCTGTTATGGTTTTGTTTTTGTTTGTTGGT A_73_101820 A_73_101820 FALSE BM430429 BM430429 gb|Bos taurus similar to Homo sapiens zinc finger, CCHC domain containing 2 (ZCCHC2) unmapped Unknown TGCAATCGAGCTATGGAAGTGAGAGTTTTGATAAGCCCTGTATGGACCGCATTGTGAATC A_73_101821 A_73_101821 FALSE XM_583948 XM_583948 LOC507353 ref|XM_583948 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 129 (C6orf129) CTTGGGGCTCCAGAAGGACTTCGTGCTGGCTTAGCCCAGGGGAAAGGCAATAAAGAACCT A_73_101822 A_73_101822 FALSE XM_582851 XM_582851 LOC506408 ref|XM_582851 unmapped Bos taurus similar to Homo sapiens hypothetical protein DKFZp762I137 (DKFZp762I137) GGGGCTTCAATCCAGTGAATTCTGTTGCAGGTCTGAAATGATACTGAGTTTGGTTTGATT A_73_101823 A_73_101823 FALSE BM106218 BM106218 gb|Bos taurus similar to Homo sapiens FBJ murine osteosarcoma viral oncogene homolog B (FOSB) unmapped Unknown ACTGGGCCGCTACCCCCCTCCTCGTGGTTCTGCACTGTCGCCAATAAAAAACTCTTAAAA A_73_101824 A_73_101824 FALSE XM_598557 XM_598557 LOC520318 ref|XM_598557 unmapped Bos taurus similar to Homo sapiens phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) (PFAS) CCTCCCCCTGGCTCCAGCTCTTCATCAATGCCCGGAATTGGACCCAGGAATGCAGCTGCT A_73_101825 A_73_101825 FALSE NM_001034805 NM_001034805 MRPL13 ref|NM_001034805 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L13 (MRPL13), nuclear gene encoding mitochondrial protein TGAAAGTTTGTGGGGAAAGGTCGGGAAGGGGTATCCCTTCATTAGGAAATTGCAGTAAGA A_73_101826 A_73_101826 FALSE NM_001024509 NM_001024509 PSME1 ref|NM_001024509 unmapped Bos taurus proteasome activator 28 alpha subunit (PSME1) ATGGAGATCCGCAATGCTTACGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAG A_73_101827 A_73_101827 FALSE XM_614929 XM_614929 UGT8 ref|XM_614929 unmapped PREDICTED: Bos taurus UDP glycosyltransferase 8 (UDP-galactose ceramide galactosyltransferase) (UGT8), partial mRNA. CAACAGCCCACCTGGTAGTAACAAATCTATTCAGTCATTGAATTTTTATTGCTACAAGTT A_73_101828 A_73_101828 FALSE XM_584520 XM_584520 LOC539055 ref|XM_584520 unmapped Bos taurus similar to Homo sapiens tetraspanin 14 (TSPAN14) GAAGAAGAATGCTTGTGTTTTTAGGAAGTGTGATGCTTTTCTTTGACTGCCAAACTCTTT A_73_101829 A_73_101829 FALSE XM_869050 XM_869050 LOC616912 ref|XM_869050 unmapped PREDICTED: Bos taurus similar to transmembrane protein 28 (LOC616912) CAATGATGAACCAGAATGCTGTGACGTCAGGAGAGAAGCAAAACCCAAGAGCCCCTCCAA A_73_101830 A_73_101830 FALSE XM_591395 XM_591395 LOC513669 ref|XM_591395 unmapped PREDICTED: Bos taurus similar to pre T-cell antigen receptor alpha (LOC513669) ATTCGCCGCAATCATGGGGGCACCACAGGCCGAGATTGGAAGCCCCTTGAGGGTGGTGAT A_73_101831 A_73_101831 FALSE CB454174 CB454174 gb|Unidentified transcripts on BTA4 position 54423050-54423759 unmapped Unknown ATTTTCTCTTCCAGGGTTAAGCTCACAACGTCAGTGGATTTGTTTTCCCCCCAGAACCAT A_73_101832 A_73_101832 FALSE BM090260 BM090260 gb|Bos taurus similar to Homo sapiens G protein-coupled receptor 161 (GPR161), transcript variant 1 unmapped Unknown GATCATCGCTGTCGACCGGTACTACGCTGTCCTGTATCCCATGGCGTACCCGATGAAGAT A_73_101833 A_73_101833 FALSE EE897917 EE897917 gb|Unidentified transcripts on BTA16 position 43363663-43362713 unmapped Unknown TCCAGAAAGAAATGAGAGGAGATTATGCAGGAAGAGAATTGAGTCTGTCAGAAGCTTCAA A_73_101834 A_73_101834 FALSE XM_583694 XM_583694 LOC507136 ref|XM_583694 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 120B (FAM120B) CTAGACTGTGAGGATATTTCCCAGATGATCTAATCTTTTAAGACATGATGTCTAATAAGC A_73_101835 A_73_101835 FALSE XM_868706 XM_868706 LOC616635 ref|XM_868706 unmapped Bos taurus similar to Homo sapiens CDC42 small effector 2 (CDC42SE2), transcript variant 1 GCAGTTCTATTATAGAAAGCAAGTTTGCCTTGATTTTGTTTAAAATGACTTCTGCTCAGC A_73_101836 A_73_101836 FALSE XM_865129 XM_865129 LOC510921 ref|XM_865129 unmapped Bos taurus similar to Homo sapiens general transcription factor IIE, polypeptide 2, beta 34kDa (GTF2E2) GGTTCCATTTTCCCCTTTTATTACTTTAGAACAAGTTTGCTGGTAGTCTTGAATGCAATA A_73_101837 A_73_101837 FALSE XM_870646 XM_870646 LOC618315 ref|XM_870646 unmapped Bos taurus similar to Homo sapiens DiGeorge syndrome critical region gene 6-like (DGCR6L) GCTCCCAAACTGCGTGTGACCCCGAGAAATAAAGCTGCCTCAGCGTCGCCTGCAGAAAAA A_73_101838 A_73_101838 FALSE XM_605986 XM_605986 LOC527592 ref|XM_605986 unmapped Bos taurus similar to Homo sapiens dehydrogenase/reductase (SDR family) member 8 (DHRS8) GCATCATTGGGATTTGAGACAAAGAACTGGGAAAATGTACCCATAAGTGGCAGCAATAAT A_73_101839 A_73_101839 FALSE EE913316 EE913316 gb|Unidentified transcripts on BTA18 position 53597345-53596946 unmapped Unknown TATTTGTCTACGAGTTGTTAAGTGTATACCCCTGAACATCATCTCTCCCATCCCCTGACC A_73_101840 A_73_101840 FALSE XM_870919 XM_870919 LOC618588 ref|XM_870919 unmapped Bos taurus similar to Homo sapiens RAB23, member RAS oncogene family (RAB23), transcript variant 1 GTAGTAACAAAATTGGGGTCTTTAGCACGTCTGCTGGGAGTCACTTGGGTCAGAATTCAA A_73_101841 A_73_101841 FALSE XM_588781 XM_588781 LOC511447 ref|XM_588781 unmapped Bos taurus similar to Homo sapiens WD repeat domain 54 (WDR54) CTGAGATTCAGCAGCATATGAGAGAAGAGCAGCCCTCTGTTGCCCTGTGGTATTTATAAA A_73_101842 A_73_101842 FALSE NM_001034777 NM_001034777 C6orf134 ref|NM_001034777 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 134 (C6orf134), transcript variant 2 CTTTTCTGACTCACTCCTCCTTTTTCTTCTCCCTCTCAGTGTTGTCTGAATAAAGCGTGA A_73_101843 A_73_101843 FALSE NM_174390 NM_174390 MMP14 ref|NM_174390 unmapped Bos taurus matrix metalloproteinase 14 preproprotein (MMP14) ACATACCTTTAACCTCTGAACTCTGACCTCAGGAGGCTCTGGGCACTTCAGCCCCGCAAA A_73_101844 A_73_101844 FALSE XM_593382 XM_593382 LOC515372 ref|XM_593382 unmapped Bos taurus similar to Homo sapiens transmembrane protein 139 (TMEM139) TAATTTGCACAGGAGCACTCTGCTAGTAAATGACACAAAGTCTTGAACTTTGCTCTTCAG A_73_101845 A_73_101845 FALSE BE753913 BE753913 gb|Bos taurus similar to Homo sapiens yippee-like 2 (Drosophila) (YPEL2) unmapped Unknown AATTCTCTAGTTTCCTCTGCATTTCTTGAAGTATATTTTAAGGGAAACAGTGATCACCAG A_73_101846 A_73_101846 FALSE XM_868174 XM_868174 LOC530908 ref|XM_868174 unmapped Bos taurus similar to Homo sapiens cellular repressor of E1A-stimulated genes 1 (CREG1) TCGTGGTCCACTTACGTTTGACAGTCCTGGGTGTTGTTAATCCAACACAAGGCAAAACTA A_73_101847 A_73_101847 FALSE EE914522 EE914522 gb|Unidentified transcripts unmapped Unknown AATTACTGCCTCCTACTAATAGTTGAAACTATTCACAATTGAGATGATCTGAAACCAACC A_73_101848 A_73_101848 FALSE XM_591400 XM_591400 LOC513673 ref|XM_591400 unmapped Bos taurus similar to Homo sapiens p21 (CDKN1A)-activated kinase 2 (PAK2) ATCCAGAGAAGCTTTCCCCAATATTTCGGGATTTCTTAAATCGATGTTTGGAGATGGATG A_73_101849 A_73_101849 FALSE NM_001024568 NM_001024568 RPS11 ref|NM_001024568 unmapped Bos taurus ribosomal protein S11 (RPS11) AGTTCCAGAAGTTCTGAGACTGGACCTCTGCCTGCTGCCCCAAACACAATAAAGTTATTT A_73_101850 A_73_101850 FALSE BE754696 BE754696 gb|Unidentified transcripts on BTA29 position 18535657-18536316 unmapped Unknown TTATGTAAGTCTCAAGGAATTTGGAGTAGTGGGTTCAGACACTGGTGGGTACACATGGGA A_73_101851 A_73_101851 FALSE NM_174153 NM_174153 PPID ref|NM_174153 unmapped Bos taurus peptidylprolyl isomerase D (cyclophilin D) (PPID) ATTCAGTTTTGCTTAAGTGTGTGTTTATTGTATGAGCGAGGAGCAGTTTAATGGTTTGTC A_73_101852 A_73_101852 FALSE XM_592474 XM_592474 LOC514601 ref|XM_592474 unmapped PREDICTED: Bos taurus similar to early estrogen-induced gene 1 protein (LOC514601) AGTCAAGACTTCAGCCTAGATTCCAGTGCAGAAGAAGAAGGACTGAGGTTATTTGTGGGT A_73_101853 A_73_101853 FALSE XM_604713 XM_604713 LOC526344 ref|XM_604713 unmapped PREDICTED: Bos taurus similar to potassium voltage-gated channel, subfamily H, member 8 (LOC526344) TACGTCATTGGAAAAATGGAGAGGGAAGACAACAGCCTTCTGAAGTGGGAAGTGGACATT A_73_101854 A_73_101854 FALSE CB420655 CB420655 gb|Unidentified transcripts unmapped Unknown TTGCAACTGGATATGTCTATCTAATTAAACACTATTTCATTCCGGATATGACTTCCATGC A_73_101855 A_73_101855 FALSE CB433840 CB433840 gb|Unidentified transcripts unmapped Unknown CCTATTAGGCTCTTGGCCTGCAGAAAAGTTAATGCTGTCTTTTTATCCTTTTATATTCTG A_73_101856 A_73_101856 FALSE XM_593029 XM_593029 LOC540297 ref|XM_593029 unmapped Bos taurus similar to Homo sapiens kallikrein 13 (KLK13) ATCCAAGAAACAATCCAAAAGCGGAAAACTTGTAAACAGGAATGGACGAAGGGCCCACAA A_73_101857 A_73_101857 FALSE XM_588358 XM_588358 LOC539613 ref|XM_588358 unmapped Bos taurus similar to Homo sapiens TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) (TRMT1) CCGCTGAGCCTGGGGCTGCTACTGGTCCAGGCACAGAGTGAGCTAATAAAGACCTTTTCA A_73_101858 A_73_101858 FALSE XM_612540 XM_612540 LOC533212 ref|XM_612540 unmapped PREDICTED: Bos taurus similar to obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (LOC533212) ACACCAGACGACAAGACACAGGCCAAGCTGACTGTGGAAAGTGAGCAGCTAGGCGAGCTT A_73_101859 A_73_101859 FALSE XM_612421 XM_612421 STAT6 ref|XM_612421 unmapped Bos taurus similar to Homo sapiens signal transducer and activator of transcription 6, interleukin-4 induced (STAT6) AGTCCAACTGCTCATGTCACTGGTTCAAACTAGAGAGAATGGGAGTGTGCTGTGTAGGGG A_73_101860 A_73_101860 FALSE XM_617938 XM_617938 LOC537755 ref|XM_617938 unmapped Bos taurus similar to Homo sapiens desmoglein 4 (DSG4) ATTGGTTCCACATCCCCAGTGACATCTCGACACAGAGTAACACGGTACAGTAACATACAT A_73_101861 A_73_101861 FALSE AV612884 AV612884 gb|Bos taurus similar to Homo sapiens hypothetical protein LOC286334 (LOC286334) unmapped Unknown AATACCATGGGCACATCTGACTGTGTCTCTCTCTTCGAGTGCAAGAAACTCAAGTCATCT A_73_101862 A_73_101862 FALSE BI535188 BI535188 gb|Bos taurus similar to Homo sapiens FUS interacting protein (serine/arginine-rich) 1 (FUSIP1), transcript variant 2 unmapped Unknown TCAATGTTTGGATCAAAACAAGACCCAGCTTATTTTCTGCTTGCTGTAAATTAAGCAAAC A_73_101863 A_73_101863 FALSE XM_865920 XM_865920 SIAT8A ref|XM_865920 unmapped Bos taurus similar to Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 (ST8SIA1) GAAGCTGAGGAATTAAGGTAGATTAAGTGAAATGCCAGAGTAGAAGTGTTACTGGTTATC A_73_101864 A_73_101864 FALSE XM_611194 XM_611194 LOC506990 ref|XM_611194 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 149 (C20orf149) TCACACCCCATGACCCTGTGCCTTGCACCAATGCACCAAGTGGACAATAAACTCCAGGAG A_73_101865 A_73_101865 FALSE XM_610278 XM_610278 LOC531776 ref|XM_610278 unmapped Bos taurus similar to Homo sapiens LBXCOR1 homolog (mouse) (LBXCOR1) ACTTGTGTGTGGCCCCTTCCTCTCTGGTACTTTGCCTGCTGTATGAATGAAGATTGTATT A_73_101866 A_73_101866 FALSE NM_001034610 NM_001034610 RIPK2 ref|NM_001034610 unmapped Bos taurus similar to Homo sapiens receptor- interacting serine-threonine kinase 2 (RIPK2) AAGCAAATGGGTCTTCAGCCTTACCCAGAAATACTTGTGCTTTCTCAATCACCATCTTTA A_73_101867 A_73_101867 FALSE XM_607061 XM_607061 LOC528634 ref|XM_607061 unmapped Bos taurus similar to Homo sapiens similar to hemicentin (LOC392395) AGGCTCAAGACGCGCCCCCCAGCATCCTCGGAGAAGAGCAGAACGTGTCTGTTGTGGCTA A_73_101868 A_73_101868 FALSE XM_613407 XM_613407 LOC540846 ref|XM_613407 unmapped Bos taurus similar to Homo sapiens ets variant gene 1 (ETV1) TAAATGTTAAATCTGGGATCGCAATGAAGCAAAAAATATCTGTCTCCATTCACTTCCTTC A_73_101869 A_73_101869 FALSE XM_614882 XM_614882 LOC534937 ref|XM_614882 unmapped Bos taurus similar to Homo sapiens uridine phosphorylase 2 (UPP2) AAAGCCTCAGTGTAATGTATGTCTCTATGAAAAAGCTACTCATAGGGAAATAGGACCATA A_73_101870 A_73_101870 FALSE XM_610637 XM_610637 LOC532127 ref|XM_610637 unmapped Bos taurus similar to Homo sapiens integrin, alpha 9 (ITGA9) ATGCTGCTGAACACAGAAATACTGAAGAAGGACAGTTCATCTGTCATCCAGTTCATGACC A_73_101871 A_73_101871 FALSE NM_001035440 NM_001035440 SH3BGRL ref|NM_001035440 unmapped Bos taurus similar to Homo sapiens SH3 domain binding glutamic acid-rich protein like (SH3BGRL) ATCATTTGATGTATGCAAGTCTGTGCTCTTTGCCAAAATCAACATATAATGAAGACATGG A_73_101872 A_73_101872 FALSE NM_001037455 NM_001037455 MGC128522 ref|NM_001037455 unmapped Bos taurus similar to Homo sapiens transmembrane protein 153 (TMEM153) TGAGGCTGACCTGCTGGGGAGAGGAGGGAAGACGCCCCAAGGTCTCCTCTACAGCAGCCT A_73_101873 A_73_101873 FALSE NM_001034226 NM_001034226 LOC504867 ref|NM_001034226 unmapped Bos taurus similar to Homo sapiens chromosome 11 open reading frame 73 (C11orf73) TTGTCATGTTTTGAAGATAATGACTGTGTGAAAGCATGAAGTCAAAAGGATCAATGAAGC A_73_101874 A_73_101874 FALSE XM_868606 XM_868606 LOC535113 ref|XM_868606 unmapped Bos taurus similar to Homo sapiens small nuclear ribonucleoprotein 70kDa polypeptide (RNP antigen) (SNRP70), transcript variant 1 CCCCACCTTCCTGGTCACCACCTAAATCTGCCAGCCAAGGGTAGGAGTCTCCTTATTTGT A_73_101875 A_73_101875 FALSE XM_865755 XM_865755 LOC614306 ref|XM_865755 unmapped Bos taurus similar to Homo sapiens dual specificity phosphatase 9 (DUSP9) GTGATTCAGCCAACGTGGAGAGCTTGGCCAAGCTGGGCATCCGCTACATCCTCAATGTCA A_73_101876 A_73_101876 FALSE CB422351 CB422351 gb|Bos taurus similar to Homo sapiens transmembrane protein 71 (TMEM71) unmapped Unknown TCTATACCAAAGCACAAGCCAGCCAAATCTCATGTTCCATGAAGACATGCTGAATCTGCC A_73_101877 A_73_101877 FALSE XM_866450 XM_866450 LOC614814 ref|XM_866450 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 1, subfamily L, member 6 (OR1L6) GCCTGAGGAACAAAGATATGAAGAGGGGTCTGAGGAAATTAAAGGACCAAGTTTACTCAT A_73_101878 A_73_101878 FALSE XM_865502 XM_865502 LOC520325 ref|XM_865502 unmapped PREDICTED: Bos taurus similar to Calreticulin precursor (CRP55) (Calregulin) (HACBP) (ERp60) (grp60) (LOC520325) GAAATAGACAATCCTGAATATAAGCCTGACCCCAGCATTTGCCACTATTACAACATCAGT A_73_101879 A_73_101879 FALSE XM_595717 XM_595717 LOC517545 ref|XM_595717 unmapped PREDICTED: Bos taurus similar to regulator of G-protein signaling 6 (LOC517545) TGACAGACATTGTTTAAAAATGTCCAAAGTGGCTGAAAGGGGGAAAGAATTATGTGTGCC A_73_101880 A_73_101880 FALSE CB437973 CB437973 gb|Unidentified transcripts unmapped Unknown CACTATTGGCATAAATATTTAATTTTTACCTGTTTTTATTATCCTGTCATTTTATTCCAA A_73_101881 A_73_101881 FALSE XM_583189 XM_583189 LOC506708 ref|XM_583189 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ10324 (FLJ10324) ACAGAGCTTTTATGTTTGAAGGTTTTAATGGAAAAACATAGATTCAATAAACTATCTTTC A_73_101882 A_73_101882 FALSE XM_583591 XM_583591 LOC538910 ref|XM_583591 unmapped Bos taurus similar to Homo sapiens protocadherin gamma subfamily A, 4 (PCDHGA4), transcript variant 2 ATATCTCAAGATTTACTGGAAACAAAAGGAGAATCCAGTCTTAATCAGGTGAGTCAAATC A_73_101883 A_73_101883 FALSE XM_882368 XM_882368 LOC512094 ref|XM_882368 unmapped Bos taurus similar to Homo sapiens alkB, alkylation repair homolog 4 (E. coli) (ALKBH4) GTCACAGTTGAGGGCAGTGGCCTAATATGAGCTTAAAAATGGTTGGTACCCCTTCAGGCT A_73_101884 A_73_101884 FALSE XM_588365 XM_588365 LOC539614 ref|XM_588365 unmapped Bos taurus similar to Homo sapiens neuromedin U receptor 1 (NMUR1) TGGCCTTCCAGTACGTGCACGTCATCTCTGGAGTCTTCTTCTACCTCAGCTCGGCCGCCA A_73_101885 A_73_101885 FALSE NM_001034563 NM_001034563 DHX33 ref|NM_001034563 unmapped Bos taurus similar to Homo sapiens DEAH (Asp- Glu-Ala-His) box polypeptide 33 (DHX33) TCAGAGCACAGCTGAGGGACATCTGCATAAAGATGTCCATGCCAATTGTGTCCTCCCGGG A_73_101886 A_73_101886 FALSE XM_879250 XM_879250 LOC534309 ref|XM_879250 unmapped Bos taurus similar to Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TMEFF1) GTGAGTAGAATGTGTTCAGGTGTTTAACATGTAGTTTAGGTATTCAGAAGTATGCATGTA A_73_101887 A_73_101887 FALSE XM_597487 XM_597487 LOC519271 ref|XM_597487 unmapped PREDICTED: Bos taurus similar to RAB6-interacting protein 2 isoform gamma (LOC519271) TATACGTCTGCTCCAGAGGGTTGAAGCCGCGCTCTGTCTCCCAGCTGAATGCATCCTGTT A_73_101888 A_73_101888 FALSE XM_582663 XM_582663 TBXA2R ref|XM_582663 unmapped PREDICTED: Bos taurus thromboxane A2 receptor (TBXA2R) TGCAGCTCATGGGCATTATGGTGGTGGCCAGCATTTGCTGGATGCCACTGCTGGTCTTCA A_73_101889 A_73_101889 FALSE XM_873511 XM_873511 LOC514798 ref|XM_873511 unmapped Bos taurus similar to Homo sapiens RUN and FYVE domain containing 3 (RUFY3), transcript variant 2 ATATATTTGTGGTTAAGGAAAGGGACAAGGAAGATGTTCTAATTCCGTATCATAAGAAGG A_73_101890 A_73_101890 FALSE XM_868727 XM_868727 LOC616650 ref|XM_868727 unmapped PREDICTED: Bos taurus similar to HLA class I histocompatibility antigen, Cw-12 alpha chain precursor (MHC class I antigen Cw*12) (LOC616650) ATGAGGACCTGTGCTTTTGGACCACAGCACATGCAGAGGCTCAGATCCCCAAGCTCAAGC A_73_101891 A_73_101891 FALSE XM_589869 XM_589869 LOC512361 ref|XM_589869 unmapped Bos taurus similar to Homo sapiens lysosomal associated multispanning membrane protein 5 (LAPTM5) CACCAACACCCCTTGTGCTACTGCTTTGTGTGATGGGGAAGAAGTTTTAATAAAGCAGCA A_73_101892 A_73_101892 FALSE XM_863875 XM_863875 LOC613283 ref|XM_863875 unmapped Bos taurus similar to Homo sapiens protocadherin alpha 2 (PCDHA2), transcript variant 1 TTGTGGACATCAATGATAACTCACCAGAAGTCTCAATCACGTCTCTTTCACTACCCATTC A_73_101893 A_73_101893 FALSE XM_614220 XM_614220 LOC534450 ref|XM_614220 unmapped Bos taurus similar to Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5) AGGACAGGGAAAAACTTTGTACAATGGAGAAAATATTTATAAACCTAATTTTTTAAAAAA A_73_101894 A_73_101894 FALSE XM_865987 XM_865987 LOC614468 ref|XM_865987 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 7, subfamily A, member 5 (OR7A5) AAAGCTCTGAAAATATTTGGGAAGGAAACTAATAAAGAGTTAATTGTCCTGGGGCTGAAG A_73_101895 A_73_101895 FALSE NW_970805 NW_970805 gb|Bovine miRNA bta- miR-30e-5p on chr Un, (+) strand. Mature length 20 nt, stem-loop length 92 nt. Source: NW_970805.1:161154-161245 unmapped Unknown TGTAAACATCCTTGACTGGATATCCTACTATACGTATCACATAGC A_73_101896 A_73_101896 FALSE XM_607704 XM_607704 LOC529260 ref|XM_607704 unmapped PREDICTED: Bos taurus similar to N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4 (LOC529260), partial mRNA. CCCCATGGATCCAGAGTCTAGAACCTTCCTCTCTAATTACTACCGAGATCATAATGTGGA A_73_101897 A_73_101897 FALSE BG358804 BG358804 gb|Bos taurus similar to Homo sapiens cardiomyopathy associated 5 (CMYA5) unmapped Unknown CTGTAGAACACGAGTCTCTTTTCCCTGAAATTTTAAATGTAGAAAAACGCTAGATGTTAG A_73_101898 A_73_101898 FALSE XM_863916 XM_863916 LOC532835 ref|XM_863916 unmapped Bos taurus similar to Homo sapiens antizyme inhibitor 1 (AZIN1), transcript variant 1 CTGCTTTGGCTTCTGTTGCGAAAGAGTTGAAATTTTACTTATCAGCTTTGTGTACATTGA A_73_101899 A_73_101899 FALSE XM_866407 XM_866407 LOC520472 ref|XM_866407 unmapped Bos taurus similar to Homo sapiens pre-B-cell colony enhancing factor 1 (PBEF1), transcript variant 1 AACTGGAAGCAGCACCTCATTAGGCTTTGTTTTATGACTGGGTGTGTGTGTGTGTTATGT A_73_101900 A_73_101900 FALSE XM_608323 XM_608323 LOC529863 ref|XM_608323 unmapped PREDICTED: Bos taurus similar to Acrosomal protein SP-10 precursor (Acrosomal vesicle protein-1) (LOC529863) CATCCATGAACCTCTTCTCCCACGGAACCAGGATGCAAATTATATGCTGTCGAAATCAGT A_73_101901 A_73_101901 FALSE XM_589136 XM_589136 LOC511743 ref|XM_589136 unmapped PREDICTED: Bos taurus similar to UDP glucuronosyltransferase 2 family, polypeptide A3, transcript variant 1 (LOC511743) GGTTATTTTTTCTCAAGGGCAGAGAATGTCAGCAGTATGTTAAGGAAGAAGAGATAATTT A_73_101902 A_73_101902 FALSE XM_606902 XM_606902 LOC528479 ref|XM_606902 unmapped PREDICTED: Bos taurus similar to protease, serine, 21 (LOC528479) CACTACAAGTGGATCCGAGAGGTTCTGGCCCAAAACAACACTTGCAGGCTGGACTCCTGC A_73_101903 A_73_101903 FALSE XM_588263 XM_588263 LOC511017 ref|XM_588263 unmapped Bos taurus similar to Homo sapiens dihydrouridine synthase 4-like (S. cerevisiae) (DUS4L) GATCCTAGGTGTTTCAAACATTGACAGACCTTGCTCTGAATCCTATTATGAATTAAAATG A_73_101904 A_73_101904 FALSE XM_589415 XM_589415 LOC539780 ref|XM_589415 unmapped Bos taurus similar to Homo sapiens baculoviral IAP repeat-containing 1 (BIRC1) CCTCAGTCTAAACATTTCATCCTTTCCTGGAAATGGATACTGCCATTCTCTCCAATCATT A_73_101905 A_73_101905 FALSE XM_580685 XM_580685 LOC504544 ref|XM_580685 unmapped Bos taurus similar to Homo sapiens adaptor- related protein complex 4, epsilon 1 subunit (AP4E1) GTTAGGAGGGAAAAATGCAAGGGAATAACAGCTTACCAGGCATTAGTTGCCTTATTTTGG A_73_101906 A_73_101906 FALSE XM_878015 XM_878015 LOC506423 ref|XM_878015 unmapped Bos taurus similar to Homo sapiens solute carrier family 37 (glycerol-6-phosphate transporter), member 4 (SLC37A4) TTGCTAAATCTCATCTGTAACACAAACAGGATGAACATCCTGAGCTAAGGGAGAGGATGA A_73_101907 A_73_101907 FALSE NM_001014852 NM_001014852 PAK1IP1 ref|NM_001014852 unmapped Bos taurus PAK1 interacting protein 1 (PAK1IP1) TCATCAAAATGTGGAAGCTTAAGCAGGACAAGAAAGTTTCCCCGTCTCTATTGTGTGAAA A_73_101908 A_73_101908 FALSE BM366193 BM366193 gb|Unidentified transcripts on BTA12 position 10972030-10973215 unmapped Unknown GCTTTCAAAGGCTTAAGTAAGCACAGCTGAGGAGTTCCAAATAAGATTTGTGGATACGAA A_73_101909 A_73_101909 FALSE XM_611980 XM_611980 LOC540539 ref|XM_611980 unmapped Bos taurus similar to Homo sapiens HRAS-like suppressor (HRASLS) CATTATTGTTCCAAATTTCCAGTGATGGATGACAGACTCTTTAATAAATTGCTTACTGGC A_73_101910 A_73_101910 FALSE XM_593093 XM_593093 LOC515128 ref|XM_593093 unmapped Bos taurus similar to Homo sapiens major facilitator superfamily domain containing 4 (MFSD4) AGTTCATCTATAGTCTAAAACATCGAAAGGAAAGTTGAATCTTGCTACCTTTGGGACACT A_73_101911 A_73_101911 FALSE EE961308 EE961308 gb|Unidentified transcripts unmapped Unknown TGAATGTATAAGCACATTAGATCAGCATAAGGCAGTTATTAATACAGAAGATCAGAGGAC A_73_101912 A_73_101912 FALSE XM_597034 XM_597034 LOC518833 ref|XM_597034 unmapped PREDICTED: Bos taurus similar to CYFIP2, transcript variant 1 (LOC518833) CCTCTGCATGCTCTCCCGTGACATCTCCATGGTGGTGTTTCCATAGTGTAAATGAAAAAA A_73_101913 A_73_101913 FALSE NM_183081 NM_183081 TLR9 ref|NM_183081 unmapped Bos taurus toll-like receptor 9 (TLR9) CTGGGCATAGCCCTGACCAGGGACAACCGTCACTTCTATAACCGGAACTTCTGCCGGGGC A_73_101914 A_73_101914 FALSE NM_001034455 NM_001034455 MGC127483 ref|NM_001034455 unmapped Bos taurus similar to Homo sapiens vacuolar protein sorting 29 (yeast) (VPS29), transcript variant 2 GAGGAAGAACCTAGACTTTCTTGTATACATTTTTCTCTTCTCCAGTAATAAACAGTTACC A_73_101915 A_73_101915 FALSE BE809709 BE809709 gb|Bos taurus similar to Homo sapiens formin homology 2 domain containing 3 (FHOD3) unmapped Unknown GACACAAAAAGGGGAGTCACACCCTGGTCAAATATCATGGAAATCCTGGAGGAAAAGGAT A_73_101916 A_73_101916 FALSE XM_874051 XM_874051 LOC536218 ref|XM_874051 unmapped Bos taurus similar to Homo sapiens discs, large homolog 4 (Drosophila) (DLG4) GCCTTCTGCAATTTATTTATTTTTTCTTTCGAGAGAGTGAAAGGAAGAGACGGATACTCG A_73_101917 A_73_101917 FALSE XM_587941 XM_587941 LOC539535 ref|XM_587941 unmapped Bos taurus similar to Homo sapiens neurexophilin 4 (NXPH4) TCCTCAGCTTTGACTACAAACTGGTGCAGAAGGTGTGCCCAGACTATAACTTCCAGAGCG A_73_101918 A_73_101918 FALSE XM_597300 XM_597300 LOC519091 ref|XM_597300 unmapped PREDICTED: Bos taurus similar to potassium channel, subfamily K, member 13 (LOC519091) CCCGGCTAATCAGGTTTCATCCTAAACACAAGGCACTGCTTCTGGACTGCGAGCCTGAGG A_73_101919 A_73_101919 FALSE XM_864280 XM_864280 LOC515193 ref|XM_864280 unmapped PREDICTED: Bos taurus similar to modulator of estrogen induced transcription isoform b, transcript variant 2 (LOC515193) GTGTCCAGATGTATTGCACATCTTCATCGCACTGAGCTGCATGGACAGCTAATTTCTGTT A_73_101920 A_73_101920 FALSE NM_001012669 NM_001012669 FASN ref|NM_001012669 unmapped Bos taurus fatty acid synthase (FASN) CACCCCTGGACAGCATCCAGAGCCTGGCCACCTACTACATCGAGTGCATCAGGCAAGTGC A_73_101921 A_73_101921 FALSE XM_580384 XM_580384 LOC504288 ref|XM_580384 unmapped Bos taurus similar to Homo sapiens A kinase (PRKA) anchor protein 13 (AKAP13), transcript variant 2 AGAGTGTGCCTCAAAACCAGGTGTCCTTAAAAGAGAATCTGGGAGCGATTCTGACCTTTT A_73_101922 A_73_101922 FALSE XM_876343 XM_876343 LOC404068 ref|XM_876343 unmapped PREDICTED: Bos taurus similar to protein kinase C receptor, transcript variant 2 (LOC404068) GAAAACTTCTTGGGACTCATCACGTTAGCTTAGTCTGCATCAAACCGGGGCTTTGATTAA A_73_101923 A_73_101923 FALSE CB421386 CB421386 gb|Bos taurus similar to PREDICTED: Homo sapiens hypothetical LOC387654 (LOC387654) unmapped Unknown CTGTGAGCAGCAGAGTTGTTCTCTGGAATGAGGAAAAAAGCGACCTAGCAGTTCAGTATT A_73_101924 A_73_101924 FALSE XM_587033 XM_587033 LOC509963 ref|XM_587033 unmapped Bos taurus similar to Homo sapiens angiopoietin-like 4 (ANGPTL4), transcript variant 1 GTGCTGTGAGTCAGCTGGCGCCCACGGCGTCTGGGTGGAACCCACAGAATTCTCGGAATA A_73_101925 A_73_101925 FALSE BG691481 BG691481 gb|Bos taurus similar to Homo sapiens WD repeat domain 48 (WDR48) unmapped Unknown ACCCGTAATAGTTTCCAGAAGATCTGACAGTCTGCAATGCCAAAAGGGTAAAAATCTGTA A_73_101926 A_73_101926 FALSE XM_870529 XM_870529 LOC618203 ref|XM_870529 unmapped Bos taurus similar to PREDICTED: Homo sapiens tetratricopeptide repeat domain 24 (TTC24) CAGGGAACCCCCTGGCAGGAACCCTCAGAAGAGATCCATGGAGTCTGGCTTCTGCATAAT A_73_101927 A_73_101927 FALSE XM_590440 XM_590440 LOC539944 ref|XM_590440 unmapped Bos taurus similar to Homo sapiens keratin 84 (KRT84) TGCTGGAAGGCGAGGAGATCCGGATCTGTGAAGGTGTTGGACCAGTAGACATAGCGGTGA A_73_101928 A_73_101928 FALSE XM_599600 XM_599600 LOC521340 ref|XM_599600 unmapped Bos taurus similar to Homo sapiens protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 2 CTGCTGTTCAGGTGAGTTTGGTTCATTTTTACCAGTGCGGACTCTGGGCGCCGCTGTTGG A_73_101929 A_73_101929 FALSE EE906958 EE906958 gb|Unidentified transcripts on BTA29 position 31792023-31791343 unmapped Unknown TCCTCGCTATTATTAACATTAGAAGAAAGAACCCTGGTCCTGAGAGTCAGAGGTTCTGGG A_73_101930 A_73_101930 FALSE CB446992 CB446992 gb|Bos taurus similar to Homo sapiens AT rich interactive domain 5B (MRF1-like) (ARID5B) unmapped Unknown AGACTGTAAACCAGAAAAGCATCACTGAGCCTCTCCCAATAGCAGACACAAAGAAAAAGA A_73_101931 A_73_101931 FALSE XM_868840 XM_868840 LOC616737 ref|XM_868840 unmapped Bos taurus similar to Homo sapiens trace amine associated receptor 6 (TAAR6) GTCATTGTGAGTGGTCAGGTTTTCAAGAATAGTTCAGCAAGCATGAATTTGTCCTCTGAA A_73_101932 A_73_101932 FALSE XM_583629 XM_583629 LOC507075 ref|XM_583629 unmapped Bos taurus similar to Homo sapiens progestin and adipoQ receptor family member IV (PAQR4) TTGTGGTAAATGAAGCTCATCTGGCAGTCCGTCTGCTGTAATGTGCTCCCGGGGGTGAAT A_73_101933 A_73_101933 FALSE BE666212 BE666212 gb|Unidentified transcripts on BTA28 position 7763644-7764469 unmapped Unknown TCATAGCCTTAATACAGGGCTCAAGTTATAGTTATACCTGGGAACCCCCCTAAATTTAAT A_73_101934 A_73_101934 FALSE XM_870283 XM_870283 LOC617949 ref|XM_870283 unmapped PREDICTED: Bos taurus similar to FERM, RhoGEF and pleckstrin domain protein 2 (LOC617949) TACACGATACTTGTTTGCCCTGCAGCTTAAGAGAGACCTTCTGGAGGAACGTCTGACCTG A_73_101935 A_73_101935 FALSE XM_870009 XM_870009 LOC617701 ref|XM_870009 unmapped Bos taurus similar to Homo sapiens brain- derived neurotrophic factor (BDNF), transcript variant 5 CACCAGGTGAGAAGAGTGATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCGGT A_73_101936 A_73_101936 FALSE XM_610301 XM_610301 LOC531799 ref|XM_610301 unmapped PREDICTED: Bos taurus similar to RAS and EF hand domain containing (LOC531799) CCCGGAGATTCTTCCAGGACACTGGTTTAGGAGTGCTCCCCAAACCTCGGCGACTTGATT A_73_101937 A_73_101937 FALSE XM_603463 XM_603463 LOC525117 ref|XM_603463 unmapped Bos taurus similar to Homo sapiens deoxyribonuclease II beta (DNASE2B), transcript variant 1 TACCCAGAATCAGCACATTTACCAGGCATTTCAAGGACTAGTTTTATATTATGAGAACTG A_73_101938 A_73_101938 FALSE EE896971 EE896971 gb|Bos taurus similar to Homo sapiens EPH receptor A4 (EPHA4) unmapped Unknown TAACAGAACAATGCTTGGTTCATACATGTTCCAAAAGTTGAACAATCTCTTGAGTTAGAC A_73_101939 A_73_101939 FALSE XM_603006 XM_603006 LOC524676 ref|XM_603006 unmapped Bos taurus similar to Homo sapiens dpy-19-like 2 (C. elegans) (DPY19L2) ACAGATTTTGATACCTTAATTTACACCTGTGCTCCTGAATTTGACTTCATGGAAACAGCG A_73_101940 A_73_101940 FALSE NM_174255 NM_174255 CABP2 ref|NM_174255 unmapped Bos taurus calcium binding protein 2 (CABP2) CACCAAGCCCCCTTGCCCAGCTCTGTTTCTCTGACAATAAAGCATGTTCGAGCTGGGGGA A_73_101941 A_73_101941 FALSE CB468594 CB468594 gb|Bos taurus similar to Homo sapiens complement component 1, s subcomponent (C1S), transcript variant 1 unmapped Unknown TTTTGGTTTCCCCTTTACCTGTTTGAAGTTGACCACATCGTTTCTGCTATCTACTTGTAA A_73_101942 A_73_101942 FALSE XM_866488 XM_866488 LOC614845 ref|XM_866488 unmapped Bos taurus similar to Homo sapiens hypothetical LOC339541 (MGC33556) GGATTCTTTGATCCACGGTAATCCCAAGTACCAGAATCAAGTGTACAAAGGTCTGATAGC A_73_101943 A_73_101943 FALSE XM_869673 XM_869673 LOC617421 ref|XM_869673 unmapped PREDICTED: Bos taurus similar to HLA class II histocompatibility antigen, DRB1-7 beta chain precursor (MHC class I antigen DRB1*7) (DR-7) (DR7) (LOC617421) GGAGCATACCTTGGAATCAAAGTGATACTATTCATGGTAGCATCCAAAAGATGACAATTA A_73_101944 A_73_101944 FALSE NM_001015675 NM_001015675 MINA ref|NM_001015675 unmapped Bos taurus MYC induced nuclear antigen (MINA) TCAATGTCCCAGAAAGTGACAAAAGCCATATTTCGACCAGTTTATTTAATCCAGTGTGGT A_73_101945 A_73_101945 FALSE XM_590773 XM_590773 LOC513132 ref|XM_590773 unmapped Bos taurus similar to Homo sapiens CTAGE family, member 5 (CTAGE5), transcript variant 1 TCTTTATGCCAAGAACTGTATTTACTATGGTTGCAGGCAAATGTGAAAGTAACTTTATGC A_73_101946 A_73_101946 FALSE XM_612041 XM_612041 LOC540552 ref|XM_612041 unmapped Bos taurus similar to Homo sapiens delta- notch-like EGF repeat-containing transmembrane (DNER) TTATATCCAGGACATTTTTGTGGCTGTATTTGATTGATATGTGCTTCTTCTGATTCTTGC A_73_101947 A_73_101947 FALSE NM_174348 NM_174348 ICAM1 ref|NM_174348 unmapped Bos taurus similar to Homo sapiens polypyrimidine tract binding protein 1 (PTBP1), transcript variant 1 AATTTTGGACCAAAGTTTTGTTTCTGTTTTTCTCCTGCCTCTAATGCTGGGACCCCAGGA A_73_101948 A_73_101948 FALSE XM_868329 XM_868329 LOC616333 ref|XM_868329 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 79, member A (FAM79A) TTGTCAGCTCCTGAATGGACTGTTGCTTTTGTGGAAATGCGTGGTTGACCTAAAGTCACA A_73_101949 A_73_101949 FALSE XM_604534 XM_604534 LOC526172 ref|XM_604534 unmapped Bos taurus similar to Homo sapiens paired box gene 4 (PAX4) CTTGCAGTGGCCTGGCTCCCCACTGTGAGGTCTGGGATGAGGAAGGAGGCTCAGTATGGA A_73_101950 A_73_101950 FALSE XM_588296 XM_588296 LOC511042 ref|XM_588296 unmapped Bos taurus similar to Homo sapiens nicotinamide nucleotide adenylyltransferase 2 (NMNAT2), transcript variant 1 CTCGCCTTCCCAGCATGCCCTTTACCACAAAGGGCTATCTTTTTCCTTTCTTTCTTATCT A_73_101951 A_73_101951 FALSE XM_590064 XM_590064 LOC539883 ref|XM_590064 unmapped PREDICTED: Bos taurus similar to Securin (Pituitary tumor-transforming protein 1) (Tumor transforming protein 1) (Esp1-associated protein) (hPTTG) (LOC539883) CCTCAAGCATTCTGTTGACTCTGGATGTTGAATTGCCACCCGTTTCCTGTGACTTAGATA A_73_101952 A_73_101952 FALSE BE751775 BE751775 gb|Bos taurus similar to Homo sapiens dual adaptor of phosphotyrosine and 3-phosphoinositides (DAPP1) unmapped Unknown ATGTTCACTGAGATGTAGTTTCATGTTTTGTTTTAGATCCAGAAGTGTTTGTGTAGGTAG A_73_101953 A_73_101953 FALSE NM_174090 NM_174090 IL15 ref|NM_174090 unmapped Bos taurus interleukin 15 (IL15) CTTACCATGCTAGCAAACAGCAATTTATCTTCTATTGAGAATAAAACAGAATTGGGATGC A_73_101954 A_73_101954 FALSE XM_612995 XM_612995 LOC533555 ref|XM_612995 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ35779 (FLJ35779) TCTTGGAACCAGATCAACTCACACCCAGTCTCTCACAAGCATTCAGTCCATAAAAGTGGT A_73_101955 A_73_101955 FALSE BE478680 BE478680 gb|Unidentified transcripts on BTA16 position 2978142-2975976 unmapped Unknown AAACAAACTCCTGCTTTCTTTTATTGAAGGGTTTCCAGGACTGCGTGTCTGTTCCTGAGC A_73_101956 A_73_101956 FALSE XM_586208 XM_586208 LOC509275 ref|XM_586208 unmapped Bos taurus similar to Homo sapiens histone 1, H1d (HIST1H1D) ACCCACTAATTTCAGGTGAAAGAGCTTAACCGGACATAAATCCCTAGGTTTACCAATGAG A_73_101957 A_73_101957 FALSE XM_616800 XM_616800 LOC536660 ref|XM_616800 unmapped PREDICTED: Bos taurus similar to Potential phospholipid-transporting ATPase IB (ATPase class I type 8A member 2) (ML-1) (LOC536660) GATCTTATGACACCACCAAAAACAAACCCCAGAAGACTTTTTCTTCTGCCACCTTGGAGT A_73_101958 A_73_101958 FALSE XM_868643 XM_868643 LOC616586 ref|XM_868643 unmapped PREDICTED: Bos taurus similar to AER61 glycosyltransferase (LOC616586) TGTTTGCACCTATGTGGATATGGGATGGACGGACACTCTTGAATCAGCCCAGGAAATATT A_73_101959 A_73_101959 FALSE XM_864671 XM_864671 LOC525161 ref|XM_864671 unmapped Bos taurus similar to Homo sapiens WD repeat domain 40A (WDR40A) GTACTGTTGGCAGACCCTCTTCTGTGATGGGTAATGCATTTGGTTGTTTGAGGTTTTGTT A_73_101960 A_73_101960 FALSE XM_596851 XM_596851 LOC518655 ref|XM_596851 unmapped PREDICTED: Bos taurus similar to ash1 (absent, small, or homeotic)-like (LOC518655), partial mRNA. AGTTACCGTATGGGAAATGAGGCCCGATTCATCAATCACAGCTGTGACCCAAATTGTGAA A_73_101961 A_73_101961 FALSE XM_594662 XM_594662 LOC516507 ref|XM_594662 unmapped PREDICTED: Bos taurus similar to Y71F9B.8 (LOC516507) AGCGCAGTGGAGTGGCAGTACTCACTTAGAGACTTGGAATTTGCAAATGTGGATGCTTTA A_73_101962 A_73_101962 FALSE AV595295 AV595295 gb|Bos taurus similar to Homo sapiens centromere protein B, 80kDa (CENPB) unmapped Unknown TGGGGCTGGGCCCAGAGTCCAGCCATCCAGCTGCTCCTTTCCCAGTCTGAATTCAATAAA A_73_101963 A_73_101963 FALSE NM_001034614 NM_001034614 BNIP3L ref|NM_001034614 unmapped Bos taurus similar to Homo sapiens BCL2/adenovirus E1B 19kDa interacting protein 3-like (BNIP3L) TAACCCACCTGTCTCTTCTAATGGGACCAGGTTGCAAATGATATGAAAGCTTTGTTGTTT A_73_101964 A_73_101964 FALSE XM_610590 XM_610590 LOC532080 ref|XM_610590 unmapped Bos taurus similar to Homo sapiens exosome component 8 (EXOSC8) AACTGATGGATGAAGTATTTAAGAGTATGAAACCCAAATGAGCAACCACGTTTTCAAAAC A_73_101965 A_73_101965 FALSE XM_585571 XM_585571 LOC508744 ref|XM_585571 unmapped Bos taurus similar to Homo sapiens proprotein convertase subtilisin/kexin type 4 (PCSK4) TCAACACAGGGACGCTGTACCGCTACACGCTGCTGCTCTACGGGACGGCTGAGGACATGA A_73_101966 A_73_101966 FALSE NM_174675 NM_174675 GABARAPL2 ref|NM_174675 unmapped Bos taurus GABA(A) receptor-associated protein-like 2 (GABARAPL2) CCAGTCATGGTGGACTGAGCTAATCTGTTCCTCTTTCTGAAACTATTAAGGTAAATAATT A_73_101967 A_73_101967 FALSE XM_602577 XM_602577 LOC524256 ref|XM_602577 unmapped Bos taurus similar to Homo sapiens zinc finger protein 300 (ZNF300) GTACATCAGAGAATTCATAGCAGTGGTAAAAATCATAGTGAACTAAAAACACAGACAAGC A_73_101968 A_73_101968 FALSE XM_866393 XM_866393 LOC507084 ref|XM_866393 unmapped Bos taurus similar to Homo sapiens interphase cyctoplasmic foci protein 45 (ICF45) TTTTTTCCCTCCCTGTTCTCACTCCACGGGAATAGGAGACATGGCTTACAGTTGGTAATT A_73_101969 A_73_101969 FALSE XM_877007 XM_877007 LOC510840 ref|XM_877007 unmapped PREDICTED: Bos taurus similar to ankyrin repeat domain 39, transcript variant 2 (LOC510840) GTCTCTTGTCTTAACTGTGTTCGTTGTTACCTGTTTATGAAAATTGGTACAGGGGATGGC A_73_101970 A_73_101970 FALSE XM_865290 XM_865290 LOC541083 ref|XM_865290 unmapped Bos taurus similar to Homo sapiens HBS1-like (S. cerevisiae) (HBS1L) TATTTGGTGTTGAGCATAAGAGTATTCTTCCTTCAGCAAGCAACCATTTGAAAGCTTAGT A_73_101971 A_73_101971 FALSE XM_583587 XM_583587 LOC507041 ref|XM_583587 unmapped PREDICTED: Bos taurus similar to Protein kinase C, epsilon type (nPKC-epsilon) (LOC507041) GGGATTTGAAACTGGACAATATCCTTTTGGATGCAGAAGGTCATTGCAAGCTGGCTGACT A_73_101972 A_73_101972 FALSE NM_173951 NM_173951 PLG ref|NM_173951 unmapped Bos taurus plasminogen (PLG) AACATGTTCCTGACTGTGGACTGCTGGATTCTGTAATACCAAGGCAATACAGCTATGACA A_73_101973 A_73_101973 FALSE XM_597683 XM_597683 LOC519464 ref|XM_597683 unmapped Bos taurus similar to Homo sapiens RAB GTPase activating protein 1-like (RABGAP1L), transcript variant 1 CAGCAGGAAGACCCAATGGATAGATACAAGTTTGTATATTTGTAGGTGACTTCACCTGTT A_73_101974 A_73_101974 FALSE XM_614246 XM_614246 LOC534471 ref|XM_614246 unmapped Bos taurus similar to Homo sapiens integrator complex subunit 2 (INTS2) TTTTTTGTAGCAACTGAGCTTTTCTTTTTCTGTTGGCAGCGCATTTAAGAATCATTACTG A_73_101975 A_73_101975 FALSE AW445353 AW445353 gb|Unidentified transcripts unmapped Unknown TTGCACTGTCATTTTGCTGCTTCAAGTCAGGTACTTAAACCCAAGAAAAAACTATTTAGG A_73_101976 A_73_101976 FALSE XM_582371 XM_582371 LOC505993 ref|XM_582371 unmapped Bos taurus similar to Homo sapiens delta-like 3 (Drosophila) (DLL3), transcript variant 1 CGCTCTCCCTGATGCACTCAACAACATGAGGACGCAGGAAGGTCCCGGGGACGGCCCGAG A_73_101977 A_73_101977 FALSE NM_176627 NM_176627 PAG17 ref|NM_176627 unmapped Bos taurus pregnancy-associated glycoprotein 17 (PAG17) TCTCGTGGTTCAAATCTAACTATTCACCCACTGAGAAACATCATGGATATGCTCTACGTG A_73_101978 A_73_101978 FALSE BF707009 BF707009 gb|Bos taurus similar to Homo sapiens receptor tyrosine kinase-like orphan receptor 2 (ROR2) unmapped Unknown GGATAGAGTTCACTTGTAACTCCCACACCTGGTGTACCCAATAAAGCGAAAGAGAAGGTT A_73_101979 A_73_101979 FALSE BF041453 BF041453 gb|Bos taurus similar to Homo sapiens solute carrier family 4, sodium bicarbonate cotransporter, member 5 (SLC4A5), transcript variant a unmapped Unknown GCATATATAAAGGAAGCTTTTTTCCCTCCCCTGAAATAGTTCCTGGCATGTGGTAGGCAC A_73_101980 A_73_101980 FALSE NM_174351 NM_174351 IFNW1 ref|NM_174351 unmapped Bos taurus interferon, omega 1 (IFNW1) ATTTAATGGCCTTGCTTAGAAAGCATGGCATCAGAGAACCTACCTCAAGGTTCCACCAGA A_73_101981 A_73_101981 FALSE NM_174628 NM_174628 UBQLN1 ref|NM_174628 unmapped Bos taurus ubiquilin 1 (UBQLN1) CAATTGGTGGTATACAGTGTGGGGTAGTGTCATAACCAGTTTGACAATTTATTAATCACA A_73_101982 A_73_101982 FALSE CB448442 CB448442 gb|Bos taurus similar to Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 (FAM19A2) unmapped Unknown AAGACTGTCTGAACTTGTAAAGAAAGGAGTAATAGTTGTGCTGGAGTTTCTGCATCAGTG A_73_101983 A_73_101983 FALSE NM_173964 NM_173964 TEK ref|NM_173964 unmapped Bos taurus TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal) (TEK) ATATTGTAGGCACATGCTATACTGAGATCATATAGTAAGTGAATAAATGTCTTGCCTACC A_73_101984 A_73_101984 FALSE CB433868 CB433868 gb|Bos taurus similar to Homo sapiens ubiquitin-activating enzyme E1-like 2 (UBE1L2) unmapped Unknown GCTGGTGATTGAAATACCAGGTGCAAAAATTAATGATTTGATTTTGTACAGTACCACTGA A_73_101985 A_73_101985 FALSE NM_174293 NM_174293 CRYL1 ref|NM_174293 unmapped Bos taurus crystallin, lambda 1 (CRYL1) CCCTGTGGTCCTACACATTTGAGGAGTTCCCTTCATTTTTCTGATCCTTATTCCAAATAA A_73_101986 A_73_101986 FALSE CB419721 CB419721 gb|Bos taurus similar to Homo sapiens ectonucleoside triphosphate diphosphohydrolase 3 (ENTPD3) unmapped Unknown GGCTGCAAAGTAAAAATCAACATTCTCTCAGATTATAGCTTGTTCACTGAGTACAGAATA A_73_101987 A_73_101987 FALSE XM_605012 XM_605012 LOC526639 ref|XM_605012 unmapped Bos taurus similar to Homo sapiens lipocalin 2 (oncogene 24p3) (LCN2) ACCCTTCTCTGGGTCCTGCAGCCCCGAAGATGCAGCCCTGCCTTGCCTGCTAAATAAATA A_73_101988 A_73_101988 FALSE XM_589513 XM_589513 LOC512072 ref|XM_589513 unmapped PREDICTED: Bos taurus similar to protein tyrosine phosphatase, receptor type, F (LOC512072) TGGTGTACCGTGACATCAACAGCCAGCAGGAGCTTCAGAACGTCACTGCCGACACCCACC A_73_101989 A_73_101989 FALSE XM_581807 XM_581807 LOC505512 ref|XM_581807 unmapped Bos taurus similar to Homo sapiens SUMO-1 activating enzyme subunit 1 (SAE1) TGGAATGCGTTCCTCACCCACACTTGACTTTCTCCCCATATGTAAATTGGCTGGTTAGAA A_73_101990 A_73_101990 FALSE XM_588843 XM_588843 LOC511497 ref|XM_588843 unmapped Bos taurus similar to Homo sapiens arginyl aminopeptidase (aminopeptidase B)-like 1 (RNPEPL1) GGACCTCCGCTCGGGGTCACCGCCATTGTCCCATTAAACCTCCACTCTGCAGACTGCCAA A_73_101991 A_73_101991 FALSE CB226336 CB226336 gb|Bos taurus similar to Homo sapiens RAB2, member RAS oncogene family (RAB2) unmapped Unknown GTGTGGTGGTTTTACCCTTTTTCTTTTATCTCCCTTGGTCTATAATGAAATTGTTATAGC A_73_101992 A_73_101992 FALSE BF440184 BF440184 gb|Unidentified transcripts on BTA16 position 1487416-1486740 unmapped Unknown CTGAAAAGGTGAGTTGTTGATGTAGTATAAATGTTCCATTTGAAGCTGCCGGTTTCTTCA A_73_101993 A_73_101993 FALSE BM255896 BM255896 gb|Bos taurus similar to Homo sapiens Rho-related BTB domain containing 3 (RHOBTB3) unmapped Unknown AAGGGCCATTTAAAGACCCAGTATGACTGTTTCTATAATGAGAAATTTAGAAGACTGATC A_73_101994 A_73_101994 FALSE BE664511 BE664511 gb|Unidentified transcripts on BTA19 position 39429270-39430514 unmapped Unknown AAATGGGTATTAATTTGTAATTATCCCAGCCAGACTGTTTTGGCCTTTCCCAATTTGGGG A_73_101995 A_73_101995 FALSE NM_001040588 NM_001040588 LOC615896 ref|NM_001040588 unmapped Bos taurus similar to Homo sapiens choline phosphotransferase 1 (CHPT1) AACCAACTAACAGAAAAACCCTCAAAATCCTCTCATGCACTTTAGCTCTTGAAAACTAGT A_73_101996 A_73_101996 FALSE XM_609754 XM_609754 LOC531264 ref|XM_609754 unmapped PREDICTED: Bos taurus similar to macrophage scavenger receptor 2 (LOC531264), partial mRNA. ACACTGGCTGAATGTGAGCAGGTTGAGACCTTTGACTGTGGGCACGATGAAGATGCAGGC A_73_101997 A_73_101997 FALSE EE893106 EE893106 gb|Unidentified transcripts on BTA1 position 99758804-99759824 unmapped Unknown GGCTTCAGTCCATATGAGAGAGAACCATGGAATTTCCCAGGGCCTCTCCTCCACTCTGCC A_73_101998 A_73_101998 FALSE XM_606934 XM_606934 LOC528508 ref|XM_606934 unmapped Bos taurus similar to PREDICTED: Homo sapiens deltex 4 homolog (Drosophila) (DTX4) CAGACACCGTCATCTGGAATGAAGTCCATCACAAGACAGAGTTCGGCTCTAACCTCACCG A_73_101999 A_73_101999 FALSE NM_173897 NM_173897 CA4 ref|NM_173897 unmapped Bos taurus carbonic anhydrase IV (CA4) TTGACCTCTGGTCTCAGCCCTTAAGAGGGCTTGGCCTCTGTCCCTCAGGCTTCTCAGATT A_73_102000 A_73_102000 FALSE NM_001035480 NM_001035480 MGC127823 ref|NM_001035480 unmapped Bos taurus similar to Homo sapiens chromosome 12 open reading frame 24 (C12orf24) ATGTGCCAAAGGTGGGGGAAGGGATTGTGAATTGTGTCCTCTCTCTACATTTAAGACAGA A_73_102001 A_73_102001 FALSE NM_001014950 NM_001014950 ID3 ref|NM_001014950 unmapped Bos taurus inhibitor of DNA binding 3 (ID3) ATGCGATGTATATTAAACTTTTTATAAAAGTTAACATTTTGCATAATAAACGGTTTTTAA A_73_102002 A_73_102002 FALSE XM_598418 XM_598418 LOC520183 ref|XM_598418 unmapped Bos taurus similar to Homo sapiens DEP domain containing 2 (DEPDC2), transcript variant 1 CTGCCTACATAGATAAGCTCATGAGGCCTCTCAATGTTTTGGATGAACTTTATCGACTGG A_73_102003 A_73_102003 FALSE XM_877167 XM_877167 LOC540253 ref|XM_877167 unmapped Bos taurus similar to Homo sapiens hypothetical protein MGC33648 (MGC33648) GTAGTTTATCAAATTTTAGCCAAGTCATCAGCAGTTCTTACACTGTTGATGTGTACTAAC A_73_102004 A_73_102004 FALSE XM_588453 XM_588453 LOC511170 ref|XM_588453 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein LOC146909, transcript variant 1 (LOC146909) TGCCATCATTCCCCCTCGTTTATAATGCCGTCCAGGCAGGAAGCTAGCTATGGGGGGCTT A_73_102005 A_73_102005 FALSE XM_618150 XM_618150 LOC537961 ref|XM_618150 unmapped Bos taurus similar to Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 19 (ADAMTS19) AGAAGAGTTGACCTCTGGCAGGCTGGCTGGCCAACAGCTCTTTGCAATTACATTATTTAT A_73_102006 A_73_102006 FALSE XM_580934 XM_580934 LOC504764 ref|XM_580934 unmapped Bos taurus similar to Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR) CTGTGGAGGGAAGACTGGTACTAACAGATGTGCTGCACTTTTGTGGTTGGAAGCATCTGA A_73_102007 A_73_102007 FALSE XM_590739 XM_590739 LOC513103 ref|XM_590739 unmapped PREDICTED: Bos taurus similar to multiple substrate lipid kinase (LOC513103), partial mRNA. TACAGATGCTACACTTGCCATTGTGAAAGGAGAGACGGTTCCACTTGATGTCTTACAGAT A_73_102008 A_73_102008 FALSE NM_001040587 NM_001040587 PYY ref|NM_001040587 unmapped Bos taurus peptide YY (PYY) TCTTCTCTCCATACTGCTCTTTCCAGATCGCGAGGACCCGCCGGTCAAGTCGCGGCCAGA A_73_102009 A_73_102009 FALSE XM_865890 XM_865890 LOC614401 ref|XM_865890 unmapped PREDICTED: Bos taurus similar to Voltage- dependent L-type calcium channel alpha-1C subunit (Voltage-gated calcium channel alpha subunit Cav1.2) (Calcium channel, L type, alpha-1 polypeptide, isoform 1, cardiac muscle) (RAT brain class C) (RBC)... CTTTATCATCGTGGTTGTCGGGCTTTTCAGCGCGATCTTAGAGCAAGCGACCAAAGCCGA A_73_102010 A_73_102010 FALSE XM_869549 XM_869549 LOC617316 ref|XM_869549 unmapped Bos taurus similar to Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) (ELAVL1) TTAAAGATTAACCCTCAAAGTTCTCTTCATAACTGCCTTGACGTTTTGGGTTGTTCTGTT A_73_102011 A_73_102011 FALSE NM_001035328 NM_001035328 DKFZP761P1121 ref|NM_001035328 unmapped Bos taurus similar to Homo sapiens chromosome 22 open reading frame 25 (C22orf25) TCAGGGAGGGCACACAGAGGCCCCTGCCGTTCTCCTTTTCCCGAAGAACTAAATGGCATA A_73_102012 A_73_102012 FALSE XM_582523 XM_582523 LOC506121 ref|XM_582523 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 4, subfamily B, member 1 (OR4B1) TGTCTTCTCCTTCCTCCTTTTGGTGTCCTCATACATTGTCATCCTGGTCAACTTGAGGAA A_73_102013 A_73_102013 FALSE CB451222 CB451222 gb|Bos taurus similar to Homo sapiens myotubularin related protein 9 (MTMR9) unmapped Unknown CCCAAAAGAGACCTTCTGAAACTCTATGCTAGGTTTTAGAAAGTCTGAACTTGTTATCTA A_73_102014 A_73_102014 FALSE NM_176644 NM_176644 CYP11A1 ref|NM_176644 unmapped Bos taurus cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1) TCTTGCACCTTTCTGGCTAGGTCTGACCAGATGAAGCTGGCACTCAGGGGTCAGCTGCTT A_73_102015 A_73_102015 FALSE XM_581895 XM_581895 LOC505588 ref|XM_581895 unmapped PREDICTED: Bos taurus similar to cordon-bleu homolog (LOC505588) AGGTGCCCTTGCTTGTGTGAGTCAGTGACAAGATGCAGTTGTGGCAGAAAACCGCCCCCA A_73_102016 A_73_102016 FALSE XM_864794 XM_864794 LOC507883 ref|XM_864794 unmapped Bos taurus similar to Homo sapiens minichromosome maintenance deficient domain containing 1 (MCMDC1) GAGTAGACAAGCTTTGGGGTACTGGAAGGGGAAAAGACAGGAATATATGAAGAAGACTTC A_73_102017 A_73_102017 FALSE CB165948 CB165948 gb|Unidentified transcripts on BTA17 position 20793556-20795323 unmapped Unknown CCATATTTGGTGAACCATAAATCTTGGAAGCAAGACTGCAATATGCTTAAATTTAAGTGG A_73_102018 A_73_102018 FALSE NM_001038096 NM_001038096 MGC128240 ref|NM_001038096 unmapped Bos taurus similar to Homo sapiens complement factor I (CFI) AAATACAGGCGGTGTGATGGGACATTTGTTAAAGGTCTCTACAAAGTTTATGCCATTTTG A_73_102019 A_73_102019 FALSE AV599259 AV599259 gb|Unidentified transcripts on BTA20 position 9354603-9355298 unmapped Unknown TTGAAGTATCAACCAAAGACTAAGTTATTGTATATCCATGCTGCGGAATACTTTGTAAGC A_73_102020 A_73_102020 FALSE CB442547 CB442547 gb|Bos taurus similar to Homo sapiens laminin, alpha 2 (merosin, congenital muscular dystrophy) (LAMA2) unmapped Unknown ATTTGTGCATGCATGTTGAATGCTTTCTATATTCCAGCGGTGCTAATTCAGATCCCAGAC A_73_102021 A_73_102021 FALSE BM483254 BM483254 gb|Unidentified transcripts unmapped Unknown AAGCACAATGTTGATTGTTCTCTAATTTACCTTGTTTTCCTACAAACAGCTCAACTTTCC A_73_102022 A_73_102022 FALSE CB437207 CB437207 gb|Bos taurus similar to Homo sapiens mannosidase, alpha, class 1A, member 2 (MAN1A2) unmapped Unknown AAGAGAGAAAAAGCCACTGCCAGCAGTTCCTATACCAAACCTTATAGGAACACATGGTGG A_73_102023 A_73_102023 FALSE NM_174025 NM_174025 CRYZ ref|NM_174025 unmapped Bos taurus crystallin, zeta (quinone reductase) (CRYZ) GTGCGCTGTGTTTGCTGTACTTAGCATTCATTTGATTCAGTGAGTTCCTTACACTTAAAA A_73_102024 A_73_102024 FALSE XM_867231 XM_867231 LOC615428 ref|XM_867231 unmapped Bos taurus similar to Homo sapiens troponin C type 2 (fast) (TNNC2) GGACAAGAACAACGACGGCCGCATTGACTTCGACGAGTTCCTGAAGATGATGGAGGGCGT A_73_102025 A_73_102025 FALSE AW463640 AW463640 gb|Bos taurus similar to Homo sapiens synovial sarcoma translocation gene on chromosome 18-like 1 (SS18L1), transcript variant 2 unmapped Unknown TAACGTGCCGTCCATTTTTATGTAACGTGGGGAGTGATGCCAGCGGCTCGTCACTCTCTT A_73_102026 A_73_102026 FALSE hmm4226 gb|Region 3' of Bos taurus HMM4226 wothout similarity to human proteins unmapped Unknown GAGGCAACATGACAGGTTCCCTGAGGTCCCCATCTTAACTCAAGAGGAACCCCAAGCTTC A_73_102027 A_73_102027 FALSE XM_580738 XM_580738 LOC504591 ref|XM_580738 unmapped PREDICTED: Bos taurus similar to kinase suppressor of ras 2 (LOC504591) AGTCCTTGAGGAGATCACCCCGGGCCAGCTGAGTCTGGAGGACCTCTTGGAGATGACAGA A_73_102028 A_73_102028 FALSE CB535640 CB535640 gb|Unidentified transcripts on BTA27 position 6450105-6451103 unmapped Unknown TGTTCTCCTCGTGGTCTGTGTTATTTATAATTACATGAATCTTAACCAAAGGTTCCATTG A_73_102029 A_73_102029 FALSE BM253131 BM253131 gb|Bos taurus similar to PREDICTED: Homo sapiens similar to KIAA1155 protein (LOC400961) unmapped Unknown ACAAAGTGGCAGCTGTTGAAAATCTCTCTCATTAAAATGAGAATAAAATGCATTTGCTGG A_73_102030 A_73_102030 FALSE XM_591041 XM_591041 LOC513372 ref|XM_591041 unmapped Bos taurus similar to Homo sapiens 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS) GTTTGTAACGTAAGATACACCTAACATGAAACCAGTTTTAAAAATCAATAGCCGTGTGTG A_73_102031 A_73_102031 FALSE CB170149 CB170149 gb|Unidentified transcripts on BTA4 position 59726015-59724952 unmapped Unknown CTTTGCGACAGGGCCTTTTACATGAGTGTTTTTTCTTTTTGTATGTGTTACGTGTTGTTG A_73_102032 A_73_102032 FALSE XM_869645 XM_869645 LOC534122 ref|XM_869645 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to aminopeptidase puromycin sensitive (LOC653118) CTGTATTTCAGAAGGTCATCAGATTGTGAGACTGCTTCCTTGAAACATTTTTTGTGCTAT A_73_102033 A_73_102033 FALSE XM_601891 XM_601891 LOC523590 ref|XM_601891 unmapped Bos taurus similar to Homo sapiens EF-hand domain (C-terminal) containing 2 (EFHC2) TGTGAAGATGAGTGGCTTGGGATGCCATCACCTATTCCTGTGAAATACATTTACTATTCA A_73_102034 A_73_102034 FALSE XM_875024 XM_875024 LOC521196 ref|XM_875024 unmapped Bos taurus similar to Homo sapiens makorin, ring finger protein, 2 (MKRN2) GGGCGACTACAATAGCAGCTAGAGAAGCAGGACCCCATCTACGTGTTAGGTTATTTTATA A_73_102035 A_73_102035 FALSE NM_001040580 NM_001040580 LOC614733 ref|NM_001040580 unmapped Bos taurus similar to inhibitor of growth family, member 5 (LOC614733) ACCCCTGTGTGACAGTGACCTCGAGTCACATGGGTTTGTACCACTTCCACGCGGCTGTTT A_73_102036 A_73_102036 FALSE XM_593354 XM_593354 LOC540345 ref|XM_593354 unmapped Bos taurus similar to Homo sapiens DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1) CCCCAGGCCACACCCCCTTTGGTTTGTTTTAGTTGCTCTGGGGGGAAGAGAGACCATAGA A_73_102037 A_73_102037 FALSE AV664173 AV664173 gb|Bos taurus similar to Homo sapiens transmembrane and tetratricopeptide repeat containing 1 (TMTC1) unmapped Unknown CTCCCATAAAGGATTTCTCCTATTTAAGTCTGATTATGTACACTTTGCCTAGGTCTTTCC A_73_102038 A_73_102038 FALSE NW_929458 NW_929458 gb|Putative orthologue of human miRNA hsa-mir-144 on chr 17, (-) strand. Mature length 22 nt, stem-loop length 86 nt. Source: NW_929458.1:c433514-433438 unmapped Unknown TACAGTATAGATGATGTACTAGTATCCTACTATACGTATCACATA A_73_102039 A_73_102039 FALSE CB457466 CB457466 gb|Unidentified transcripts on BTA5 position 62842040-62841346 unmapped Unknown AATGTGTCGTCTTCCTTCAGAGGGTTACTGGGATCTTGATGTTGTTGTGTCTGTGGGTAT A_73_102040 A_73_102040 FALSE XM_591188 XM_591188 LOC513497 ref|XM_591188 unmapped Bos taurus similar to Homo sapiens cyclin- dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A), transcript variant 2 TTCAAAGCCCCACCCACAGTGCTGAGTATACAGCAGGTGCTCAATAAATATTCCTGATGA A_73_102041 A_73_102041 FALSE XM_587101 XM_587101 LOC539429 ref|XM_587101 unmapped Bos taurus similar to Homo sapiens galanin receptor 1 (GALR1) TTCCAGAAGAACTTGTATCTGCAGACCAAGTACTTCCTGGGGCACCCTTGTAATCATGTT A_73_102042 A_73_102042 FALSE XM_588764 XM_588764 LOC511431 ref|XM_588764 unmapped Bos taurus similar to Homo sapiens acyl-CoA thioesterase 4 (ACOT4) AATGGCCATTCAGTGTTTGCCAGTGGTTCAATTACTGATAACAGTAGAATTTTCATTGGC A_73_102043 A_73_102043 FALSE BE590158 BE590158 gb|Unidentified transcripts unmapped Unknown TGTAAATATACGTTCAATATCTTGATTGCAGTGATGTTTTCATATGTGTGAAAACATAAG A_73_102044 A_73_102044 FALSE XM_586294 XM_586294 LOC509354 ref|XM_586294 unmapped Bos taurus similar to Homo sapiens non- metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) (NME6) AAAGTCAGTATGCTACTGAAAAAGGCTGGGAACACTACTCGAGGTGCTCTCTCTCTCCCC A_73_102045 A_73_102045 FALSE NM_001015555 NM_001015555 AUP1 ref|NM_001015555 unmapped Bos taurus ancient ubiquitous protein 1 (AUP1) TAAAGGGAGGAATGGGCTCCCCCCAGTGTCACATTAAATTCAGGGTTTTCACTCAGAAAA A_73_102046 A_73_102046 FALSE XM_867983 XM_867983 LOC616020 ref|XM_867983 unmapped PREDICTED: Bos taurus similar to Suppressor/Enhancer of Lin-12 family member (sel-10) (LOC616020) TGGAAATCCTTTCTTGTCATTCTTTCAAAAATGGATGGTACAGGTGAAAATAAAAGACGG A_73_102047 A_73_102047 FALSE XM_582882 XM_582882 LOC506433 ref|XM_582882 unmapped Bos taurus similar to Homo sapiens WNK lysine deficient protein kinase 1 (WNK1) TTTTTTCCCCTCCTGTGGATGAAATAACTGAAACCTAGAGGAATGAACCAGTGCTACTGA A_73_102048 A_73_102048 FALSE XM_588760 XM_588760 LOC511427 ref|XM_588760 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ12949 (FLJ12949), transcript variant 2 CTCGTAGTCCAGCCGGGTAATACTCATCCAGGTACTCCTCGAATGTCTTGTCCCCAGGGT A_73_102049 A_73_102049 FALSE AU098184 AU098184 gb|Bos taurus similar to Homo sapiens RYK receptor-like tyrosine kinase (RYK), transcript variant 2 unmapped Unknown TTTTTTACTTCATCAATGTAGGTGATTCACCTTTAAAGTTTTTTGTTTGTTTGGTTTAAT A_73_102050 A_73_102050 FALSE XM_585605 XM_585605 LOC508773 ref|XM_585605 unmapped Bos taurus similar to Homo sapiens hypoxia up- regulated 1 (HYOU1) ACTAGCAGTTGAGGCTGGTTGGACAGATTTGAGTCAAATTGTACTTTGCTCCATTGTTAA A_73_102051 A_73_102051 FALSE XM_580961 XM_580961 LOC504790 ref|XM_580961 unmapped Bos taurus similar to Homo sapiens component of oligomeric golgi complex 7 (COG7) TCAGATAATTTTTAAAAATGATTCCATCTTGAAAGTGCAGTTAATAAATACCATGAAATG A_73_102052 A_73_102052 FALSE XM_593842 XM_593842 LOC515764 ref|XM_593842 unmapped Bos taurus similar to Homo sapiens pancreatic lipase (PNLIP) GTTTGGAATGAGCCAAGTTGTGGGCCACCTAGATTTCTTCCCAAATGGAGGGAAAGAAAT A_73_102053 A_73_102053 FALSE XM_586306 XM_586306 LOC509365 ref|XM_586306 unmapped Bos taurus similar to Homo sapiens TatD DNase domain containing 1 (TATDN1) ATACTGGAGATAATGTCAGCAGTAAGAGATGAAGATCCATTGGAACTAGCCAATACACTA A_73_102054 A_73_102054 FALSE CB169614 CB169614 gb|Unidentified transcripts on BTA6 position 63881287-63882292 unmapped Unknown AGAGGAGGTGGTTCAAAGACCTGCCCTTGCTGACCAAATAAACTAATCAACCCCTTCAAA A_73_102055 A_73_102055 FALSE XM_610747 XM_610747 LOC532237 ref|XM_610747 unmapped Bos taurus similar to Homo sapiens pleckstrin and Sec7 domain containing 4 (PSD4) TCACATAGGCTGTCACAGCGGGAGGGGACCTCAGAATCATTGATTCATCCACTCATGGGT A_73_102056 A_73_102056 FALSE NM_001038549 NM_001038549 MGC134459 ref|NM_001038549 unmapped Bos taurus similar to Homo sapiens kinesin light chain 3 (KLC3) AAGGCCAGCTAAGACTCAGGCGTCACGGCCCCACCTGGCACTATAGCTGCTGGGCAATCT A_73_102057 A_73_102057 FALSE NM_001015598 NM_001015598 KBTBD5 ref|NM_001015598 unmapped Bos taurus kelch repeat and BTB (POZ) domain containing 5 (KBTBD5) TGTCAGGTGGGGAGCAACTCTATCGAGTGCACCTTGCAGCCTGAGTAAGTCTCCTCCTGT A_73_102058 A_73_102058 FALSE XM_593803 XM_593803 LOC515731 ref|XM_593803 unmapped Bos taurus similar to Homo sapiens plexin domain containing 2 (PLXDC2) AGTGCTGGCTTACAGGTGTTAAGACTAAAAATTTGCCTATACCTTTAAGACAAACACACA A_73_102059 A_73_102059 FALSE NM_001034593 NM_001034593 APBB1IP ref|NM_001034593 unmapped Bos taurus similar to Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein (APBB1IP) AATCCTTAACCTGCACAGAATTGAGACTATCTACGTCAATGTACGTTCTTTTCTGTGTAT A_73_102060 A_73_102060 FALSE NM_201527 NM_201527 SOD2 ref|NM_201527 unmapped Bos taurus superoxide dismutase 2, mitochondrial (SOD2) TCGTTAATGGCTGTATAATGCTTTATCAGTTGGACACTTCCTAATAAATTTTACAGTCCG A_73_102061 A_73_102061 FALSE NM_001034209 NM_001034209 SPSB1 ref|NM_001034209 unmapped Bos taurus similar to Homo sapiens splA/ryanodine receptor domain and SOCS box containing 1 (SPSB1) CAGCCCAGAGCCTTGTGGCCTGTACAGTTTTGAAACTCCTGTTCTATTTTATGATGGTTG A_73_102062 A_73_102062 FALSE XM_881553 XM_881553 LOC508148 ref|XM_881553 unmapped Bos taurus similar to Homo sapiens hepsin (transmembrane protease, serine 1) (HPN), transcript variant 1 CTGGAAACCTATAGGGCTTAGAAGCGGTCACCCTAGGGAACAGATGGCTTTCACGGGGCT A_73_102063 A_73_102063 FALSE BF652044 BF652044 gb|Unidentified transcripts on BTA7 position 8591642-8591041 unmapped Unknown TCATCTGTTCTTCCTTAGCTTCCCAAGGCAGAAACCAGAGATTATGCCCTCCCTTTTATG A_73_102064 A_73_102064 FALSE XM_583236 XM_583236 LOC506745 ref|XM_583236 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 46, member B (FAM46B) TCCTCACGAGGGAAAGGAGAGGTATGCCCCACCTCCCTTCCCATCCCTCTGGATTTGTAA A_73_102065 A_73_102065 FALSE BG358871 BG358871 gb|Unidentified transcripts unmapped Unknown ACAAGTAGGAAGAGACCCTCACCAAGGACCCAACCATGAACTTCCAGCCTCCAGACTCGT A_73_102066 A_73_102066 FALSE NM_001034382 NM_001034382 IVD ref|NM_001034382 unmapped Bos taurus similar to Homo sapiens isovaleryl Coenzyme A dehydrogenase (IVD), nuclear gene encoding mitochondrial protein GCCTCCAGCGTGGGGAGAACAATGATTTTACAGATGCTATATGTGAAATAAAAATATTAA A_73_102067 A_73_102067 FALSE XM_609862 XM_609862 LOC531370 ref|XM_609862 unmapped PREDICTED: Bos taurus similar to LIM homeobox transcription factor 1 alpha (LOC531370) CTGCAAAGAGCCCCTGGAGACCACCTGCTTCTACCGGGACAAGAAGCTCTACTGCAAGTA A_73_102068 A_73_102068 FALSE EE908403 EE908403 gb|Unidentified transcripts on BTA24 position 40830748-40830014 unmapped Unknown TGGAAGACAGCGGAGTCTCAGATAACTCTGAGGTAATGCTTCGGAGAAACATGGTTTTCA A_73_102069 A_73_102069 FALSE XM_872981 XM_872981 LOC510120 ref|XM_872981 unmapped Bos taurus similar to Homo sapiens MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) (MCM2) CTTTTCTGCCGGCCGCCTTCCCACGCTGTTGTTTATACATTAGTTCTTTCTATGGTTTTA A_73_102070 A_73_102070 FALSE XM_589776 XM_589776 LOC539841 ref|XM_589776 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 55 (CCDC55), transcript variant 1 TGTCACATTTAAAATGTCACTCGTGTCATGCCGTCATTCCTCTTTTGTGAAACCTTAGCA A_73_102071 A_73_102071 FALSE NM_173887 NM_173887 ADA ref|NM_173887 unmapped Bos taurus adenosine deaminase (ADA) CTCCTCTGGTGACTTGTGCTGAAAATCTGGTGCTCAATAAAGAAGCCAATGGCTGGGGCC A_73_102072 A_73_102072 FALSE XM_868724 XM_868724 LOC616646 ref|XM_868724 unmapped PREDICTED: Bos taurus similar to C-type lectin, superfamily member 8 (LOC616646) GGAGTGATTTTCCTTGTGACTCTAAGACAAGTTGGATTTGCAAGATAACTGGAACTGCAT A_73_102073 A_73_102073 FALSE XM_864829 XM_864829 LOC531706 ref|XM_864829 unmapped Bos taurus similar to Homo sapiens ubiquitin specific peptidase 33 (USP33), transcript variant 1 TTTGTTTTGGTCTGGGGCAGATGCCACCAGCTAAAACAGTGTTATTAAAATCAGTTCAAT A_73_102074 A_73_102074 FALSE CB449623 CB449623 gb|Unidentified transcripts on BTA28 position 21746910-21746166 unmapped Unknown GAGGGCTGCCGGGCTGGCCCCAGTCCCACCTCTGTTTATTCTGTACTACAACCTGTAAAT A_73_102075 A_73_102075 FALSE CB420097 CB420097 gb|Unidentified transcripts on BTA16 position 45717703-45718311 unmapped Unknown TTGATAACTTGGAGTCACAACCAAGCAAATGTCCAAAATAAAGGAGAAATTTGAAATAGA A_73_102076 A_73_102076 FALSE XM_864734 XM_864734 LOC538237 ref|XM_864734 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 51 (C1orf51) AACAAAATGACAAGTTTTTTGACCTGATACTCTCTTAATACCCCATGTTCAATTCAGAGC A_73_102077 A_73_102077 FALSE XM_606019 XM_606019 LOC527624 ref|XM_606019 unmapped Bos taurus similar to Homo sapiens membrane- associated ring finger (C3HC4) 4 (MARCH4) TGTCCGATCACCACTGTGCTTACACCATCCTGCACATCTTGAGTCACTTGCGACCTCATG A_73_102078 A_73_102078 FALSE XM_584088 XM_584088 LOC507477 ref|XM_584088 unmapped Bos taurus similar to Homo sapiens aldehyde dehydrogenase 7 family, member A1 (ALDH7A1) GGTGGCTAATCCCTTATGTGTCTGAGGCCTAAATCAAGAGACTCATTTTTTAAAAAATGA A_73_102079 A_73_102079 FALSE XM_867348 XM_867348 LOC534420 ref|XM_867348 unmapped Bos taurus similar to Homo sapiens keratin 1 (epidermolytic hyperkeratosis) (KRT1) TGGTGGCAGCAAAAGCATCTCCATTAGTGTGGCCGGAGGAGGTGGACGTGGTGGTTTCGG A_73_102080 A_73_102080 FALSE XM_597998 XM_597998 LOC519773 ref|XM_597998 unmapped Bos taurus similar to Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A (SEMA3A) AACAGGCATTCTTCTGAATACCAACACCTATTAATAGAGGTCAGATGAACACAGATGTTC A_73_102081 A_73_102081 FALSE NM_001024529 NM_001024529 GPAA1 ref|NM_001024529 unmapped Bos taurus anchor attachment protein 1 (GPAA1) CAGCTGGGAGTTCCCCACGTTCTCTTCTTCCTAGGAAATAAACAGTTCTGTTTCAGATGT A_73_102082 A_73_102082 FALSE BI359559 BI359559 gb|Bos taurus similar to PREDICTED: Homo sapiens synaptopodin 2, transcript variant 4 (SYNPO2) unmapped Unknown TTCTTTTTTGTGAACATTTCCACTTCTCTGTACACTGCAAAACTGCAAGCCATAGGTATT A_73_102083 A_73_102083 FALSE XM_869016 XM_869016 LOC616885 ref|XM_869016 unmapped Bos taurus similar to Homo sapiens keratinocyte growth factor-like protein 1 (KGFLP1) TTTAATAATGTTCTTCCCGCAAATAATCGTGCTTTTCTCCTCTGGTTACAGCATTAAACT A_73_102084 A_73_102084 FALSE BI538722 BI538722 gb|Bos taurus similar to Homo sapiens sulfatase 1 (SULF1) unmapped Unknown ATTCTGTGATACTTTTATAGAACAATTCTGGCTTCAGGAAAGTCTAGAGGCACTATTTCT A_73_102085 A_73_102085 FALSE BM251391 BM251391 gb|Unidentified transcripts on BTA15 position 15019351-15018748 unmapped Unknown GGCTCAACAGAATGACAAAGCTTCTTTTTCTAGGAAATAAGACAATTTTCTTGACAACTC A_73_102086 A_73_102086 FALSE CB467249 CB467249 gb|Bos taurus similar to Homo sapiens hydroxysteroid dehydrogenase like 2 (HSDL2) unmapped Unknown TCAGGCAGTAACATTAACTCTTTTTGTATCTTCTTCCTGTGTAAAATGAGACTAGACTGT A_73_102087 A_73_102087 FALSE NM_174461 NM_174461 SFRP5 ref|NM_174461 unmapped Bos taurus secreted frizzled-related protein 5 (SFRP5) TCCCAGAAGCTCGCTCCTCAGCCTCCGCGTGTCCCTATATCCTGATGACCATAAATTAAT A_73_102088 A_73_102088 FALSE XM_598489 XM_598489 LOC520254 ref|XM_598489 unmapped PREDICTED: Bos taurus similar to SH3-binding domain protein 5-like (LOC520254), partial mRNA. CTGCAGAAGTGTGATTCCGTGGAGCACCTGCGGGGTCTCTCGGACCACACCAGTCTCGAT A_73_102089 A_73_102089 FALSE XM_582675 XM_582675 LOC506250 ref|XM_582675 unmapped Bos taurus similar to Homo sapiens holocytochrome c synthase (cytochrome c heme-lyase) (HCCS) GGATGAAGGTGGCCTGGTGGCGCTGGACTTCCTAAGCACCGCTTTGTCAGAGATGAGAAA A_73_102090 A_73_102090 FALSE XM_870198 XM_870198 LOC617872 ref|XM_870198 unmapped PREDICTED: Bos taurus similar to retrotransposon gag domain containing 1 (LOC617872) TTAAGTCTGAGCCTCTGTTGGTCGGCCTGGATGATGGTGTTAAGCTCCCCGGCGAGTCTA A_73_102091 A_73_102091 FALSE EE940627 EE940627 gb|Unidentified transcripts unmapped Unknown TGTGATATTTGTATGGCTTTTTACTGCTTATCATGGTACTTCAAGGGCCGAGACACATGT A_73_102092 A_73_102092 FALSE XM_865064 XM_865064 LOC511999 ref|XM_865064 unmapped Bos taurus similar to Homo sapiens carbohydrate kinase-like (CARKL) GAATGGTAACCCAGCATCTTGGTCAACAGGGTCATCTGTAGGCAAAATAAATGTGGGCTT A_73_102093 A_73_102093 FALSE XM_592974 XM_592974 LOC515034 ref|XM_592974 unmapped PREDICTED: Bos taurus similar to Interleukin-1 receptor-associated kinase-like 2 (IRAK-2) (LOC515034) GTCTGTGAGTCGGCTTTACCAGGGGCTCATTACGATCCCTTTACCAGTCCCTTCACCGAG A_73_102094 A_73_102094 FALSE XM_864676 XM_864676 LOC510467 ref|XM_864676 unmapped Bos taurus similar to Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide B7 (UGT2B7) CCAGTTTAGCTTATTTCCCAGAAGAGTGTTTGTAAAATTAGAAATATAGCAACTGCTACC A_73_102095 A_73_102095 FALSE BE752458 BE752458 gb|Bos taurus similar to Homo sapiens PHD finger protein 7 (PHF7), transcript variant 2 unmapped Unknown CATGCCAGAAAGTTCCCTCCTACCCTTTCCAGTTAGTTCTCTCAAAGATAATCACTGTTT A_73_102096 A_73_102096 FALSE XM_882991 XM_882991 LOC515556 ref|XM_882991 unmapped Bos taurus similar to Homo sapiens active BCR- related gene (ABR), transcript variant 1 GGTCCAAAGGCTTTTATTTTGCGCTCTGTAACTGCTGCCAGCTTCGCCTCTCTTGGCCCT A_73_102097 A_73_102097 FALSE XM_865420 XM_865420 LOC614081 ref|XM_865420 unmapped PREDICTED: Bos taurus similar to PDZ domain containing RING finger protein 4 (Ligand of Numb-protein X 4) (SEMACAP3-like protein) (LOC614081) TTGTGTTTTAGTATTGCAGTCAACGAGGATTCTCCCTTTCCCTTCTACTGGGATTGGAAG A_73_102098 A_73_102098 FALSE NW_930042 NW_930042 gb|Bovine miRNA bta- miR-487a on chr 21, (+) strand. Mature length 22 nt, stem-loop length 80 nt. Source: NW_930042.1:563863-563942 unmapped Unknown AATCATACAGGGACATCCAGTTTATCCTACTATACGTATCACATA A_73_102099 A_73_102099 FALSE XM_593154 XM_593154 LOC515180 ref|XM_593154 unmapped Bos taurus similar to Homo sapiens mitofusin 1 (MFN1), nuclear gene encoding mitochondrial protein AGATGAAAAAAGGAGTGTGAAGACAGTTAATCAGCTGGCCCACGCCCTTCATATGGACAA A_73_102100 A_73_102100 FALSE XM_607172 XM_607172 LOC528741 ref|XM_607172 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, KQT-like subfamily, member 4 (KCNQ4), transcript variant 1 GGACTCTTACTTGAACTCCCTCCCTCGTGGGGAGAGAGGCCACATGCAGTATTGAGCTGT A_73_102101 A_73_102101 FALSE XM_877411 XM_877411 LOC404171 ref|XM_877411 unmapped Bos taurus similar to Homo sapiens solute carrier family 12 (sodium/chloride transporters), member 3 (SLC12A3) CAGGACCTCAGACCTCCAGTCATCCTGATCCGAGGAAACCAGGAGAACGTGCTCACCTTT A_73_102102 A_73_102102 FALSE NW_930491 NW_930491 gb|Putative orthologue of human miRNA hsa-mir-146b on chr 10, (+) strand. Mature length 22 nt, stem-loop length 73 nt. Source: NW_930491.1:c75580-75507 unmapped Unknown TGAGAACTGAATTCCATAGGCTTATCCTACTATACGTATCACATA A_73_102103 A_73_102103 FALSE XM_872839 XM_872839 LOC533792 ref|XM_872839 unmapped Bos taurus similar to Homo sapiens neuro- oncological ventral antigen 1 (NOVA1), transcript variant 1 TTTGTCAGGCTTTTTGACAGGTCATTTCAGAGTAAGCCTTTGTTCCCAAGACCCAACAAC A_73_102104 A_73_102104 FALSE NM_001040510 NM_001040510 DSCR3 ref|NM_001040510 unmapped Bos taurus similar to Homo sapiens Down syndrome critical region gene 3 (DSCR3) GTCTTCCCCCGGCTATTCACCTGCCCGACGCTAGAGACCACCAACTTCAAAGTGGAGTTT A_73_102105 A_73_102105 FALSE NM_174594 NM_174594 RNASE6 ref|NM_174594 unmapped Bos taurus ribonuclease k6 (RNASE6) GTAAAGGAGGGTCCAGACCTCCATATTTTTAACCTTAGGAATTTGGCCAACGTTTGCTGT A_73_102106 A_73_102106 FALSE XM_607829 XM_607829 LOC529382 ref|XM_607829 unmapped Bos taurus similar to Homo sapiens calcium channel, voltage-dependent, gamma subunit 5 (CACNG5), transcript variant 1 CTCCCTGCAGATGAACAGCAGCTACCCGGCGCTGCTCAAGTGCCCAGACTACGACCAGAT A_73_102107 A_73_102107 FALSE XM_864867 XM_864867 LOC535714 ref|XM_864867 unmapped Bos taurus similar to Homo sapiens programmed cell death 8 (apoptosis-inducing factor) (PDCD8), nuclear gene encoding mitochondrial protein, transcript variant 1 CTCTGAATGTATGGGTATGAATGATCAAGTCCTTTGTGAATATTTCAACCATGTAGGCAA A_73_102108 A_73_102108 FALSE NM_173884 NM_173884 TH ref|NM_173884 unmapped Bos taurus tyrosine hydroxylase (TH) CGTCCTTGTCCTGCCTGCTCCCCCTGTGCTGCGCTGCCCGCTTGCAACCTGAATAAAAGA A_73_102109 A_73_102109 FALSE XM_863836 XM_863836 LOC514739 ref|XM_863836 unmapped Bos taurus similar to Homo sapiens microtubule-associated protein 1B (MAP1B), transcript variant 1 GCCCCCCAGGTATCTTCATATGCCTATGAGACTTCAGACCAGTGCTACACGGCAGAAAAG A_73_102110 A_73_102110 FALSE XM_588745 XM_588745 LOC511413 ref|XM_588745 unmapped Bos taurus similar to Homo sapiens zinc finger, FYVE domain containing 21 (ZFYVE21) ACTTTACAATAACTGTACAACAATTTGTATATAAAGCTTACGATTAAAACTTATTTGAAA A_73_102111 A_73_102111 FALSE BM251749 BM251749 gb|Bos taurus similar to Homo sapiens mitogen-activated protein kinase kinase 7 (MAP2K7) unmapped Unknown AGGCCGCCAGTATTGCCCCATCCCTTTTTAAAACAAAATGCCCTCGTTTGTAAATCCTTA A_73_102112 A_73_102112 FALSE NM_174109 NM_174109 MC2R ref|NM_174109 unmapped Bos taurus melanocortin 2 receptor (adrenocorticotropic hormone receptor) (MC2R) GCTCAATTCCACGTGAACAGCCTTGCTATAGGGTACAACTTCTATAGCTTAGAGAGGCAA A_73_102113 A_73_102113 FALSE XM_866035 XM_866035 LOC614502 ref|XM_866035 unmapped PREDICTED: Bos taurus similar to MICAL-like 2 (LOC614502) CTTAGAGGAACAACGCATCAGAGAGAAGGCCGAAGACCAGCACTTTGAAAGCTTCATATT A_73_102114 A_73_102114 FALSE NM_001040556 NM_001040556 AMID ref|NM_001040556 unmapped Bos taurus similar to Homo sapiens apoptosis- inducing factor (AIF)-like mitochondrion-associated inducer of death (AMID) AAGAGCCGGGACCTGTTGGTCTCCACGAGCTGGAAAACCATGAAACAGTCTCCACCCTGA A_73_102115 A_73_102115 FALSE CB449156 CB449156 gb|Bos taurus similar to Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type I, alpha (PIP5K1A) unmapped Unknown AGTGTCACTATTTGCCTCTACTTTGTATTGTTCAGAAATGGCAAATACAGTATAAAAGCG A_73_102116 A_73_102116 FALSE BI540366 BI540366 gb|Bos taurus similar to Homo sapiens catenin (cadherin-associated protein), delta 1 (CTNND1) unmapped Unknown GCCTTTCCTGTTTTTCTTTCTCTCTTGTTAATGCTTTAAAAACAAATGAGTTTTTATACA A_73_102117 A_73_102117 FALSE XM_587700 XM_587700 LOC539495 ref|XM_587700 unmapped Bos taurus similar to Homo sapiens chromosome 14 open reading frame 135 (C14orf135) ATTAGTTGGCCAATATTTGTGCCCTATGGATTGTGGTAGGCTTTGGTAAATATAAAACAT A_73_102118 A_73_102118 FALSE XM_585851 XM_585851 bMtCCA ref|XM_585851 unmapped Bos taurus similar to Homo sapiens tRNA nucleotidyl transferase, CCA- adding, 1 (TRNT1), transcript variant 1 CCCTAACTTCCTGGTAAGCTGAGAAAGCTTAGCTTAAGATTCTTGTGCCCATTATTTTAA A_73_102119 A_73_102119 FALSE NM_001034363 NM_001034363 MGC128854 ref|NM_001034363 unmapped Bos taurus similar to Homo sapiens RNA binding motif (RNP1, RRM) protein 3 (RBM3), transcript variant 1 CCACCTCTCCAAATGACTGTATTTATAAAGACTTTTGGAGCTGCACTGAAACATCTGTAA A_73_102120 A_73_102120 FALSE CB467921 CB467921 gb|Bos taurus similar to Homo sapiens beta-transducin repeat containing (BTRC), transcript variant 2 unmapped Unknown TGTGATTATGTCATGGTGATGTGTAGTCAATGTACCGATATGTTCACAACCTAGAATCAT A_73_102121 A_73_102121 FALSE BF040313 BF040313 gb|Bos taurus similar to Homo sapiens chromosome 14 open reading frame 172 (C14orf172) unmapped Unknown GCAGGCCCCATCCGCCACCTGGCTTCTCCACCCAGGAAGCGCCTCCTCCGAGGCCCCGGC A_73_102122 A_73_102122 FALSE XM_867810 XM_867810 LOC615887 ref|XM_867810 unmapped Bos taurus similar to PREDICTED: Homo sapiens mucin 6, gastric, transcript variant 1 (MUC6) ACAAGGGGACGTGCATGCCATGCACCTCTGAGAGTGTGGATGCACCAAACACCCACTCTC A_73_102123 A_73_102123 FALSE XM_591018 XM_591018 LOC513349 ref|XM_591018 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ20186 (FLJ20186), transcript variant 1 TATCTTGCTCATGAAGCCATATTTTATCACCTGCAGGGAGGCCATGGCAGCGCGCCTGCT A_73_102124 A_73_102124 FALSE XM_592881 XM_592881 LOC514958 ref|XM_592881 unmapped Bos taurus similar to Homo sapiens TH1-like (Drosophila) (TH1L), transcript variant 1 CCAAGAACATATAAAAGCTTTTCTGTGGTGGGAAGGCGTGGATCCCGATATCATGTTGTT A_73_102125 A_73_102125 FALSE XM_590964 XM_590964 LOC513302 ref|XM_590964 unmapped Bos taurus similar to Homo sapiens protocadherin alpha subfamily C, 1 (PCDHAC1), transcript variant 2 TGTCTCCAGATTCGGAATAGGAAAGGGGATCACGCAAATGTCAATGCCATGGTAAGCATA A_73_102126 A_73_102126 FALSE XM_588124 XM_588124 LOC510899 ref|XM_588124 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein S16 (MRPS16), nuclear gene encoding mitochondrial protein GCAGAACACTTAGTTTTATTATTTAGAGGTCAATAAATGGAATTTTTTAAGTACTCCCCA A_73_102127 A_73_102127 FALSE XM_594105 XM_594105 LOC540448 ref|XM_594105 unmapped Bos taurus similar to PREDICTED: Homo sapiens hephaestin-like 1 (HEPHL1) ATGGAGACAACCTACACAGTCCTTCGAAACATAGACAACAGGATTCCATACTCCACCAAG A_73_102128 A_73_102128 FALSE NM_001034324 NM_001034324 MGC127807 ref|NM_001034324 unmapped Bos taurus similar to Homo sapiens RNA binding motif protein 18 (RBM18) GGATTTGTAACTCCAGAAACATTATATAGTGTGCCAGAAAGAAAGGCAAAGACAAAGAAC A_73_102129 A_73_102129 FALSE BF776183 BF776183 gb|Unidentified transcripts on BTA17 position 28311038-28312166 unmapped Unknown GAAAGCTACTTAGGCCTCAATGCTAGTCAACTCCTGCGTCACTTCATAATGGCTGCAAAT A_73_102130 A_73_102130 FALSE BF774014 BF774014 gb|Unidentified transcripts on BTA23 position 17043365-17044014 unmapped Unknown CCGTTTATCTTCTGGTGTGTGTATCATTAAGCTAATTGTCTTCCCCAACTAAGGAATCAT A_73_102131 A_73_102131 FALSE NM_001015650 NM_001015650 DHODH ref|NM_001015650 unmapped Bos taurus dihydroorotate dehydrogenase (DHODH) ACAGTCCAGGATCCTTAAATATTACAGGGACAGTAGACATTTGGAGGGAAAATCGTGGTA A_73_102132 A_73_102132 FALSE XM_584631 XM_584631 LOC507932 ref|XM_584631 unmapped Bos taurus similar to Homo sapiens COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) (COPS3) ATTAAATTACCATGCATGTGAGCCATAGGATGCATTCTGAATTAAAGAGACCCTTTTAGT A_73_102133 A_73_102133 FALSE XM_591527 XM_591527 LOC513782 ref|XM_591527 unmapped Bos taurus similar to Homo sapiens PRP40 pre- mRNA processing factor 40 homolog B (S. cerevisiae) (PRPF40B), transcript variant 2 CACCACCCCTGGGGCCCAGCGTATGTGTGTTTTGTTTTGGGTTTGTTTTTTAAATGACAA A_73_102134 A_73_102134 FALSE NM_174501 NM_174501 ALOX15 ref|NM_174501 unmapped Bos taurus arachidonate 15-lipoxygenase (ALOX15) GGTATCTGGCCTCAGTGTTTTTCCCAAAGGATCCTTATCTGTAACCCATTTGCACTTCAT A_73_102135 A_73_102135 FALSE XM_881561 XM_881561 LOC616344 ref|XM_881561 unmapped Bos taurus similar to Homo sapiens phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1) GGGGCTGGGAAACAGAATGTATACTGCATGTTTGTTTCTCCTTTTGGGTGACAATGACAG A_73_102136 A_73_102136 FALSE CB422527 CB422527 gb|Unidentified transcripts on BTA19 position 7035300-7035938 unmapped Unknown CCTACTGTATTAGTCCCAGCTTCCAAAGTATTAAAAAATGACTTGTTTCTTCCCCCAAAA A_73_102137 A_73_102137 FALSE XM_872090 XM_872090 LOC513509 ref|XM_872090 unmapped Bos taurus similar to Homo sapiens stannin (SNN) CTGTTTTTTGTCTCAAAGCTACCAAGTTTGTGCAATAAGTGGAGGGGATGTCACCCCTGT A_73_102138 A_73_102138 FALSE XM_591015 XM_591015 LOC513346 ref|XM_591015 unmapped Bos taurus similar to Homo sapiens protocadherin 8 (PCDH8), transcript variant 1 CATTTGGTTTTCTGTAAACCGTGTCACTTATAAGCACAGTAATAAAGGATTTGTCATGTG A_73_102139 A_73_102139 FALSE XM_584502 XM_584502 LOC507819 ref|XM_584502 unmapped Bos taurus similar to Homo sapiens KIAA1840 (KIAA1840) CTACTCATCAAGCACCTACAAAGCTTTCTCAGTATATAGAACTCTCGTCCCAAGAGCTTT A_73_102140 A_73_102140 FALSE XM_584022 XM_584022 LOC507424 ref|XM_584022 unmapped Bos taurus similar to Homo sapiens ferric- chelate reductase 1 (FRRS1) CTTTCTTAGCAGTGAAATGCACATGTGCATCTTTTGATTGCGTGTCTTCATATATTTAGC A_73_102141 A_73_102141 FALSE XM_590116 XM_590116 LOC512578 ref|XM_590116 unmapped Bos taurus similar to Homo sapiens potassium channel tetramerisation domain containing 15 (KCTD15) AGATGCTGATGTACAATTGTCGTGTGTTTGTGTAAACACATTATGTTCCTAGTTCATGCC A_73_102142 A_73_102142 FALSE XM_883066 XM_883066 LOC513998 ref|XM_883066 unmapped Bos taurus similar to PREDICTED: Homo sapiens Fas (TNFRSF6) binding factor 1, transcript variant 1 (FBF1) GGCCCTGGGCTCTGCCTTGACCGTCCTGACAGTGGTCTTATCCCATTTGGCAACAAAATG A_73_102143 A_73_102143 FALSE NM_001034332 NM_001034332 MGC128175 ref|NM_001034332 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 54, member B (FAM54B) GTCAGCCCTTTTCAGGGAGATGTTTAAACATATATAATCCTAAAGTACTGTAAAGTTACC A_73_102144 A_73_102144 FALSE EE891206 EE891206 gb|Bos taurus similar to Homo sapiens calcium channel, voltage-dependent, alpha 2/delta subunit 2 (CACNA2D2), transcript variant 2 unmapped Unknown TGAGACCATAGAGAAGTTGCTGGAACAAAGACCAGGCTGCAGCAGACGTCCACCAGGCTA A_73_102145 A_73_102145 FALSE XM_867945 XM_867945 LOC615997 ref|XM_867945 unmapped PREDICTED: Bos taurus similar to TSPY-like 5 (LOC615997) AGCTGGACTTAACTGCATCTTGAGCACCAGCATAATGATAAGCGTGGACATTACAGTCAA A_73_102146 A_73_102146 FALSE CB418353 CB418353 gb|Bos taurus similar to Homo sapiens adducin 2 (beta) (ADD2), transcript variant beta-1 unmapped Unknown AGGAAGGGAGGGGCAGATTGCTTTAGGATGCTGATCAGGCGCTCGGGTCTAGCCTATTGT A_73_102147 A_73_102147 FALSE NM_173915 NM_173915 GAS ref|NM_173915 unmapped Bos taurus gastrin (GAS) TGAGAACAAGCTTTGGAGCCCAGTCACCTCCCAGCCCAGCCCAGCCCCATGAAACACACA A_73_102148 A_73_102148 FALSE XM_879112 XM_879112 LOC505547 ref|XM_879112 unmapped Bos taurus similar to Homo sapiens PRP39 pre- mRNA processing factor 39 homolog (S. cerevisiae) (PRPF39) AACTATGTTGTTTCAGGAGACTTTGTATTTGGAATAGTCATGTTAAACTTGTGAGCAAGC A_73_102149 A_73_102149 FALSE XM_868044 XM_868044 LOC616077 ref|XM_868044 unmapped Bos taurus similar to Homo sapiens chromosome 2 open reading frame 34 (C2orf34) CATGACATGCTTGGCTGGGCTCATGGTTGCTATTTCTGCAGATGTCAAAGAAGTTCTGTT A_73_102150 A_73_102150 FALSE XM_868312 XM_868312 LOC534206 ref|XM_868312 unmapped Bos taurus similar to Homo sapiens tubulin, beta 6 (TUBB6) AGGAAGAGGTCAACGAGTAGAGGCATGTCCTGCCTTGGACACCGAGGCTCAGAGGTCTTT A_73_102151 A_73_102151 FALSE XM_871544 XM_871544 LOC511202 ref|XM_871544 unmapped Bos taurus similar to Homo sapiens SECIS binding protein 2 (SECISBP2) GGTTTCTTAGAGGCCGAAGGATAGAAGTTTACTTTCATATTATCCTGTAAGTAAGAGGGC A_73_102152 A_73_102152 FALSE XM_588255 XM_588255 LOC511011 ref|XM_588255 unmapped Bos taurus similar to Homo sapiens chromosome X open reading frame 26 (CXorf26) ACTGAACTGTTCGCAGGGCTACACTGAAGAAAACACCATCTTTGCACCCAGGATACAATT A_73_102153 A_73_102153 FALSE NM_174633 NM_174633 CLECSF1 ref|NM_174633 unmapped Bos taurus domain) lectin, superfamily member 1(cartilage-derived) (CLECSF1) CGTATGTATCTGAGTGATGAGGTGCTACATAATCCAAAACCTTTTCAGTCTGATGCTCGG A_73_102154 A_73_102154 FALSE XM_587423 XM_587423 LOC510296 ref|XM_587423 unmapped Bos taurus similar to Homo sapiens LIM homeobox transcription factor 1, alpha (LMX1A), transcript variant 1 CCAGAGTGGGAAACCCCATTGATCATCTGTACTCCATGCAGAATTCTTACTTCACCTCTT A_73_102155 A_73_102155 FALSE XM_588288 XM_588288 LOC511035 ref|XM_588288 unmapped Bos taurus similar to Homo sapiens chromosome 10 open reading frame 61 (C10orf61), transcript variant 1 GAAGGCTCTCAAAAAGGCTCCATCTTTCCCATTATTATCCTGTGTCTCCTATTGCTTGGA A_73_102156 A_73_102156 FALSE XM_582186 XM_582186 LOC538713 ref|XM_582186 unmapped PREDICTED: Bos taurus similar to F54C1.5a (LOC538713) ACCCTGGAAGAAGAAAGAATGCATATTGGAAAGAATACAGTCACATATGAATCCAGAGAG A_73_102157 A_73_102157 FALSE XM_593609 XM_593609 LOC515570 ref|XM_593609 unmapped Bos taurus similar to Homo sapiens NODAL modulator 2 (NOMO2), transcript variant 2 GAAACCGCACAGCCTGTGTGTACTCCTAGGAGGGTGTGTTATGTGGTAAAAAGTCAATAA A_73_102158 A_73_102158 FALSE AW463563 AW463563 gb|Bos taurus similar to Homo sapiens DNA segment on chromosome X and Y (unique) 155 expressed sequence, isoform 1 (DXYS155E) unmapped Unknown AAGCGACTGGATCAACAGTTTGATGGGAAACCGAAGCTCGTGATCACGAGCCCGACGCAC A_73_102159 A_73_102159 FALSE XM_591087 XM_591087 LOC540032 ref|XM_591087 unmapped Bos taurus similar to Homo sapiens monad (LOC116143) TAAAATACCAAAGTGACATGGTCATCAGTTTTCAGCGATTTAACTCAGAATGAAATGCTG A_73_102160 A_73_102160 FALSE NM_001034498 NM_001034498 TIMM22 ref|NM_001034498 unmapped Bos taurus similar to Homo sapiens translocase of inner mitochondrial membrane 22 homolog (yeast) (TIMM22) CGACCGGTCGTGTCCTTTTGTTGAGTGCCCTGCTATCCTTGTTATATAGATGTATGTGTA A_73_102161 A_73_102161 FALSE XM_600972 XM_600972 LOC522687 ref|XM_600972 unmapped PREDICTED: Bos taurus similar to Bone morphogenetic protein 6 precursor (BMP-6) (VG-1-related protein) (VGR-1) (LOC522687) ACTGTGACAAAAAAGTCCGGCCCGAGTGGGGCCAGCTGGGACGGAGATGGCGCTTCAACA A_73_102162 A_73_102162 FALSE XM_615972 XM_615972 LOC535858 ref|XM_615972 unmapped PREDICTED: Bos taurus similar to vasoactive intestinal peptide receptor 1 (LOC535858) CTGAAGTGAAACTGGTCTTTGAGCTCGTCGTGGGTTCTTTCCAGGGTTTCGTGGTGGCCA A_73_102163 A_73_102163 FALSE XM_601672 XM_601672 LOC523375 ref|XM_601672 unmapped PREDICTED: Bos taurus similar to nanos homolog 3 (LOC523375) CTCAGGCACCCCTGCCCTTCTTCCCCAACGCTGAGCAACCAGTCAGCGCTCAATAAATGT A_73_102164 A_73_102164 FALSE XM_614102 XM_614102 LOC534354 ref|XM_614102 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to mitochondrial translational release factor 1-like (LOC285442) AGCAAATCAGGTTGTGTATATACAGTATTCTCTTGAAACACATGAGTTAACACAGTTGAG A_73_102165 A_73_102165 FALSE XM_604131 XM_604131 LOC525775 ref|XM_604131 unmapped PREDICTED: Bos taurus similar to trace-amine- associated receptor 7a (LOC525775) TACTTTGGGCAGCGTTACTGTCAACTCCACTCCTGTTTTGAAGGCTCATTCTGTTACACT A_73_102166 A_73_102166 FALSE CB424500 CB424500 gb|Unidentified transcripts unmapped Unknown GGTCACAGGGTATAACAGTTTGATAGGAAAAGGTCATCTGACTTTAGTCAAAAATGCTTT A_73_102167 A_73_102167 FALSE NM_001034783 NM_001034783 MGC127804 ref|NM_001034783 unmapped Bos taurus similar to Homo sapiens ribosomal protein L32 (RPL32), transcript variant 1 TTGGAACGTATGTTTAGGAGTCAAGTCCACGGAGTCAGTTCACAGAGTGAATTCCACACT A_73_102168 A_73_102168 FALSE BF889660 BF889660 gb|Bos taurus similar to Homo sapiens KIAA1576 protein (KIAA1576) unmapped Unknown GTCTAATGTATTTGTGGCTTTAGAGCTTTCGTTATATTGTGCCTACAAAGCAAATCATGT A_73_102169 A_73_102169 FALSE XM_607091 XM_607091 LOC528661 ref|XM_607091 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 105 (CCDC105) GCGCAAGAAGCTCACCTGGAGCTTCAACTGCAAGAAGATCGGGCACAATGTAGACTACAG A_73_102170 A_73_102170 FALSE XM_591568 XM_591568 LOC540111 ref|XM_591568 unmapped Bos taurus similar to Homo sapiens nucleoporin 160kDa (NUP160) TGTGGACCTTATGACTCACAATTACTATGAGCTTCTGTATGCCTTTCACATCTATCGTCA A_73_102171 A_73_102171 FALSE XM_590867 XM_590867 LOC513215 ref|XM_590867 unmapped PREDICTED: Bos taurus similar to centromere protein E (LOC513215) TTTTGAGCCAAAGCAAGAATTTTTGAATCTTCCCAGATCCCAAGGAATTAGAGTAGTTTA A_73_102172 A_73_102172 FALSE XM_587713 XM_587713 LOC510558 ref|XM_587713 unmapped Bos taurus similar to Homo sapiens asteroid homolog 1 (Drosophila) (ASTE1) AACATCAATTGTTAATGCAGTAGAACTACCCAAGGATCATTCTGACTTAAGCAAATTGAC A_73_102173 A_73_102173 FALSE XM_592814 XM_592814 LOC514898 ref|XM_592814 unmapped Bos taurus similar to Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1 (P2RX1) TATTACAAGCAGAAGAAGTTCAAGTACGCGGAAGACATGGGCCCAGGGGCGGGACAGCAT A_73_102174 A_73_102174 FALSE XM_610544 XM_610544 LOC532036 ref|XM_610544 unmapped PREDICTED: Bos taurus similar to zinc finger and SCAN domain containing 5 (LOC532036) TATAGGATCAAGCCCTACGTGTGCCCCGAGTCCCAATTGCCTTCTGTCAGCTGGGGACTT A_73_102175 A_73_102175 FALSE XM_603462 XM_603462 LOC525116 ref|XM_603462 unmapped Bos taurus similar to Homo sapiens Rap2-binding protein 9 (RPIB9) ATGTAAAAGCCAGAAGTTTTTATGTTGCAAATATTCCATATACGTAAGTCTGACTGCTGG A_73_102176 A_73_102176 FALSE NM_001035387 NM_001035387 TTLL3 ref|NM_001035387 unmapped Bos taurus similar to Homo sapiens tubulin tyrosine ligase-like family, member 3 (TTLL3), transcript variant 2 CACAAGGGACAGGTGGCCACAGAAGCCCTTGCTTCCATCACCATCACCCTTATCCTGGAT A_73_102177 A_73_102177 FALSE AW445723 AW445723 gb|Unidentified transcripts on BTA19 position 28476007-28476770 unmapped Unknown GTGGGTTTACGAATAGCTGTTTTTGGAAAACAGTGACAGCTTTTTATTGTCACTTCCACA A_73_102178 A_73_102178 FALSE NM_182989 NM_182989 PEMT ref|NM_182989 unmapped Bos taurus phosphatidylethanolamine N-methyltransferase (PEMT) TTCACTGCCGAAATCTATCAGCAGAAAGCCTCCCAGGCCTACAAGAGGAGCTGACGGCCA A_73_102179 A_73_102179 FALSE BM365832 BM365832 gb|Bos taurus similar to PREDICTED: Homo sapiens hypothetical LOC388789 (LOC388789) unmapped Unknown TGGTTCAGCATATACATTTGAGAGATACCTTGATTTCCACTTTCCATTTGTGAAAAGTGA A_73_102180 A_73_102180 FALSE XM_873692 XM_873692 LOC613826 ref|XM_873692 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 137B (GPR137B) TTAGATCGATAAAATCTTATTTTAGTACTAAAAAGTGAGCCTGGCTGCCTATTCCATGAG A_73_102181 A_73_102181 FALSE XM_584571 XM_584571 LOC507880 ref|XM_584571 unmapped Bos taurus similar to Homo sapiens SEC31-like 2 (S. cerevisiae) (SEC31L2) TGGCTGCACTTTCATGGTTGGACTCTGCACTGAAGCCCTGATGTACTTTATGTGCAATAA A_73_102182 A_73_102182 FALSE XM_587940 XM_587940 LOC539534 ref|XM_587940 unmapped Bos taurus similar to Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6 (EDG6) TTTTCGGCCTGCTGCTGGCCGATATCTTCGGCTCCAACGTCTGGGCGCAGGAGTACCTGA A_73_102183 A_73_102183 FALSE XM_866425 XM_866425 LOC505719 ref|XM_866425 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 63, member A (FAM63A), transcript variant 1 TTTGTTTCAGGGTTTGATTTGGGTTTCTATCTCTATTATTTTTAATGCCTTCCTAGGGGT A_73_102184 A_73_102184 FALSE BF074022 BF074022 gb|Bos taurus similar to Homo sapiens neuronal growth regulator 1 (NEGR1) unmapped Unknown GTACAAAAATGCTCCAAAATATAACAAATATTCCATCCTAGTATGCAGCAGATCAATCCC A_73_102185 A_73_102185 FALSE BI776151 BI776151 gb|Unidentified transcripts on BTA19 position 34511714-34510915 unmapped Unknown CTGTTATGTGCGATTTTTCACCCCGTTGTGTTTTGGGTCAGGATTTAAAGAAAGATATTT A_73_102186 A_73_102186 FALSE XM_581365 XM_581365 LOC505124 ref|XM_581365 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ12681 (FLJ12681) GTCCCGGCAGTGGCCGTACCCGGAGCCCGAGTAGAGGCGGCCAGGGCTCGTGGCAGGAAA A_73_102187 A_73_102187 FALSE XM_582157 XM_582157 LOC505806 ref|XM_582157 unmapped PREDICTED: Bos taurus similar to inositol polyphosphate kinase 1 (LOC505806), partial mRNA. AGTTTTTGGGTGAGAACTATGTTCATTGTGGGCTGAGAAGCATGGGATTCCGAGACACTT A_73_102188 A_73_102188 FALSE CB437955 CB437955 gb|Bos taurus similar to Homo sapiens SMAD, mothers against DPP homolog 7 (Drosophila) (SMAD7) unmapped Unknown TTCTATGGGTGTTATCACCTGGCTGAATGTTTTTCTAAAGGAGTTTATGTTCCATTAAAC A_73_102189 A_73_102189 FALSE CB449025 CB449025 gb|Unidentified transcripts unmapped Unknown CATGAATCCTTGGGGGTTTATCACACTACTCCTTCTACTTCTGTGTATGTTTGAAAATTT A_73_102190 A_73_102190 FALSE NM_174403 NM_174403 NR5A1 ref|NM_174403 unmapped Bos taurus nuclear receptor subfamily 5, group A, member 1 (NR5A1) AGGATAACAGAGTTTGCAAACTTAGGCAAGGGGACTGTTGGGCCCTGGAGGACACTGGGA A_73_102191 A_73_102191 FALSE NW_928220 NW_928220 gb|Putative orthologue of human miRNA hsa-mir-146a on chr 5, (+) strand. Mature length 22 nt, stem-loop length 99 nt. Source: NW_928220.1:1009311-1009404 unmapped Unknown TGAGAACTGAATTCCATGGGTTTATCCTACTATACGTATCACATA A_73_102192 A_73_102192 FALSE CB421939 CB421939 gb|Bos taurus similar to Homo sapiens TIP41, TOR signalling pathway regulator-like (S. cerevisiae) (TIPRL), transcript variant 1 unmapped Unknown TCCAAGTGTCTTTTTGTAAGAGGAGAATAAACAATAAGTAATTGCCGATCTGTGTTTTGC A_73_102193 A_73_102193 FALSE XM_869704 XM_869704 LOC617442 ref|XM_869704 unmapped Bos taurus similar to Homo sapiens ecotropic viral integration site 2B (EVI2B) ATACAACCAACACCAACTGTCAAAAGTTCACCTAGGAAGACACCAGGATTCAACTTCGAA A_73_102194 A_73_102194 FALSE CB441493 CB441493 gb|Bos taurus similar to Homo sapiens serine arginine-rich pre-mRNA splicing factor SR-A1 (SR-A1) unmapped Unknown CCCAGACCCTTTGTTCGTGCCCCTCCCTCAGTTTCATTAAAGGTTTCATGAAATGTCAAA A_73_102195 A_73_102195 FALSE XM_870762 XM_870762 LOC618432 ref|XM_870762 unmapped PREDICTED: Bos taurus similar to leucine rich repeat containing 3 (LOC618432) TAAAGATCCAAGTGAACCTGTCTGCCAACCCGTGGCGCTGTGACTGTGCCCTCCAGGAGG A_73_102196 A_73_102196 FALSE XM_595843 XM_595843 LOC517669 ref|XM_595843 unmapped Bos taurus similar to Homo sapiens zinc finger protein 638 (ZNF638), transcript variant 1 ACTGATGGGGAAAGTATGATGGGTTTGATTTTTATATCAAATCATCAGGCATGGAGAAAT A_73_102197 A_73_102197 FALSE XM_597764 XM_597764 LOC519541 ref|XM_597764 unmapped Bos taurus similar to Homo sapiens ring finger protein 125 (RNF125) CGATTAGCATTGAAGTTACTTTTAAAGGTCACTAAGAGAGTCATCCTTTTATTCAACTGC A_73_102198 A_73_102198 FALSE NM_001038036 NM_001038036 EHF ref|NM_001038036 unmapped Bos taurus similar to Homo sapiens ets homologous factor (EHF) ATCAGAGGGCATTAAATGTTTTTATATGCAAAATGATTTAGGAAAAGGTGACGTGTCCTC A_73_102199 A_73_102199 FALSE CB430326 CB430326 gb|Unidentified transcripts on BTA28 position 956641-957079 unmapped Unknown AGGACCACTGTCTTTTGCCCTTTATATGTTCTTCCTTTAGGATCATTTCAGGCCTTATGT A_73_102200 A_73_102200 FALSE XM_870523 XM_870523 LOC618198 ref|XM_870523 unmapped Bos taurus similar to Homo sapiens syndecan 3 (N-syndecan) (SDC3) TTTAACACTTCCCGTGCTGTGCCCATTTATAAGAGGAAATAAAATTAAGCTGAAATGATG A_73_102201 A_73_102201 FALSE XM_585641 XM_585641 LOC508809 ref|XM_585641 unmapped Bos taurus similar to Homo sapiens dihydrofolate reductase (DHFR) GCAACTTATGTATCAACTCAAAAGTGTTTAATAAATGTTAATGTGTGGGGGAAAGCATGC A_73_102202 A_73_102202 FALSE XM_867430 XM_867430 LOC615582 ref|XM_867430 unmapped Bos taurus similar to Homo sapiens gamma- glutamyltransferase 1 (GGT1), transcript variant 1 GCTGCACAATCAGCTTCTGCCCAACACCACGGTGCTGGAGAAAGGCATCGACCAGGCGGT A_73_102203 A_73_102203 FALSE CB447757 CB447757 gb|Bos taurus similar to Homo sapiens caspase recruitment domain family, member 6 (CARD6) unmapped Unknown GCATGACACAGGAAACAAGATATACACAGCACAACTGGATATTATAAAAATATCTGTGAG A_73_102204 A_73_102204 FALSE XM_610842 XM_610842 LOC532330 ref|XM_610842 unmapped PREDICTED: Bos taurus similar to insulin receptor substrate 3 (LOC532330) GGAGTACGTATGCATTGAGTATGCGGCTGCGGACTACATAGGAATGGGCACTGCCAACCC A_73_102205 A_73_102205 FALSE XM_581561 XM_581561 LOC505295 ref|XM_581561 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 1, subfamily L, member 3 (OR1L3) AAGGCATGAAACAGGGCTTAGAGAAATTGATAAGCAGGATGAAGTTTCAAACGAATAGGC A_73_102206 A_73_102206 FALSE NM_174533 NM_174533 DNAJC5 ref|NM_174533 unmapped Bos taurus DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5) AGGAGAACGTGAACACCTACTTTGTGCTCTCCAGCTGGTGGGCCAAGGCCCTGTTCATCT A_73_102207 A_73_102207 FALSE XM_870453 XM_870453 LOC514186 ref|XM_870453 unmapped Bos taurus similar to Homo sapiens desmuslin (DMN), transcript variant A TCATCTAAAAAGCTGATCTTGCTAACCTGTTCCTGTTCCCTTTGAAGGGATATATCATAA A_73_102208 A_73_102208 FALSE CB453664 CB453664 gb|Unidentified transcripts on BTA4 position 65259713-65258426 unmapped Unknown TCCTTTCCCTCCACAGTCTTCTCACCATGTAGAAATCCAGTCCGGGTCTAAATTAGAATT A_73_102209 A_73_102209 FALSE BF604728 BF604728 gb|Unidentified transcripts on BTA16 position 41294192-41295170 unmapped Unknown AGGCCAGCTGTCCTTTGCTATGGAGCGGCCAACAGAGTGTGGGGTTTATAAGCTGGTCTC A_73_102210 A_73_102210 FALSE AW307682 AW307682 gb|Unidentified transcripts on BTA26 position 8562282-8560170 unmapped Unknown CTGGAGGCTGTGTGGGAGGGATTTCTCTAACATTGACATCTATTCCATGAGCTTTTCCTA A_73_102211 A_73_102211 FALSE XM_606825 XM_606825 LOC528403 ref|XM_606825 unmapped Bos taurus similar to Homo sapiens ankyrin repeat and FYVE domain containing 1 (ANKFY1), transcript variant 1 TCGGGTGGTTTGATTCTGTCACTGGAAAGTAAGGCAATTATGCTTCAGTTATGAATCGAG A_73_102212 A_73_102212 FALSE XM_867585 XM_867585 LOC615709 ref|XM_867585 unmapped PREDICTED: Bos taurus similar to transcription factor B1, mitochondrial (LOC615709), partial mRNA. TGTTGACTTTTCAAAAGGAAGTGGCAGAGAGACTTACAGCTACTACTGGAAGCAAACAGC A_73_102213 A_73_102213 FALSE CB166941 CB166941 gb|Unidentified transcripts unmapped Unknown TGGCATTGGATTTTGGCCTGTGGACCTACTGAATTTGAAATACCCTGTAAGGAAGGCAAA A_73_102214 A_73_102214 FALSE XM_592089 XM_592089 LOC514264 ref|XM_592089 unmapped PREDICTED: Bos taurus similar to zinc finger protein 258 (LOC514264) CAAAAGGCCCAGTTTATAATGTAATAGCTAACACACTTGGATGTTGAAACTGCTTGGCCT A_73_102215 A_73_102215 FALSE XM_584836 XM_584836 LOC539099 ref|XM_584836 unmapped Bos taurus similar to Homo sapiens homeobox containing 1 (HMBOX1) AGCTGTGTGACTGAGTAGATAAAATACTGCCTTCTGCCTTTGGGACCATGATTAAACAGA A_73_102216 A_73_102216 FALSE XM_612841 XM_612841 LOC533437 ref|XM_612841 unmapped Bos taurus similar to Homo sapiens transcription factor B1, mitochondrial (TFB1M) TATCAAGTGTCATAAGGGCTAGGATTCTTATTTTGCTAATGAATAAATTTAAAAGTTAGT A_73_102217 A_73_102217 FALSE XM_871246 XM_871246 LOC618933 ref|XM_871246 unmapped Bos taurus similar to Homo sapiens opiate receptor-like 1 (OPRL1), transcript variant 2 AGCGAGAGGCTGGGAGGACCAGAGCCACTACAACTGTGGCGTTTTCTCACCAATGCTGAA A_73_102218 A_73_102218 FALSE XM_616527 XM_616527 LOC536398 ref|XM_616527 unmapped PREDICTED: Bos taurus similar to UDP- glucuronosyltransferase 2B15 precursor (UDPGT) (UDPGTh-3) (HLUG4) (LOC536398) TTCCTTCTCATAAAAGGTTGCTTGCTTTGCTATCAAAAGTTTGTTAAGACAGGAAAGAAG A_73_102219 A_73_102219 FALSE XM_869015 XM_869015 LOC616884 ref|XM_869015 unmapped PREDICTED: Bos taurus similar to kinesin family member 25 isoform 1 (LOC616884) TCGGAGGTGATGCAAAGTTACAGGTGATCGTGTGCGTGTCCCCAGGCCAGAGGCACGTGG A_73_102220 A_73_102220 FALSE XM_587069 XM_587069 LOC509991 ref|XM_587069 unmapped Bos taurus similar to Homo sapiens homeobox A3 (HOXA3), transcript variant 1 TCTGGCGGCGGCCGCTCTGGAAACGCCGAGCTGCCAGCCCGCTGGGCTGCCCGTTTCCCA A_73_102221 A_73_102221 FALSE EE911668 EE911668 gb|Unidentified transcripts on BTA19 position 40084937-40085499 unmapped Unknown TTCTAGTTTTGAGGGCACATGTTTTGTCTTTCTTGTATTATTATCCTCATGAGGTTTTGG A_73_102222 A_73_102222 FALSE EE899511 EE899511 gb|Unidentified transcripts unmapped Unknown ATTTTGGTCAGTTTTACCAGATATGGGATGATTACATGTGGGTTACTCCAGAAAAAGGAC A_73_102223 A_73_102223 FALSE XM_870414 XM_870414 LOC618086 ref|XM_870414 unmapped PREDICTED: Bos taurus similar to transmembrane protein 7 (LOC618086) TTATAATCATCATCGTAGCTGTAATTGTGGTAGCAGTCACTATCAGAGCCTCAAAAGCTT A_73_102224 A_73_102224 FALSE XM_866627 XM_866627 LOC614961 ref|XM_866627 unmapped PREDICTED: Bos taurus similar to related RAS viral (r-ras) oncogene homolog 2 (predicted) (LOC614961) AAGGCTCCGAGTTTGCTGCGGGGACTCTCCGGTCTCCTGGCAGACAGGATAGCAGTGGTA A_73_102225 A_73_102225 FALSE XM_583320 XM_583320 LOC538858 ref|XM_583320 unmapped Bos taurus similar to Homo sapiens leucine rich repeat containing 21 (LRRC21) CCTCAGTGAGGCCGACAGACTCCTCTCTGCTCGCTCCAGCCTGGACTCTCAGGCCGTGGG A_73_102226 A_73_102226 FALSE XM_581398 XM_581398 LOC505154 ref|XM_581398 unmapped PREDICTED: Bos taurus similar to Loricrin (LOC505154) TCCCTAGTTTCTGTACAACTACCTCCTAATTCCAGTACCTTCTCAGTCAATAAATTTGCA A_73_102227 A_73_102227 FALSE CB452508 CB452508 gb|Unidentified transcripts on BTA19 position 41556267-41555147 unmapped Unknown TCTGTCAGCTGTGGGCTTCCAAACAGCTGTACTTCAATTACTTGAAAAGGTTGATTGAAG A_73_102228 A_73_102228 FALSE XM_604267 XM_604267 LOC525908 ref|XM_604267 unmapped Bos taurus similar to Homo sapiens low density lipoprotein receptor class A domain containing 3 (LDLRAD3) AGCCTGGCCCGCAGGAGGGCACCGCTGAGCCCAGGGACTCCGCGCCCAGCCAGGGCACTG A_73_102229 A_73_102229 FALSE XM_585092 XM_585092 LOC508330 ref|XM_585092 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ11783 (FLJ11783) AACCAAAGGCCTCATACATGACAAAAAGACTGAACCGTTCAGGTTACTTGCATGGAGTTG A_73_102230 A_73_102230 FALSE XM_868335 XM_868335 LOC616339 ref|XM_868335 unmapped Bos taurus similar to Homo sapiens RNA binding motif protein 21 (RBM21) AGGTTTTCCTCCCTCAAGCACTTCGAAACCTGCTTAAGTGAAGATGGGAACCCTGAAAGG A_73_102231 A_73_102231 FALSE BF600598 BF600598 gb|Bos taurus similar to Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G (SEMA3G) unmapped Unknown AGATGGGTATCAGAGGAAGGAAGAAGTCAGAGGGCTTTGCTTATGAAGCTGAGATTGCTT A_73_102232 A_73_102232 FALSE NM_001034497 NM_001034497 MGC127606 ref|NM_001034497 unmapped Bos taurus similar to solute carrier family 25, member 35 (MGC127606) CATGTCTGCAAAGAGCTGCTCCCAAGGCGCAGCCCTACTGCACACTCCAAACCAATAAAG A_73_102233 A_73_102233 FALSE XM_611787 XM_611787 OVGP1 ref|XM_611787 unmapped PREDICTED: Bos taurus oviduct specific glycoprotein (OVGP1) ATTCATGCATCATTCTGGGGGCAAACAGGCCCCAGGTCATAATGAGTTAATCTCTTCTCT A_73_102234 A_73_102234 FALSE XM_613496 XM_613496 LOC533929 ref|XM_613496 unmapped Bos taurus similar to Homo sapiens fibroblast growth factor 18 (FGF18) CCAGAGGAGGACTTGAATGAGGAAAACGACACTCTGAGAAACCAAAGTCCTTTTTCCCAA A_73_102235 A_73_102235 FALSE CB455414 CB455414 gb|Unidentified transcripts on BTA3 position 76947909-76947041 unmapped Unknown TGTCTAGACTGTGAAGAGTTTTACTCTGGTTTATCAGTGATTAGTATATTTCCGAAACTG A_73_102236 A_73_102236 FALSE NM_001035444 NM_001035444 MGC127795 ref|NM_001035444 unmapped Bos taurus similar to Homo sapiens hypothetical protein LOC348180, isoform 1 (LOC348180), transcript variant 2 GCAGGCAAGGCTGGGCAGTCGGCATGTGATTGCCCCTTTGTATAAATAAAAACGTTTTAA A_73_102237 A_73_102237 FALSE CB437497 CB437497 gb|Unidentified transcripts on BTA20 position 25338283-25338788 unmapped Unknown ACATTTTTCTAGCTTCTCTTCACATTCATTGCCTCCCTTTGTTTCTACGGCCCGGAAAAA A_73_102238 A_73_102238 FALSE XM_876130 XM_876130 LOC506562 ref|XM_876130 unmapped Bos taurus similar to Homo sapiens basic leucine zipper and W2 domains 1 (BZW1) TCTCAGAAGGCAATGATTTGTGTGATAATTTGATATGCCCAAAGCCCTGCTCATCAATGA A_73_102239 A_73_102239 FALSE AW427787 AW427787 gb|Unidentified transcripts on BTA15 position 2483868-2484612 unmapped Unknown ACTTTCTTCCTTCAAGGAGATTTGTATACAGAGAGAGTTTTGGTTTAGAATTAAGGTGTG A_73_102240 A_73_102240 FALSE XM_868253 XM_868253 LOC616273 ref|XM_868253 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 6, subfamily B, member 3 (OR6B3) ATTGTGTGCAGCTGGTGGCTTTTTCCTATATGAGTGGTTTCATGGTCTCTGTATTCAAGG A_73_102241 A_73_102241 FALSE XM_592770 XM_592770 LOC514858 ref|XM_592770 unmapped Bos taurus similar to Homo sapiens TBC1 domain family, member 17 (TBC1D17) GGCCCTGCCTACCAGCTTCTTGTTATGAGAAAAATAAACTCGTGTTTCATCCACTGCCAA A_73_102242 A_73_102242 FALSE CB434166 CB434166 gb|Unidentified transcripts unmapped Unknown ACTCCCCCACAACCCAACTTATACCTGTCTATGAGTACAATTTAAAAATGACACTGCTTA A_73_102243 A_73_102243 FALSE NM_174114 NM_174114 MSRA ref|NM_174114 unmapped Bos taurus methionine sulfoxide reductase A (MSRA) TTTAACGCTTTGCTCACAGCTATGGCATATGCTTATTCTAATAAAGGTCTGCTAATACGA A_73_102244 A_73_102244 FALSE CB460193 CB460193 gb|Unidentified transcripts on BTA9 position 42881249-42882157 unmapped Unknown TTTTTTATCCCTGCAGGTAAATGAGGGCTCTGGATTTGGTGAGTTTCTGTCTTAAAAATT A_73_102245 A_73_102245 FALSE XM_868106 XM_868106 LOC616142 ref|XM_868106 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 174 (C1orf174) TCAATGCCGGTTCTTAAAGAACTCTCCTTATTTCCATACACAAAGTTTATGTTTACCTTG A_73_102246 A_73_102246 FALSE XM_585992 XM_585992 LOC509101 ref|XM_585992 unmapped Bos taurus similar to Homo sapiens transmembrane protein 125 (TMEM125) ATGGTTAGGATCCAATGACATGATGTGTGCAAGGGCCGGGCCCGTGGCAGGTGTGCAATA A_73_102247 A_73_102247 FALSE XM_584355 XM_584355 LOC507696 ref|XM_584355 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor associated sorting protein 2 (GPRASP2), transcript variant 2 AGCCATCGTAAGTAAGCTACCCTTTTGATTGTTCTGGTGTTACTGATGTCGATTTGAGTC A_73_102248 A_73_102248 FALSE XM_868569 XM_868569 LOC616531 ref|XM_868569 unmapped PREDICTED: Bos taurus similar to interleukin 28B (LOC616531) GTTCTTGCCAAAGGACTGGGACTGCAGCACCCACCTTTTCCCCAGGACCCGGGACCTGAA A_73_102249 A_73_102249 FALSE XM_864488 XM_864488 FZD3 ref|XM_864488 unmapped Bos taurus similar to Homo sapiens frizzled homolog 3 (Drosophila) (FZD3) AGTGCGTGGGGCATCCCTGGAACTCTGACCATCATCCTTTTAGCGATGAATAAAATTGAA A_73_102250 A_73_102250 FALSE NM_001010994 NM_001010994 MBL-A ref|NM_001010994 unmapped Bos taurus mannose binding lectin, liver (A) (MBL-A) TGAAGGGCAGTTTATGTATGTAACTGGAGGAAGGCTAGGCTACAGCAACTGGAAGAAGAA A_73_102251 A_73_102251 FALSE AV593273 AV593273 gb|Bos taurus similar to Homo sapiens chromosome 6 open reading frame 153 (C6orf153) unmapped Unknown CCCAGACTTCAAGGAATTCCTTCAGATAAAATTTCAAGGAATATGAGCTTACACTGAAAA A_73_102252 A_73_102252 FALSE XM_583024 XM_583024 LOC506562 ref|XM_583024 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to basic leucine zipper and W2 domains 1 (LOC151579) TGATACCATTGTGAAGGGGGTGAAGTTGTTAAATGAATGACTTTTGATAAAGCTTTCATG A_73_102253 A_73_102253 FALSE XM_870389 XM_870389 LOC618059 ref|XM_870389 unmapped PREDICTED: Bos taurus similar to Potential phospholipid-transporting ATPase IK (ATPase class I type 8B member 3) (LOC618059) AAACCTTAGTGCTGTGATGGAAACTGTACCACCAAGTGCAAAAGGATCATCCATCAGCGA A_73_102254 A_73_102254 FALSE XM_872090 XM_872090 LOC513509 ref|XM_872090 unmapped Bos taurus similar to Homo sapiens thioredoxin domain containing 11 (TXNDC11) GGAGAAAACTGTACATTGGGAATATATTTATGCAAATTTTATTGAAATTTATTGTAAATA A_73_102255 A_73_102255 FALSE XM_878850 XM_878850 LOC507663 ref|XM_878850 unmapped Bos taurus similar to Homo sapiens tetratricopeptide repeat domain 19 (TTC19) TCGGGCACTTGGAAGTAGTAGCGTGCCCTTTAGATTATACATAAAAGTGGACTGCGTGTT A_73_102256 A_73_102256 FALSE XM_588479 XM_588479 LOC511196 ref|XM_588479 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 119, member B (FAM119B), transcript variant 1 GGATTGACCAGCATGTCTTCCCTGGAGACTATGACCTGGTGCTGGGGGCTGATATCGTGT A_73_102257 A_73_102257 FALSE XM_868937 XM_868937 LOC616821 ref|XM_868937 unmapped Bos taurus similar to Homo sapiens midline 2 (MID2), transcript variant 2 AGTCTGGGTTCAAGCCACTGGAGAACAAATTTGGAGAATTCTTCTCTTGTCATTGAAGAA A_73_102258 A_73_102258 FALSE BE755268 BE755268 gb|Bos taurus similar to Homo sapiens Fas apoptotic inhibitory molecule 2 (FAIM2) unmapped Unknown TGTTTCCTTCCCTGGCCTCACCCTCTTGGTCTGTGTCTGACAGGAAATAAGAATAAAAGT A_73_102259 A_73_102259 FALSE XM_591693 XM_591693 LOC513928 ref|XM_591693 unmapped Bos taurus similar to Homo sapiens cAMP responsive element binding protein-like 1 (CREBL1) GTTCCTGGGAGTCAACGAGGCATGGCAGAGGGAGGTCAGGTGGATGTATGGGCATATCTT A_73_102260 A_73_102260 FALSE EE897589 EE897589 gb|Unidentified transcripts on BTA8 position 43347951-43348574 unmapped Unknown TGTGATCAGCTTCTCTCAACCTGACATGGAAAGTCTCTTGTACTACACTGTATTTAATAA A_73_102261 A_73_102261 FALSE XM_585082 XM_585082 LOC508320 ref|XM_585082 unmapped Bos taurus similar to Homo sapiens serine/threonine kinase 19 (STK19), transcript variant 1 TGTCCGAGATGCTGGAAGTTGGTGGCTCGCAGTGCCTGGAGCTGGGAGGTTCATCAAATA A_73_102262 A_73_102262 FALSE XM_597595 XM_597595 DAX-1 ref|XM_597595 unmapped Bos taurus similar to Homo sapiens nuclear receptor subfamily 0, group B, member 1 (NR0B1) CAGGGGGTTTGCACTCATACACTATTTTTATCATAGTCTCTCCATTGAACCTGCTGAAAT A_73_102263 A_73_102263 FALSE XM_871720 XM_871720 LOC530719 ref|XM_871720 unmapped Bos taurus similar to Homo sapiens calcium /calmodulin-dependent protein kinase (CaM kinase) II alpha (CAMK2A), transcript variant 2 GGTTGGGGGGAAGAAGGGGTGTCTGTTTTATTCTTGGTGTTTTCAGTGCAATAAATAGCT A_73_102264 A_73_102264 FALSE CB420132 CB420132 gb|Unidentified transcripts on BTA8 position 55136726-55137395 unmapped Unknown GCAATATCAGGACCAGACTCCTGATATACACAACAAATGGATGAATCTCAAAAACATGCT A_73_102265 A_73_102265 FALSE XM_869875 XM_869875 LOC617588 ref|XM_869875 unmapped PREDICTED: Bos taurus similar to mutS homolog 5 isoform b (LOC617588) CACAGATACATACAAAGCCATTGATGACACTCGGACTTTCACACTGGAGTTGCTGGCAAT A_73_102266 A_73_102266 FALSE NM_001034515 NM_001034515 GPRC5A ref|NM_001034515 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor, family C, group 5, member A (GPRC5A) CCTGGGCTTCAGTCTGGTGCAGGACATCATTGCCATCGAGTACGTGGTCCTCACCATGAA A_73_102267 A_73_102267 FALSE CB444044 CB444044 gb|Unidentified transcripts on BTA11 position 34043419-34044146 unmapped Unknown GTTGTCTGAGCGAGGCAAATTCTTTGTACTCTTTTTGCAGTCTGTTTGTGTGTTTGAGGT A_73_102268 A_73_102268 FALSE BE749907 BE749907 gb|Bos taurus similar to Homo sapiens zinc finger protein 706 (ZNF706), transcript variant 2 unmapped Unknown TCTATAATACAGTGACCCACCCACCACAGTCCAAACTATAACTGAAATATATTTAAACCT A_73_102269 A_73_102269 FALSE NM_001035317 NM_001035317 MVP ref|NM_001035317 unmapped Bos taurus similar to Homo sapiens major vault protein (MVP), transcript variant 1 CCAGGTTGTGCCTTAGCTCTGTACTGCACTGACAAATAAAACCGACACTTCTGGGCATTT A_73_102270 A_73_102270 FALSE XM_590194 XM_590194 LOC512646 ref|XM_590194 unmapped Bos taurus similar to Homo sapiens TATA element modulatory factor 1 (TMF1) TGTCTTCCAGTGGAGTCACAGAATTCTCTCTTAAGACAAGAAAATAGTAGATTTCAGGCT A_73_102271 A_73_102271 FALSE XM_584218 XM_584218 LOC507579 ref|XM_584218 unmapped Bos taurus similar to Homo sapiens TRAF and TNF receptor associated protein (TTRAP) TTTCTAAGAGAAAAATGTGTAAAGAGAAATTCAGGAGGTGAATAAGGAACACTTCTCTGC A_73_102272 A_73_102272 FALSE XM_615695 XM_615695 LOC535588 ref|XM_615695 unmapped Bos taurus similar to Homo sapiens abhydrolase domain containing 5 (ABHD5) CCATTATGTGTATGCAGATCAGCCGGAAGACTTCAACCAGAAAGTGAAGGAGATCTGTGA A_73_102273 A_73_102273 FALSE XM_592509 XM_592509 LOC514627 ref|XM_592509 unmapped Bos taurus similar to Homo sapiens sperm associated antigen 8 (SPAG8), transcript variant 2 CAGTCATGCAGGATGGCTCTGAGAGTTTCTTTTTCCGACACGGACACCGGGGACTGCTGA A_73_102274 A_73_102274 FALSE XM_867168 XM_867168 LOC615377 ref|XM_867168 unmapped PREDICTED: Bos taurus similar to Ca2+-dependent activator for secretion protein 2 (LOC615377) AAACACCGGTGGTGCATTCCTGTCCACTTAGTTCTGCTAGAGCAGGGCTTTACCCTGGAT A_73_102275 A_73_102275 FALSE NM_001037100 NM_001037100 BCL2A1 ref|NM_001037100 unmapped Bos taurus similar to Homo sapiens BCL2-related protein A1 (BCL2A1) CATCACCGAAAATACAGGAGAGTGGATAAAGCAAAATGGAGGCTGGGTATGTGTGATGGA A_73_102276 A_73_102276 FALSE XM_863863 XM_863863 LOC613272 ref|XM_863863 unmapped Bos taurus similar to Homo sapiens carbonyl reductase 1 (CBR1) TCTGTGAGATCTTTTGTGATTTCTTATGTAATCCCAGGGAATAAAAGAAGAATGGACGAC A_73_102277 A_73_102277 FALSE XM_618435 XM_618435 LOC538237 ref|XM_618435 unmapped Bos taurus similar to Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2) CCTCTGACAAGAAGAGCTTCCCAATCATCTCTGGAAAGTTCAACTGGACCTTCTTACTCT A_73_102278 A_73_102278 FALSE XM_600247 XM_600247 LOC521974 ref|XM_600247 unmapped Bos taurus similar to Homo sapiens T-box 15 (TBX15) GGAGCACGGCATGCACATGATTAGCCCTTCCCCCAATAATCAACAGGCGACTAACACCTG A_73_102279 A_73_102279 FALSE XM_580350 XM_580350 LOC504261 ref|XM_580350 unmapped Bos taurus similar to Homo sapiens carbamoyl- phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (CAD) CAGTTGGCGCATCTCCCTTCTCGCACCTCAAATCTGTATAGTTACTTTTTCACTGACTTA A_73_102280 A_73_102280 FALSE NM_001038647 NM_001038647 LOC540726 ref|NM_001038647 unmapped Bos taurus similar to Homo sapiens transmembrane protein 57 (TMEM57) CAACCCTTTATCTTTGTTTTGATCTTAAGTCACCAAGCAAAATCTGCCTCTTGGGTTCAC A_73_102281 A_73_102281 FALSE XM_586501 XM_586501 LOC509522 ref|XM_586501 unmapped Bos taurus similar to Homo sapiens fucosidase, alpha-L- 1, tissue (FUCA1) GTTTGCAAAGCAAGCTAAGAGCTCTGACATTCAGTCTGTTTACAGGGATTCTATGAAGAA A_73_102282 A_73_102282 FALSE NM_001034669 NM_001034669 ASB2 ref|NM_001034669 unmapped Bos taurus similar to Homo sapiens ankyrin repeat and SOCS box-containing 2 (ASB2) CCAGGGGAGCAGGGTGGGAGACTTTGGGCCCAGAGGGCTTCCTTAGGTACAATAAATGTT A_73_102283 A_73_102283 FALSE XM_601182 XM_601182 LOC522893 ref|XM_601182 unmapped PREDICTED: Bos taurus similar to G-protein coupled receptor 113 (LOC522893) GTTGCCTCATGGACAAGAAGGTCCAAGAGGCTTTACGCAAACGCTTCTGCTGCAGCCAAC A_73_102284 A_73_102284 FALSE NM_001034700 NM_001034700 MGC127913 ref|NM_001034700 unmapped Bos taurus similar to Homo sapiens splicing factor, arginine/serine-rich 3 (SFRS3) ATGGTTCAAATGTAACAGTGCAGAATTGAAATATGGAGGCATGCATAATCTTCCTCTTAG A_73_102285 A_73_102285 FALSE XM_865575 XM_865575 LOC614188 ref|XM_865575 unmapped PREDICTED: Bos taurus similar to glycerophosphodiester phosphodiesterase domain containing 4 (LOC614188) GTACTATGCTCACAAAGTTGAGAGTTCTGCAAGTGGTTGTTGGATTGCCCTTCCTCCTTA A_73_102286 A_73_102286 FALSE CB432920 CB432920 gb|Unidentified transcripts on BTA14 position 24810704-24809764 unmapped Unknown TTCGCAATCTAAGGGGGAAAAAACTCTTCTCCAAAGGGTTTGGATTATATAGTTTTAAAG A_73_102287 A_73_102287 FALSE XM_586458 XM_586458 LOC509488 ref|XM_586458 unmapped Bos taurus similar to Homo sapiens SEC24 related gene family, member C (S. cerevisiae) (SEC24C), transcript variant 2 TGCAAAATGGACCAAGCTCCGGTGTTCAGATGCAGAGGCTCCCTGGGTCTCAGCCATTTG A_73_102288 A_73_102288 FALSE AW669309 AW669309 gb|Bos taurus similar to PREDICTED: Homo sapiens KIAA1205 (KIAA1205) unmapped Unknown TCAACTTGTATACACTGTGTACACACAACCAGCCAAACGAAAACCCAACGGCAAACACTT A_73_102289 A_73_102289 FALSE BE237085 BE237085 gb|Bos taurus similar to Homo sapiens GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) (GLI3) unmapped Unknown TCTAGGGAGAAACTGTCTTCCATTTCAGTTTTGAATCAGTATTGTTACACTCAAAACATC A_73_102290 A_73_102290 FALSE XM_879591 XM_879591 LOC615263 ref|XM_879591 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 63 (C1orf63), transcript variant 2 CAAGTGACCAATAGGTTCCTACTCTAATATGCACATTCTCAGTTTCAGCGTTTTCCCCTT A_73_102291 A_73_102291 FALSE CB435013 CB435013 gb|Unidentified transcripts unmapped Unknown ACCTTTGGGGGACACTTTGCCCACTCTCAGTGTCTATGCTGAGAGATTTGTACTTTCTTT A_73_102292 A_73_102292 FALSE BE485731 BE485731 gb|Unidentified transcripts unmapped Unknown CGGTGCTCGATAATCATTACCAGTTGTTACTCTTGATTTCCTATCTGGCAGTTAGCCTTT A_73_102293 A_73_102293 FALSE XM_877589 XM_877589 LOC534067 ref|XM_877589 unmapped PREDICTED: Bos taurus similar to ubiquitin specific protease 34, transcript variant 4 (LOC534067) ATGTGGCAGTTGTGTAGTTGTATTCCCAGTACATTACCAGATCCTAAAGCTGTGTCTTTA A_73_102294 A_73_102294 FALSE EE893913 EE893913 gb|Unidentified transcripts unmapped Unknown GTAAAGCTATTGAAAATAAGCAGACAGCATTTTAATTATTCATAGATTATATCATTGTTC A_73_102295 A_73_102295 FALSE NM_001037598 NM_001037598 MGC133836 ref|NM_001037598 unmapped Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 1B (EIF1B) AACATGGGGTATGTAGGCTAGTAACACATAAGAAAATTGCAGTAAGATGGTAATGAAACC A_73_102296 A_73_102296 FALSE NM_001024564 NM_001024564 FLJ21839 ref|NM_001024564 unmapped Bos taurus similar to RIKEN cDNA 9430057O19 (FLJ21839) AGCCTTGAAGATGCACACTCGGCCTGGGACCAAGGGGTGAATCAATAAAATTAGTTTGTA A_73_102297 A_73_102297 FALSE XM_871044 XM_871044 LOC618720 ref|XM_871044 unmapped Bos taurus similar to Homo sapiens transmembrane protein 161A (TMEM161A) TGTACTTCCACCAGCATCTGGCGGGCTAGTAGCCCTCTTGCAGACACTCCTGTGGTCCCG A_73_102298 A_73_102298 FALSE CB168295 CB168295 gb|Bos taurus similar to Homo sapiens solute carrier family 24, member 5 (SLC24A5) unmapped Unknown ATAGCATATGCCGCACAGTCTCTGAATAGGGGCCAACATGATAGCCTTGAAACCTGTAAA A_73_102299 A_73_102299 FALSE XM_589156 XM_589156 LOC511758 ref|XM_589156 unmapped Bos taurus similar to Homo sapiens transducin (beta)-like 2 (TBL2) GAGCAATACATATGCTGCTATATCCCCTTGTAGCAGGTTTGTAGCCTCGTGTGGCTTCAC A_73_102300 A_73_102300 FALSE NW_001005719 NW_001005719 gb|Bovine miRNA bta- miR-31 on chr Un, (+) strand. Mature length 21 nt, stem-loop length 94 nt. Source: NW_001005719.1:77313-77406 unmapped Unknown GGCAAGATGCTGGCATAGCTGTATCCTACTATACGTATCACATAG A_73_102301 A_73_102301 FALSE XM_582110 XM_582110 LOC538703 ref|XM_582110 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia) (KCNA1) AATTGTACCACAGCTAACCAAAACTGTGTTAATAAGAGCAAGCTACTGACTGATGTTTAA A_73_102302 A_73_102302 FALSE XM_864882 XM_864882 LOC539793 ref|XM_864882 unmapped Bos taurus similar to Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 (PPFIA4) ATGGGTGTGTGTGGGTGTTGAGTGTGGGTGTGTATATACCAATAAATAAACTGGTCTTGA A_73_102303 A_73_102303 FALSE XM_609045 XM_609045 LOC530571 ref|XM_609045 unmapped PREDICTED: Bos taurus similar to cytochrome P450, family 2, subfamily b, polypeptide 10 isoform 2 (LOC530571), partial mRNA. AACTTCTCTTTGGGGTCTCCCAAGGCCCCTGAAGACATCGACCTCACACCCAGGGAGAAT A_73_102304 A_73_102304 FALSE XM_616262 XM_616262 LOC536141 ref|XM_616262 unmapped Bos taurus similar to Homo sapiens homeobox C11 (HOXC11) TTTTATTTTTATTTTTTATTTTCTAACTCGCCTACTTTCCGCGGGTGGAAAACTGGACTG A_73_102305 A_73_102305 FALSE BM030612 BM030612 gb|Unidentified transcripts unmapped Unknown GACTCAACATTTCCCATGCCCCACATGCTGACGTTGCCAATATGCGCCTCCTTTAGGAGT A_73_102306 A_73_102306 FALSE XM_581466 XM_581466 LOC538611 ref|XM_581466 unmapped PREDICTED: Bos taurus similar to type I hair keratin KA36 (LOC538611) GTCAAATGACACTTGTGAGCCATGTTCGGCGTACGTAATTTGCACAGTAGAAAACAGCTG A_73_102307 A_73_102307 FALSE XM_874613 XM_874613 LOC614427 ref|XM_874613 unmapped Bos taurus similar to Homo sapiens methyltransferase like 5 (METTL5) CTGATTTTATTCCATCAACCTTAAAAGATATTTAGACATCTTAGATATTTGTACCCTGTC A_73_102308 A_73_102308 FALSE NM_001012666 NM_001012666 DCT ref|NM_001012666 unmapped Bos taurus dopachrome tautomerase (DCT) GGTGGTATCTGATAATAATCCCCATACTGATTGATTAAGCCTCCTCGTGTTCTGATCCCC A_73_102309 A_73_102309 FALSE BE477037 BE477037 gb|Bos taurus similar to Homo sapiens interferon responsive gene 15 (IFRG15) unmapped Unknown GCCACTATCTAGTTACTTGGCTCTACATTAAAGCAAAGACTAATCCCTGGTCTTTGGTGG A_73_102310 A_73_102310 FALSE CB447902 CB447902 gb|Bos taurus similar to Homo sapiens GTPase activating Rap/RanGAP domain-like 4 (GARNL4) unmapped Unknown GTGATTTGTAGACCCCCACACCCACCCCTGACTGCCTATGTAATGTAAATAGTGTACATT A_73_102311 A_73_102311 FALSE CB454178 CB454178 gb|Unidentified transcripts on BTA12 position 6659493-6658815 unmapped Unknown TATTAATAGGTGTGTGTGTGTCCAAGTGCAGGCATATAAAAACTTCAATTTTCTGACTTG A_73_102312 A_73_102312 FALSE NM_001025345 NM_001025345 MCM7 ref|NM_001025345 unmapped Bos taurus similar to Homo sapiens MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) (MCM7), transcript variant 1 TTACTTATTCTTTTTTCCTAATAAAGCGTGTGTCCATTTGCTGCTTCTGTTAAAACAGGG A_73_102313 A_73_102313 FALSE XM_593150 XM_593150 LOC515177 ref|XM_593150 unmapped Bos taurus similar to Homo sapiens tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial fibroelastosis 2; Barth syndrome) (TAZ), transcript variant 2 CACTGTTCTTTCTGCCTCCCTGGCATCACTTGAATCCCCTGGTTGTCTTATAAACTATTA A_73_102314 A_73_102314 FALSE NM_001001855 NM_001001855 BIRC5 ref|NM_001001855 unmapped Bos taurus baculoviral IAP repeat-containing 5 (survivin) (BIRC5) TGTGTGTGTGTGGAACAGGATTTTCATGTAAAGAGGAATTGGGACAAAGCCCTCAGCCAA A_73_102315 A_73_102315 FALSE XM_867369 XM_867369 LOC615528 ref|XM_867369 unmapped PREDICTED: Bos taurus similar to sulfotransferase family, cytosolic, 1C, member 1 (LOC615528) CTCAGAATGAGGATTTTGACAAGGACTACGAGAGGAAGATGGCTGGGAGCACCCTGACAT A_73_102316 A_73_102316 FALSE XM_869295 XM_869295 LOC617104 ref|XM_869295 unmapped Bos taurus similar to Homo sapiens chromsome 3 open reading frame 28 (C3orf28) TAGGCCTTACTAAAAAGAATGTGGTGTATGAGCTTCCCTATTTCCACTCTAGAGCTACAA A_73_102317 A_73_102317 FALSE XM_613111 XM_613111 LOC533643 ref|XM_613111 unmapped Bos taurus similar to Homo sapiens zinc finger protein 326 (ZNF326), transcript variant 2 AATTCACTCATTTTCTCTGTGCCTGTGTCAGATCTTGAAATCTTCTTGGAAATACATTTG A_73_102318 A_73_102318 FALSE NM_001035039 NM_001035039 FLAD1 ref|NM_001035039 unmapped Bos taurus similar to Homo sapiens FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) (FLAD1), transcript variant 1 TTTCCAGGGAGGGAAGGAAGGAGGCCGTCCTGGGGTCTAACCTGTCAATAAACCACCTCT A_73_102319 A_73_102319 FALSE EE903535 EE903535 gb|Unidentified transcripts unmapped Unknown AGTATACCTCACAGTATGGGATGGACTCTTGGTTTGCAGTTGCCAAAGAACGAGAAGGAT A_73_102320 A_73_102320 FALSE NM_001012519 NM_001012519 AKR1B1 ref|NM_001012519 unmapped Bos taurus aldose reductase (AKR1B1) CCAGCTTGGTGTCGGGTCCAAAGAGCAGAATCAGTAGATTAGTAGAAGTCTCTTCAGTTT A_73_102321 A_73_102321 FALSE XM_611420 XM_611420 LOC539790 ref|XM_611420 unmapped Bos taurus similar to Homo sapiens pogo transposable element with KRAB domain (POGK) TGAGACACAGTTGTACTCCCCAGTAGATAGGAACTGAGTCTAACAATAAACTTTGATAAT A_73_102322 A_73_102322 FALSE XM_865634 XM_865634 LOC538504 ref|XM_865634 unmapped Bos taurus similar to Homo sapiens zinc finger protein 565 (ZNF565), transcript variant 2 ATGTAATTATTGTCAGAGAACCTTCATTTGTCACTTCTATTGTGGAACATCAGGTAACTC A_73_102323 A_73_102323 FALSE CB427444 CB427444 gb|Unidentified transcripts unmapped Unknown TTTTCCCCAGCTCAAATCTAAATTCAACACTGTTCTGTACTGCAATCAAACTTCAAACCA A_73_102324 A_73_102324 FALSE XM_599981 XM_599981 LOC521713 ref|XM_599981 unmapped Bos taurus similar to Homo sapiens MORC family CW-type zinc finger 1 (MORC1) ATTTATTCAGGCCAAAAGAGTTAGAACAAAATACCTCTGCTATTGCCTCTACAGACCCAG A_73_102325 A_73_102325 FALSE BI537287 BI537287 gb|Unidentified transcripts unmapped Unknown ATCTACTCACCGATTGTCTCGGTGCCTTTTTCCTTTTGTATTATTGTGTTACTTAAAGAA A_73_102326 A_73_102326 FALSE XM_591382 XM_591382 LOC540085 ref|XM_591382 unmapped Bos taurus similar to Homo sapiens GRB2-associated binding protein 1 (GAB1), transcript variant 1 TTGGCCACTGTCCTGTGCCTGACTTATGTAATGGGTTTATGTCCCCTCCATGAACTAAAA A_73_102327 A_73_102327 FALSE XM_593152 XM_593152 LOC515178 ref|XM_593152 unmapped Bos taurus similar to Homo sapiens ATP-binding cassette, sub-family D (ALD), member 1 (ABCD1) CCTGGGGTCAGGGAGCCTCCCTGAGTTCCTCAGTAAAGACCTGCCATGGAAAGTGCAAAA A_73_102328 A_73_102328 FALSE XM_613534 XM_613534 LOC540871 ref|XM_613534 unmapped Bos taurus similar to Homo sapiens membrane- associated ring finger (C3HC4) 9 (MARCH9) ACAGGGCAGCTGGCAATAAGACTAGTATACATTGACCTCCCGTTCCCTGCATGAGGGCGG A_73_102329 A_73_102329 FALSE XM_580929 XM_580929 LOC504761 ref|XM_580929 unmapped Bos taurus similar to Homo sapiens KIAA1468 (KIAA1468) TGTTGGATTCTAGGCATTCCTGAGAAATTGAAAGTGGCTTCCTTTCATGTCAAAAATGTT A_73_102330 A_73_102330 FALSE CB458708 CB458708 gb|Unidentified transcripts on BTA10 position 36441062-36440305 unmapped Unknown CCTGCTGATCTTTTAAACAAAGAAATAAAAATATTTAACTGCTGCAAAGTCCTAACCGCC A_73_102331 A_73_102331 FALSE XM_602953 XM_602953 LOC524624 ref|XM_602953 unmapped Bos taurus similar to Homo sapiens phosphodiesterase 4C, cAMP-specific (phosphodiesterase E1 dunce homolog, Drosophila) (PDE4C) CAAGTGTCCGAGTACATATCCCAGACCTTCCTGGAGCAGCAGACTGAGGTGGAGTTACCC A_73_102332 A_73_102332 FALSE XM_597656 XM_597656 LOC519437 ref|XM_597656 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 6, subfamily V, member 1 (OR6V1) TCAACCCCTTTATCCTCACCCTCCACAATGAGACGTTCAAGGCTGTGCTACGAGGCCAGA A_73_102333 A_73_102333 FALSE XM_581197 XM_581197 LOC504985 ref|XM_581197 unmapped PREDICTED: Bos taurus similar to Tuberin (Tuberous sclerosis 2 homolog protein) (LOC504985), partial mRNA. AGCTGAACTGCGGACATGAGACAGTGAGACTGTGATCAGGCCAATGTGACTGAAAGGCTT A_73_102334 A_73_102334 FALSE XM_866972 XM_866972 LOC615225 ref|XM_866972 unmapped PREDICTED: Bos taurus similar to translocator of inner mitochondrial membrane 44 (LOC615225) AAGAGAAAATGTTTGAGGGCAACGAGGAGGCGCTGCGGGTCGTGCTACACAAGGACTCCA A_73_102335 A_73_102335 FALSE CB457896 CB457896 gb|Unidentified transcripts on BTA3 position 56997446-56996470 unmapped Unknown TCTAGCCAGCCAGCATACTTTGCCTTCCCCTATAGCACTTAGCTGGGCATTACTTTATTA A_73_102336 A_73_102336 FALSE NM_001034676 NM_001034676 NKX2-3 ref|NM_001034676 unmapped Bos taurus similar to Homo sapiens NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3) TGAAGAGGAGCCCGAGGTCGTGAGGGACGGGAACCAAAAAAGCTGCCAACTGAAGAAACC A_73_102337 A_73_102337 FALSE XM_588098 XM_588098 LOC510874 ref|XM_588098 unmapped Bos taurus similar to Homo sapiens F-box protein 17 (FBXO17), transcript variant 1 GTCAAAGAGTAACTCAGAGACCTGTACTGTACTTGTAAATTTCTTTCTCACGTGTGCTGA A_73_102338 A_73_102338 FALSE EE911252 EE911252 gb|Unidentified transcripts unmapped Unknown TGATTTTTAAAAAGTTGTTGAATGTTTGCAGATTCCCTCTTGCCCCGAAATGGGAAGGGG A_73_102339 A_73_102339 FALSE BM030907 BM030907 gb|Bos taurus similar to Homo sapiens Bcl2 modifying factor (BMF), transcript variant 2 unmapped Unknown ATTTGGCTGTGTGTTCTTCCCGTGCATATATGTGTATATATCTTTGCCTCCATCAATTGG A_73_102340 A_73_102340 FALSE XM_870316 XM_870316 LOC617983 ref|XM_870316 unmapped Bos taurus similar to Homo sapiens leucine rich repeat containing 3B (LRRC3B) GCGGTATATTCCCGAGTCGGCTACTTCTCTGAACCTCAGTTAGATCCATCTCACTATTTA A_73_102341 A_73_102341 FALSE BF605389 BF605389 gb|Bos taurus similar to Homo sapiens suppressor of hairy wing homolog 4 (Drosophila) (SUHW4), transcript variant 3 unmapped Unknown AAGCAGGATGTAAAAAATTGGTTTGGGATATTTAGCCTAATTTATCCTTAAGATGGCTGC A_73_102342 A_73_102342 FALSE NM_001024573 NM_001024573 PPAPDC2 ref|NM_001024573 unmapped Bos taurus phosphatidic acid phosphatase type 2 domain containing 2 (PPAPDC2) CGCTCCAGGAAAACTTTAAAGAAACCAAGTTGGAGTGATTATAATGTTGCTGCTTCTTAA A_73_102343 A_73_102343 FALSE XM_870714 XM_870714 LOC618380 ref|XM_870714 unmapped Bos taurus similar to PREDICTED: Homo sapiens KIAA1086 (KIAA1086) CTGCCTTCACCCTGGGGCGAGAAGGGGCAGCACAACCATAAACCCTGGCATTTTTTGCTA A_73_102344 A_73_102344 FALSE XM_611183 XM_611183 LOC506831 ref|XM_611183 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to CG3104-PA (LOC286080) CAGGAGGCGCACCTGCAGCACTTCCGCCTCTTCTTCGTCACCAAGGTTCGGTGGCCCCCG A_73_102345 A_73_102345 FALSE CB454110 CB454110 gb|Unidentified transcripts on BTA18 position 49524198-49523353 unmapped Unknown ATCCGCCTTGCAGAAGTTCCATCCAAGCCATATATTCAGTGAATAAACCGTGCTCCCAAA A_73_102346 A_73_102346 FALSE XM_870740 XM_870740 LOC618409 ref|XM_870740 unmapped PREDICTED: Bos taurus similar to Interferon regulatory factor 4 (IRF-4) (Lymphocyte specific interferon regulatory factor) (LSIRF) (NF-EM5) (Multiple myeloma oncogene 1) (LOC618409) TTTGGGCTGGCTCTCATGACCACCCCAGGTGCCCACGTCTTGCAGACCCCAGTGCTAGAA A_73_102347 A_73_102347 FALSE XM_583503 XM_583503 LOC506970 ref|XM_583503 unmapped Bos taurus similar to Homo sapiens MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) (MCM5) TGGTGTCTGCCCTGGCTGCAGATCCAGGAAATGTGCTTTTGGAAATTTATAGAAGTAATA A_73_102348 A_73_102348 FALSE NM_001037614 NM_001037614 MGC134106 ref|NM_001037614 unmapped Bos taurus similar to Homo sapiens ubiquitin- conjugating enzyme E2H (UBC8 homolog, yeast) (UBE2H), transcript variant 1 AGCACCTGCTTTTCAGAAAGACTATTATTTCCTAACCATGAGAAGCAGACTATAATATTC A_73_102349 A_73_102349 FALSE CB452468 CB452468 gb|Unidentified transcripts on BTA8 position 55440244-55439058 unmapped Unknown ATGTACTGAGCTAGCAAAGCATGTGATAGTCTTGAAAGGAAAATCCTTCTGATGCCCAAG A_73_102350 A_73_102350 FALSE NM_174317 NM_174317 FCGR3A ref|NM_174317 unmapped Bos taurus Fc fragment of IgG, low affinity IIIa, receptor for (CD16) (FCGR3A) ACTGTATTTTTCTGTACGGAGACACCTTCAAAGCTCAGAGGAATGGAGGGATGGCAAAGT A_73_102351 A_73_102351 FALSE XM_607678 XM_607678 LOC529235 ref|XM_607678 unmapped Bos taurus similar to Homo sapiens DNA-damage- inducible transcript 4 (DDIT4) TACATGAAGATACTCGCTGTTCATGAATACACTTGATGTTCAAGTATTAAGACCTATGCA A_73_102352 A_73_102352 FALSE CB423238 CB423238 gb|Unidentified transcripts unmapped Unknown CCCTCCCAGCAGTACCTCTGCTATCTCTGTGGATTTGCCTTTTCTGAGCAATTCAAATAA A_73_102353 A_73_102353 FALSE NM_001034710 NM_001034710 MGC127769 ref|NM_001034710 unmapped Bos taurus similar to Homo sapiens cAMP responsive element modulator (CREM), transcript variant 4 ATTTCTAAGACTTGTTCCAATGCCACATATTTGCAGTTCCCAATCTCGGTGTCATGAATA A_73_102354 A_73_102354 FALSE AV589675 AV589675 gb|Unidentified transcripts on BTA3 position 75466694-75467994 unmapped Unknown GTTTTTATATTTCTTGGGATCTATATGCAGGACAAAGAAATAAAAACTTGTCTGCGATAA A_73_102355 A_73_102355 FALSE NM_001034502 NM_001034502 MGC127800 ref|NM_001034502 unmapped Bos taurus similar to Homo sapiens actin, alpha 2, smooth muscle, aorta (ACTA2) ACTCCCTGCTCTCTTGTCTGTCTCTAGTACACACTGTGAATGTTCTGTGGAATAATGCCT A_73_102356 A_73_102356 FALSE CB443691 CB443691 gb|Unidentified transcripts unmapped Unknown GACTTCTCTTTTGTATTCATCTTACCATCTATCATTGTGTCACCCAAAATTCAGAATGGT A_73_102357 A_73_102357 FALSE NM_001025327 NM_001025327 LOC509768 ref|NM_001025327 unmapped Bos taurus similar to Homo sapiens mitochondrial GTPase 1 homolog (S. cerevisiae) (MTG1) GCCGTATCCAAGAAAGCTGGCAGTGTGGACACAAGAGGCTCCGGGGTTGGCCCTCTCACT A_73_102358 A_73_102358 FALSE NM_001040540 NM_001040540 SPZ1 ref|NM_001040540 unmapped Bos taurus spermatogenic leucine zipper 1 (SPZ1) GTTCAATACTCGTATTGCAAAAAGAGCTCTTGTGGTAAAGAGGCCAGCTAGCAGCTTAAG A_73_102359 A_73_102359 FALSE XM_611432 XM_611432 LOC512236 ref|XM_611432 unmapped Bos taurus similar to Homo sapiens PRP4 pre- mRNA processing factor 4 homolog B (yeast) (PRPF4B) ATTTCAGCAGCAATGTTCCTAATTGACCTACTAGGAAAATGTAATAAACACGCCTCTTGT A_73_102360 A_73_102360 FALSE XM_617549 XM_617549 LOC537387 ref|XM_617549 unmapped PREDICTED: Bos taurus similar to Collagen alpha 1(V) chain precursor (LOC537387) AGTGAACACCCTGTGATAGACGTCAACGGCATCGTCGTGTTCGGCACCCGGATTCTGGAT A_73_102361 A_73_102361 FALSE XM_870782 XM_870782 LOC512035 ref|XM_870782 unmapped Bos taurus similar to Homo sapiens keratin 38 (KRT38) GAACCTTCTGGAGAGTGAAGACTGCAAACTCCCCTGTAATCCCTGCTCTACGCCTGCCTC A_73_102362 A_73_102362 FALSE XM_868075 XM_868075 LOC616107 ref|XM_868075 unmapped PREDICTED: Bos taurus similar to checkpoint suppressor 1 (LOC616107) AGCCAAAATGACCATTGCTTCCTCCAGCTTGTCTCAGAATCCCGCGGCTGAATCCACAGG A_73_102363 A_73_102363 FALSE XM_589649 XM_589649 LOC539813 ref|XM_589649 unmapped Bos taurus similar to Homo sapiens potassium voltage-gated channel, subfamily G, member 1 (KCNG1), transcript variant 1 CTCTGAGGCTTGACGCTATCACCATCGCTGCAGAAGCCTCCAAAGGCACATGCTGCTTCT A_73_102364 A_73_102364 FALSE XM_883229 XM_883229 LOC526155 ref|XM_883229 unmapped PREDICTED: Bos taurus similar to Neuronal pentraxin-2 precursor (NP2) (Neuronal pentraxin II) (NP-II), transcript variant 2 (LOC526155) TGTTCGGAGGAGCTTCCAAGTGGCCGGTGGAGACCTGCGAGGAGCGTCTCCTTGACTTGT A_73_102365 A_73_102365 FALSE XM_580450 XM_580450 LOC504344 ref|XM_580450 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 4, subfamily F, member 15 (OR4F15) ATTCAGGAACAAGGAGATGAAAGCAGCAATGAAGAAACTCTGCCATCAGCTTGTGAGTTA A_73_102366 A_73_102366 FALSE CB530696 CB530696 gb|Unidentified transcripts unmapped Unknown AAATTTTCAAAGTGTTAATTTGGCAGTGCTTTAAATCTTCATTATGTGCCAATACTGACA A_73_102367 A_73_102367 FALSE NM_173930 NM_173930 LHB ref|NM_173930 unmapped Bos taurus luteinizing hormone beta polypeptide (LHB) ACTTCTCAAACTGCCTAGGCTGGCCTAATAATAATTGTAATCATTATTAACCCAGAAGTT A_73_102368 A_73_102368 FALSE XM_870332 XM_870332 LOC618000 ref|XM_870332 unmapped PREDICTED: Bos taurus similar to Cytosolic acyl coenzyme A thioester hydrolase, inducible (Long chain acyl-CoA thioester hydrolase) (Long chain acyl-CoA hydrolase) (CTE-I) (CTE-Ib) (LOC618000) TCCAGACTTTCTTCCATAAACACCTGAGTGGGGAAAAGGGGACAATTCCAGCCAAGCTGT A_73_102369 A_73_102369 FALSE XM_588617 XM_588617 LOC511306 ref|XM_588617 unmapped Bos taurus similar to Homo sapiens processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) (POP1) TTACTGTCCCTGGGAGCAGTTAACTCGAGACTGGGAGTCAAGAGTCCAGGCTCCAGAGGA A_73_102370 A_73_102370 FALSE XM_868124 XM_868124 LOC616160 ref|XM_868124 unmapped PREDICTED: Bos taurus similar to GC-rich promoter binding protein 1-like 1 (LOC616160) TTGGAAGATTCAGAGGACAACAGCACACCTGAACCAAAGGAAAATGGAGAGGAAGACTGT A_73_102371 A_73_102371 FALSE NM_001014905 NM_001014905 FLJ20551 ref|NM_001014905 unmapped Bos taurus hypothetical protein LOC54977 (FLJ20551) AAGGTGGCTGACACTTGATCTGTATAGGTCCTGAAGCTTAAAATTGTTTAAAATAGCTTT A_73_102372 A_73_102372 FALSE XM_614421 XM_614421 LOC534600 ref|XM_614421 unmapped Bos taurus similar to Homo sapiens apoptotic chromatin condensation inducer 1 (ACIN1) TTGGCTGAGAAGTGGGGAACAGCCAGGAGCCCCAAACCTCCCTTGTTTTTTCCTCCATCC A_73_102373 A_73_102373 FALSE XM_585814 XM_585814 LOC539234 ref|XM_585814 unmapped PREDICTED: Bos taurus similar to stromal antigen 1, transcript variant 1 (LOC539234) CAGTGTCTCCTTGATTGGTTTTGCTAGTAATTCTGTAAATTGTACATTTGCAATATGAGG A_73_102374 A_73_102374 FALSE NM_001035051 NM_001035051 VPS24 ref|NM_001035051 unmapped Bos taurus vacuolar protein sorting 24 isoform 1 (VPS24) GGTGCATGGATGGATAGAATAATGACAACCACTCTTTCAGCGATTCAAATAAAATGATCT A_73_102375 A_73_102375 FALSE CB170350 CB170350 gb|Unidentified transcripts on BTA18 position 1757697-1760152 unmapped Unknown ATGTGTTTCTGTTCTGTGCATTGTTACCCTGCTTGTGGTAAAGTCAGCTTAACTTTTTGT A_73_102376 A_73_102376 FALSE XM_603297 XM_603297 LOC524957 ref|XM_603297 unmapped Bos taurus similar to Homo sapiens Ras protein-specific guanine nucleotide-releasing factor 2 (RASGRF2) GCCCTCATCATAGATGAAGATACGCTGTATGAGCTGTCACTAAAAATTGAACCTCGGCTC A_73_102377 A_73_102377 FALSE BI975668 BI975668 gb|Bos taurus similar to Homo sapiens septin 11 (SEPT11) unmapped Unknown TCTCCTTTCAGTGTTAATGCAGAATTGTCATATATGTAAACTGCATGTTAGACACTTGTC A_73_102378 A_73_102378 FALSE NM_174349 NM_174349 ICAM3 ref|NM_174349 unmapped Bos taurus intercellular adhesion molecule 3 (ICAM3) CCAGCACTCTCCATTTCCCTGAGACCCTCACTGTGGACTCCCAGTGGGTGGCACAAAATA A_73_102379 A_73_102379 FALSE NM_001024549 NM_001024549 RASSF8 ref|NM_001024549 unmapped Bos taurus Ras association (RalGDS/AF-6) domain family 8 (RASSF8) GCTGTAATGCCAAGCCTTCATTTTTATTTGTAGCATTTTGAGAGCATTAGGAAAGTGTTA A_73_102380 A_73_102380 FALSE XM_876488 XM_876488 LOC539073 ref|XM_876488 unmapped Bos taurus similar to Homo sapiens chromosome 8 open reading frame 1 (C8orf1) TATTCAGGAACCTACCAAGGTAGTTTCTGGAGCTATATTCTCTAGTTAACTAGCATAACC A_73_102381 A_73_102381 FALSE NW_930852 NW_930852 gb|Bovine miRNA bta- mir-10b on chr 2, (-) strand. Mature length 22 nt, stem-loop length 99 nt. Source: NW_930852.1:c59562-59464 unmapped Unknown TACCCTGTAGAACCGAATTTGTTATCCTACTATACGTATCACATA A_73_102382 A_73_102382 FALSE CB419034 CB419034 gb|Bos taurus similar to Homo sapiens transducer of ERBB2, 1 (TOB1) unmapped Unknown AAATGGTATAAAAGTATTTTGAGTCAGTGTCTTACATGTTAAGAGGGACTGAAATAGTTT A_73_102383 A_73_102383 FALSE XM_608401 XM_608401 LOC529939 ref|XM_608401 unmapped Bos taurus similar to Homo sapiens laminin, beta 3 (LAMB3), transcript variant 1 CCCACACAGAACTGTAACTCAAAACGTTGCACAAGGGAAAAGTCCAATAAAAATCTTGGG A_73_102384 A_73_102384 FALSE XM_864870 XM_864870 LOC613775 ref|XM_864870 unmapped Bos taurus similar to Homo sapiens similar to hypothetical protein (MGC33657) AGGTCACCATGGTCCTCTGTGTCTGCTTATGTTCCGGCCATTTGGGGAATTAAAGTTTTA A_73_102385 A_73_102385 FALSE XM_592562 XM_592562 LOC514672 ref|XM_592562 unmapped Bos taurus similar to Homo sapiens kinesin family member 4A (KIF4A) CGAGGCTGAGGCTGTCTTATCTCGAGGTTGTCTCAGCTTAATGGCAGAGCCTGCTCTGTG A_73_102386 A_73_102386 FALSE XM_586373 XM_586373 LOC539307 ref|XM_586373 unmapped Bos taurus similar to Homo sapiens oligodendrocyte transcription factor 1 (OLIG1) GTCTGCAAGTTCCCGCACCTGGTCCCGGCCGGCCTTGGCTTGGCCGCTGAGCCGGCGCAG A_73_102387 A_73_102387 FALSE CB427631 CB427631 gb|Bos taurus similar to Homo sapiens zinc finger protein 96 (ZNF96) unmapped Unknown TGCAATGATTATTTCACAGTTAGGAGTTTATATCTGCTGCAAATGCCTGAATTTTCTGAG A_73_102388 A_73_102388 FALSE XM_867911 XM_867911 LOC615966 ref|XM_867911 unmapped Bos taurus similar to Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ), transcript variant 1 TTTCAACTACTTTCTCTACAGCTTTTCATGTAAATTAGTCTTTAGAGAAGTTTCAGGGCC A_73_102389 A_73_102389 FALSE XM_603075 XM_603075 LOC524743 ref|XM_603075 unmapped Bos taurus similar to Homo sapiens GTP binding protein 4 (GTPBP4) ATGCCAGCAGTAAAAGGACTAAGTCAGCTCCTAGTCCTTTTGTTCAGTGCACCGTTTGAT A_73_102390 A_73_102390 FALSE BM288041 BM288041 gb|Bos taurus similar to Homo sapiens zinc finger protein 503 (ZNF503) unmapped Unknown CCCATCCCTTGTAGATTATAAATAAATACAAAACCGCCACAGAACTAGAGGTCTTCTCTT A_73_102391 A_73_102391 FALSE XM_585019 XM_585019 LOC508264 ref|XM_585019 unmapped Bos taurus similar to Homo sapiens afamin (AFM) GAAAAGAACACAGTAAACAGATTCTTCTGTACCTATTGTCTGAGATAATGTTATTGCAGC A_73_102392 A_73_102392 FALSE XM_596461 XM_596461 LOC518274 ref|XM_596461 unmapped Bos taurus similar to Homo sapiens anillin, actin binding protein (scraps homolog, Drosophila) (ANLN) TCTTTGAATTGTTAGTTATTGATGGCCTCACTTATAAACACTAAATTCTGTCACCTCCTG A_73_102393 A_73_102393 FALSE XM_868608 XM_868608 LOC616560 ref|XM_868608 unmapped Bos taurus similar to Homo sapiens plastin 1 (I isoform) (PLS1) ATATCTGATGCGTGCATATCAGATGGTCCCACATCCATAGATTCCCACAACTGCAGATCA A_73_102394 A_73_102394 FALSE NM_001015673 NM_001015673 EVA1 ref|NM_001015673 unmapped Bos taurus epithelial V-like antigen 1 (EVA1) AAACCCACCCTGGTATAATTTACTTATGAACTTGAAATGCTTCTCATGCCTGTCTCATTT A_73_102395 A_73_102395 FALSE XM_617120 XM_617120 LOC536969 ref|XM_617120 unmapped PREDICTED: Bos taurus similar to synaptotagmin IX (LOC536969) CTGTGGAAGGATATCGAATATGTCACCAACGTGAGTCTAACATTTCTTCATTTGGGATGA A_73_102396 A_73_102396 FALSE XM_870255 XM_870255 LOC617922 ref|XM_870255 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to myeloid-associated differentiation marker (LOC255275) CTGCCCCTGGGACAGCCAGCTGGTGGTGGCCACCTTCACTTACATCAACCTGCTCCTCTA A_73_102397 A_73_102397 FALSE NM_174372 NM_174372 KCNH1 ref|NM_174372 unmapped Bos taurus potassium voltage-gated channel, subfamily H (eag-related), member 1 (KCNH1) AAGGGTATTTTCCTTCATTTTTAATTTTTTCTTACTGCCATGATATTTGTAACAACATGA A_73_102398 A_73_102398 FALSE XM_581209 XM_581209 LOC504993 ref|XM_581209 unmapped Bos taurus similar to Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 13 (NUDT13) AGGCCAACCTCGCAAGGCAGAACAGATGGTGAGCCTACAGCAGGACACATCTGTCAGTGT A_73_102399 A_73_102399 FALSE XM_596756 XM_596756 LOC518563 ref|XM_596756 unmapped Bos taurus similar to Homo sapiens heparan sulfate 6-O-sulfotransferase 1 (HS6ST1) GCAGCTGTACGACTATGCCCGGGACCTCTTCCAGCAGCGTTACCAGTACAAGCGGCAGCT A_73_102400 A_73_102400 FALSE CB224549 CB224549 gb|Bos taurus similar to Homo sapiens OTU domain containing 4 (OTUD4), transcript variant 1 unmapped Unknown ATAAAATAAGAGTAAATGCCCTACATGGTGTGATGCTGCATTATATATAAAACCGTGTGC A_73_102401 A_73_102401 FALSE XM_594533 XM_594533 LOC516380 ref|XM_594533 unmapped PREDICTED: Bos taurus similar to Tubby related protein 3 (Tubby-like protein 3) (LOC516380) TGTGTAGATGTGTGTGGATTCACATACGTGTGCGCGCACATATATGTTTGTACACCCCTA A_73_102402 A_73_102402 FALSE NM_174349 NM_174349 ICAM3 ref|NM_174349 unmapped Bos taurus intercellular adhesion molecule 3 (ICAM3) GTGACTGTGGCAGAGGAGTTATCCTGAGCTCAGTGATACTGAGCAAAGACGACGGGGGCT A_73_102403 A_73_102403 FALSE XM_870023 XM_870023 LOC617714 ref|XM_870023 unmapped PREDICTED: Bos taurus similar to Ephrin-B3 precursor (EPH-related receptor tyrosine kinase ligand 8) (LERK-8) (EPH-related receptor transmembrane ligand ELK-L3) (LOC617714) ACTGCAGACCCCCCTTTCTGTCCCCACTATGAGAAGGTGAGTGGTGACTATGGGCATCCT A_73_102404 A_73_102404 FALSE NM_001034682 NM_001034682 MGC128530 ref|NM_001034682 unmapped Bos taurus similar to Homo sapiens chromatin modifying protein 5 (CHMP5) CATGGGTGGATATTTTGATTCTGTGGTTCCTGCAGTATTACAGCTGACTTGTAATCAGTA A_73_102405 A_73_102405 FALSE XM_870498 XM_870498 LOC618176 ref|XM_870498 unmapped PREDICTED: Bos taurus similar to ring finger protein 144 (LOC618176) CTGGCGCCTCCTCGTGGCTGAGAGAAGTCCTTTAAGGATCGCGTTCCACTTCAGACAGAA A_73_102406 A_73_102406 FALSE CB170247 CB170247 gb|Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa (EIF2S1) unmapped Unknown CCCTTAAATGTAAGTTACATATCTATTCATTGAAGGAAGTCTAAGCAGTTGTACTGGCAG A_73_102407 A_73_102407 FALSE XM_864269 XM_864269 LOC613463 ref|XM_864269 unmapped Bos taurus similar to Homo sapiens sec1 family domain containing 1 (SCFD1), transcript variant 1 AAGAGCCAGATGTTTCCTTCTCCATATCAATGTCCTAACGGTGAAACTTAGAGGTATTTG A_73_102408 A_73_102408 FALSE XM_609535 XM_609535 LOC531051 ref|XM_609535 unmapped Bos taurus similar to Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 12 (SERPINB12) CTTTTCTCTTTTTCATCAGACACAACAAAACCCAAACCATTCTCTTCTATGGCAGGGTCT A_73_102409 A_73_102409 FALSE AW654419 AW654419 gb|Bos taurus similar to Homo sapiens zinc finger, DHHC-type containing 2 (ZDHHC2) unmapped Unknown TTTTCCCTATTTTGAAATAGTACACATAATCATGCTGGGCCAACTCTGAAGTTACACGCG A_73_102410 A_73_102410 FALSE XM_589413 XM_589413 LOC511983 ref|XM_589413 unmapped Bos taurus similar to Homo sapiens secernin 3 (SCRN3) TTGGAATTGGACATATAGATCATGGATAGTCAGGTGTTGCTTCAGGTATTGATGTATACA A_73_102411 A_73_102411 FALSE CB451968 CB451968 gb|Bos taurus similar to Homo sapiens sorting nexin family member 27 (SNX27) unmapped Unknown ACTTAGTGTAATTAATTGTAACATATTCTTTTAAATAAATTGATTTATTGATGAAACTAA A_73_102412 A_73_102412 FALSE XM_587928 XM_587928 LOC539529 ref|XM_587928 unmapped Bos taurus similar to Homo sapiens ubiquilin 2 (UBQLN2) AACTGCTGTGTATAAAGAAAACTGTATCTTTTGACTCCATCAGTTATTTCTCTTGTGCAC A_73_102413 A_73_102413 FALSE XM_866080 XM_866080 LOC520428 ref|XM_866080 unmapped Bos taurus similar to PREDICTED: Homo sapiens CDC14 cell division cycle 14 homolog C (S. cerevisiae), transcript variant 1 (CDC14C) CATCAGGACCTTTGACAGATAGCTGCTAGTAATTCTTCAGTCCAGTGTTCAGAGCTGTAA A_73_102414 A_73_102414 FALSE XM_869321 XM_869321 LOC617126 ref|XM_869321 unmapped Bos taurus similar to Homo sapiens chromosome X open reading frame 59 (CXorf59) TCAACTCACAAGAACAGGGGTTTCCTCTACGATCAAGGGGGCTCGTTTGATGTTAAACAA A_73_102415 A_73_102415 FALSE XM_585339 XM_585339 LOC539164 ref|XM_585339 unmapped Bos taurus similar to Homo sapiens fibronectin type III domain containing 4 (FNDC4) TCTCACGGGCAGCCCCTCCAGCTGCTGGTGGTCTCACCCCTTGGACATTTTTCCAATAAA A_73_102416 A_73_102416 FALSE XM_593097 XM_593097 LOC540312 ref|XM_593097 unmapped Bos taurus similar to Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B (DDX26B) ATGTGATGCCAGAAAGGCTTCAGGTGGACTTGTGCATTCTGTGCTTCAGAAGCACTAAAA A_73_102417 A_73_102417 FALSE XM_604556 XM_604556 LOC526194 ref|XM_604556 unmapped PREDICTED: Bos taurus similar to KPL2 protein isoform 1 (LOC526194) AGAGATTCACTCGAGTCCCACTGGTCCAACTGGATAGTAAAGATATTTTGGAAAGCCAGC A_73_102418 A_73_102418 FALSE NM_175712 NM_175712 CTBP2 ref|NM_175712 unmapped Bos taurus C-terminal binding protein 2 (CTBP2) GTTTTAGTGTGAGTTACCGTTACTGTATTTGTTTATTGTAAAGGTGGACATTTAGCGTTC A_73_102419 A_73_102419 FALSE BI849764 BI849764 gb|Bos taurus similar to Homo sapiens Notch homolog 3 (Drosophila) (NOTCH3) unmapped Unknown TATAGCTTCTGGTCACAATCCCTGTGTAGCTAAGTCCCCAGGCCTTGCATTGTACAGCCC A_73_102420 A_73_102420 FALSE BE663799 BE663799 gb|Bos taurus similar to Homo sapiens zinc finger protein 83 (ZNF83) unmapped Unknown GAATGTGGTATATGGTAGAAGTCTTCAAAATTCATACCCTACTGTTAGTCAGAGAATTGA A_73_102421 A_73_102421 FALSE XM_607674 XM_607674 LOC529231 ref|XM_607674 unmapped Bos taurus similar to Homo sapiens THO complex 3 (THOC3) TTTCTTTTGTGTTTGATTTGGCTCTTATTCCCTGTCCCTTGCAGTGCCGACACCAGCATA A_73_102422 A_73_102422 FALSE BM286287 BM286287 gb|Unidentified transcripts on BTA19 position 16766943-16767625 unmapped Unknown TTCCAAAGGGTGTCTGGGAAATATCGTTTACTTATGAGTTAAAAAGTCTCTTTTCTCGGA A_73_102423 A_73_102423 FALSE BI538290 BI538290 gb|Bos taurus similar to Homo sapiens complexin 2 (CPLX2), transcript variant 1 unmapped Unknown ACGCAGATGCTAAGATGTACCAAACCAACCATGACACAAAGAAAAGACCTTGTACCGGAC A_73_102424 A_73_102424 FALSE XM_581766 XM_581766 LOC538648 ref|XM_581766 unmapped Bos taurus similar to Homo sapiens zinc finger protein 3 homolog (mouse) (ZFP3) AAGTGTCCACTCTGGACAAAAAAGGATGAGGCACTTTTATGAACTGTTCATTGAGAAGTT A_73_102425 A_73_102425 FALSE BI849462 BI849462 gb|Unidentified transcripts on BTA17 position 619536-619045 unmapped Unknown TGTTTTGATTACAGCTTTTGCTCAACATGTTTTTTAACCCGTCATACGTTGTTTGGGTTG A_73_102426 A_73_102426 FALSE XM_864431 XM_864431 LOC505648 ref|XM_864431 unmapped Bos taurus similar to Homo sapiens phosphoglucomutase 3 (PGM3) CAGTGTACCTTACTGGATTGTTTCTAGGTCTGATTATTTTTCTTAAACACTACCAGAATC A_73_102427 A_73_102427 FALSE NM_001035437 NM_001035437 MGC126931 ref|NM_001035437 unmapped Bos taurus similar to Homo sapiens transmembrane protein 14C (TMEM14C) TGGTCCTTGGGCACATATTGGTATATCTGCAGAAAGGTTTCTGAGAGTTTGTTTGTCATC A_73_102428 A_73_102428 FALSE XM_584594 XM_584594 TRB@ ref|XM_584594 unmapped PREDICTED: Bos taurus T cell receptor, beta cluster, transcript variant 1 (TRB@) TAGCCAGCTTCACCTTCCTCCCATCCTGAACGCACTACTTAAATAAAATCATTTATAAAA A_73_102429 A_73_102429 FALSE NM_176648 NM_176648 CAPZB ref|NM_176648 unmapped Bos taurus capping protein (actin filament) muscle Z-line, beta (CAPZB) GAAAGATAGAAGAAAAACTGGAAATCTGATTCCATGTGTGTTTGGGAGTTGCTTGGGGTT A_73_102430 A_73_102430 FALSE CB423555 CB423555 gb|Unidentified transcripts on BTA3 position 31173380-31174344 unmapped Unknown TGTTAGGGGATGGGTATCGCGTGTCACACTTTTTTGTGAAATAAAAATATACTTTCCAGT A_73_102431 A_73_102431 FALSE XM_614420 XM_614420 LOC534599 ref|XM_614420 unmapped Bos taurus similar to Homo sapiens oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) (OGDH), nuclear gene encoding mitochondrial protein, transcript variant 1 AATCTGAGTTCTCCCTGACCAACATAATTCCCACTTTTCCGTATGAGGGACCACACGTCC A_73_102432 A_73_102432 FALSE XM_592492 XM_592492 LOC514614 ref|XM_592492 unmapped PREDICTED: Bos taurus similar to Kelch-like protein 5 (LOC514614) ACGGCCCATGTTACAGAGTCCTCGGACAAAACCTAGGAAGTCAACTGTTGGTACATTATT A_73_102433 A_73_102433 FALSE CB170039 CB170039 gb|Bos taurus similar to Homo sapiens fibroblast growth factor 2 (basic) (FGF2) unmapped Unknown GTATGAGTGAAACAGTGGGGGGAACATCTACTGAATTTGTATAGTTAAAAATTTTTGCTG A_73_102434 A_73_102434 FALSE XM_880160 XM_880160 LOC507834 ref|XM_880160 unmapped Bos taurus similar to Homo sapiens estrogen- related receptor alpha (ESRRA) CAGGGACATGGGGCAAGCCAGGGCCCAGAGCCCTTGGCTGTACAGAGACTCTATTTTAAT A_73_102435 A_73_102435 FALSE XM_612982 XM_612982 LOC540757 ref|XM_612982 unmapped Bos taurus similar to Homo sapiens transcription factor AP-4 (activating enhancer binding protein 4) (TFAP4) TTTTAAGAACAGGGAAGAAAATCAAACAAAACCCCAAGGTATTTTTGCCCTCTCCGGAGC A_73_102436 A_73_102436 FALSE XM_866342 XM_866342 LOC539902 ref|XM_866342 unmapped Bos taurus similar to Homo sapiens Rho GTPase activating protein 24 (ARHGAP24) GTATGTCATTGCAACTTAGCTTGCTTTCAAGCTTCACCCCTTGCACTTAACATAAGCTAT A_73_102437 A_73_102437 FALSE BM105606 BM105606 gb|Bos taurus similar to Homo sapiens abhydrolase domain containing 2 (ABHD2), transcript variant 1 unmapped Unknown CTTTTGGTTCTGTTTTGATTCTGTGTGGTGGTAAACAAAGATCATTACAAACAAAAGCTG A_73_102438 A_73_102438 FALSE XM_598675 XM_598675 LOC520433 ref|XM_598675 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 168 (C6orf168) AGTCATGAGTGATGTCATCAGAAGGAATGCAGGAGATAAATGTTCTTTGGTGGCCACTTG A_73_102439 A_73_102439 FALSE XM_582858 XM_582858 LOC506413 ref|XM_582858 unmapped Bos taurus similar to Homo sapiens C1q and tumor necrosis factor related protein 6 (C1QTNF6), transcript variant 1 CACGGCTCTTCAAGCGCGAGCGAGATAATGCCGTCTACAGCGACGACATAGACACCTACA A_73_102440 A_73_102440 FALSE XM_871419 XM_871419 LOC619100 ref|XM_871419 unmapped Bos taurus similar to Homo sapiens TP53 regulating kinase (TP53RK) ACTACATTATGTATTGGCATTATATCACACTGTTTTTCAAAGAATTCCAAGGCCACAGAG A_73_102441 A_73_102441 FALSE XM_613487 XM_613487 LOC533920 ref|XM_613487 unmapped Bos taurus similar to Homo sapiens lysophospholipase-like 1 (LYPLAL1) TCTGCTGTTTACCAGGCTCTTCAGAAAAGTGACGGTGTTCTTCCTGAATTATTTCAGTGT A_73_102442 A_73_102442 FALSE XM_586498 XM_586498 LOC539337 ref|XM_586498 unmapped Bos taurus similar to Homo sapiens wingless- type MMTV integration site family, member 10B (WNT10B) CAGCAGGAGGGGTGGGAAAGGCTAATTTATTGTACTGAGACTTGTTCTTGGTTCTTGTTT A_73_102443 A_73_102443 FALSE NM_174837 NM_174837 CYB561 ref|NM_174837 unmapped Bos taurus cytochrome b-561 (CYB561) TTGTTTTGCCTGTGGCCAATCTTCGATGAAGTCCAGTGTAGTGCTGGTACAACAGATGAT A_73_102444 A_73_102444 FALSE XM_581362 XM_581362 LOC505122 ref|XM_581362 unmapped Bos taurus similar to Homo sapiens spectrin, alpha, erythrocytic 1 (elliptocytosis 2) (SPTA1) AAAGACAGCTTTTTCTGGGTCAGAGAACCTTGATGTTGTGGGAAGTATTGGGGGATGAAG A_73_102445 A_73_102445 FALSE CB428837 CB428837 gb|Bos taurus similar to Homo sapiens transmembrane protease, serine 2 (TMPRSS2) unmapped Unknown CTGCTCCCGAGTCAGATTTTAAAAAGCGTCGTCATGGTGAGCAAGCATTCCTTCTTTAGT A_73_102446 A_73_102446 FALSE AW298852 AW298852 gb|Bos taurus similar to Homo sapiens active BCR-related gene (ABR), transcript variant 2 unmapped Unknown TTCTTTGGTCTATGTTCTGTTTCAACTTATGTAGATTATTATAAATTGATGTAAGCCACG A_73_102447 A_73_102447 FALSE XM_870172 XM_870172 LOC617847 ref|XM_870172 unmapped Bos taurus similar to Homo sapiens FLJ46082 protein (FLJ46082) AGTATTCCAAACATGAGATTTCATTTCTCTTTTCGGGGATGCCTGATATCTCTCCATGGC A_73_102448 A_73_102448 FALSE NM_001034705 NM_001034705 RAN ref|NM_001034705 unmapped Bos taurus similar to Homo sapiens RAN, member RAS oncogene family (RAN) TACTTGAATCATTTCACACAAACGTAACGACAAGTCAACAGTATTGTATTTGATGAGAGG A_73_102449 A_73_102449 FALSE NM_001008666 NM_001008666 SLC14A1 ref|NM_001008666 unmapped Bos taurus urea transporter (SLC14A1) TGACTTTCTTCCCATGCCCACACACAGACTTGCAAACAGGAACAGTTTCAAACCTTGTAA A_73_102450 A_73_102450 FALSE XM_582844 XM_582844 LOC538803 ref|XM_582844 unmapped Bos taurus similar to Homo sapiens membrane associated DNA binding protein (MNAB) AAAGATATTACTGGGGGCATCCATTTCCTGTGGACTCTTTGATACTTTAAGCCCTCTTGC A_73_102451 A_73_102451 FALSE XM_872193 XM_872193 LOC513451 ref|XM_872193 unmapped Bos taurus similar to Homo sapiens splicing factor, arginine/serine-rich 11 (SFRS11) TTCCAAGCTTTACTTTTGTGCAGTAAAAACAAAAGTAGGCTACAGTCTGTGCCATGTTGA A_73_102452 A_73_102452 FALSE EE923672 EE923672 gb|Unidentified transcripts on BTA16 position 13675335-13674222 unmapped Unknown TTTTAATTCACACATGGAGTAGAAATCTCCCAGTCTTTCAGGGAGCTGAGGACAGAGATG A_73_102453 A_73_102453 FALSE XM_589467 XM_589467 LOC512029 ref|XM_589467 unmapped Bos taurus similar to Homo sapiens sorting nexin 1 (SNX1), transcript variant 1 TGTGGTTAGGAACTGGGGATAACGTTTTCTGTTACTCCTGACGGTGCCATGAAAAGATTA A_73_102454 A_73_102454 FALSE XM_864693 XM_864693 LOC538969 ref|XM_864693 unmapped Bos taurus similar to Homo sapiens zinc finger protein 24 (ZNF24) AAAGCTCAAATCTTTTTAGACATCAGCGAAGACACAATGCAGAAAAACTTCTCACATGTT A_73_102455 A_73_102455 FALSE XM_585310 XM_585310 LOC508522 ref|XM_585310 unmapped Bos taurus similar to Homo sapiens XPA binding protein 1, GTPase (XAB1) CCTTCATGTCCAATATGCTCTATGCCTGCAGCATCTTATAACAAAACCAAGCTGCCTTTT A_73_102456 A_73_102456 FALSE XM_615351 XM_615351 LOC535305 ref|XM_615351 unmapped Bos taurus similar to Homo sapiens alkB, alkylation repair homolog 7 (E. coli) (ALKBH7) AAGCTGTTCAGGACACCATGTTTGTCAATAAAGTTGTGAATAATGTTGGAGAATGGAAAA A_73_102457 A_73_102457 FALSE XM_605570 XM_605570 LOC527180 ref|XM_605570 unmapped PREDICTED: Bos taurus similar to gamma- aminobutyric acid (GABA) receptor, theta precursor (LOC527180) CTCCTCTTCCCTCTTGCCTTCGTGGTGTTCAACATTGTGTACTGGGTGTATCATATCTAT A_73_102458 A_73_102458 FALSE CB429683 CB429683 gb|Bos taurus similar to Homo sapiens ATM/ATR-Substrate Chk2-Interacting Zn2+-finger protein (ASCIZ) unmapped Unknown TTGACGATACAGTTACTTCGATTCTTTGAGGTTCTTTGCCTTTTTGTACTTGTAAACATG A_73_102459 A_73_102459 FALSE CB441572 CB441572 gb|Unidentified transcripts unmapped Unknown ATCACAGATTCCTGATTGTCAAATTCTGCTGGGCACATTAAAGCCATCCCTTTCCAAAAA A_73_102460 A_73_102460 FALSE XM_603478 XM_603478 LOC525131 ref|XM_603478 unmapped PREDICTED: Bos taurus similar to KIAA0319 (LOC525131) AGAGAGGATGGAGCGAGGGAATCCGAAGGTTTCCATGAACGGATCCATCAGAAACGGAGT A_73_102461 A_73_102461 FALSE XM_601230 XM_601230 LOC522941 ref|XM_601230 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to olfactory specific medium-chain acyl CoA synthetase (LOC341392) ACAATCACTGGGAAAATCAAACGCAACGTTTTAAGAGACCATGAATGGGGTCGAACATAG A_73_102462 A_73_102462 FALSE XM_581800 XM_581800 LOC505507 ref|XM_581800 unmapped Bos taurus similar to Homo sapiens ribosomal protein S7 (RPS7) CACGGGCAAGGATGTTAATTTTGAATTCCCAGAGTTTCAGTTGTAAACAAACGACTAAAT A_73_102463 A_73_102463 FALSE XM_581340 XM_581340 LOC505102 ref|XM_581340 unmapped Bos taurus similar to Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor- like 2 (NFKBIL2) CACCTCTGACTGGCCAGCCCCATGGTGTGCCCTGCCCAGGCCTCTAATAAAGAAGCCACT A_73_102464 A_73_102464 FALSE XM_611376 XM_611376 LOC511144 ref|XM_611376 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 116 (C20orf116) GGCAGATGGAGTGTGGCCAGGCAGTTACAGATTAAAGGCTCTATCAGTACTCCTAAAAAA A_73_102465 A_73_102465 FALSE NM_174295 NM_174295 CSPG6 ref|NM_174295 unmapped Bos taurus chondroitin sulfate proteoglycan 6 (bamacan) (CSPG6) CCATTGGTCTGGAAGATGTGTAAAGTAATATGATCCTTTTACCCAGGAACTGTAAATTTA A_73_102466 A_73_102466 FALSE XM_612826 XM_612826 LOC533426 ref|XM_612826 unmapped Bos taurus similar to Homo sapiens chromosome 18 open reading frame 37 (C18orf37) TCTGTTTTCCCTCCAAGTGTGATATTTCCTGTTGAATTAAATTATACTTCAGTTGTTGCC A_73_102467 A_73_102467 FALSE CB420240 CB420240 gb|Bos taurus similar to Homo sapiens glucosamine-6-phosphate deaminase 2 (GNPDA2) unmapped Unknown AATGACTTGGGTTCGTGCACTTAATATACGTATTTTGGCAATTATGAGCTTTATACCTAG A_73_102468 A_73_102468 FALSE XM_865250 XM_865250 LOC613983 ref|XM_865250 unmapped Bos taurus similar to Homo sapiens homeobox D11 (HOXD11) GTGGCCTTCCGCGACTACGGCCTGGAGCGCGCCAAGTGGCCATACCGCGGCGGCGGCGGC A_73_102469 A_73_102469 FALSE XM_607008 XM_607008 LOC528582 ref|XM_607008 unmapped Bos taurus similar to Homo sapiens cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase) (CCBL1) AGTCCTCAAGCCAGTACTTTTTGCCCACAATAAAGTTTTAAGCTATTCAGACCCTTAAAA A_73_102470 A_73_102470 FALSE XM_591447 XM_591447 LOC513712 ref|XM_591447 unmapped Bos taurus similar to Homo sapiens golgi apparatus protein 1 (GLG1) GCAGACTCGGGTTTCCCTGTCCAGAGACAAGTCTCTCATCCGGATGGACCTACCAGTACT A_73_102471 A_73_102471 FALSE XM_588011 XM_588011 LOC510807 ref|XM_588011 unmapped Bos taurus similar to Homo sapiens nuclear factor (erythroid-derived 2)-like 3 (NFE2L3) AATGCAATTTAACCTTAAGGTTCTTTCACTTAGCACTGAAGTTGGGTGTTTTTTCAAGAG A_73_102472 A_73_102472 FALSE NM_001034749 NM_001034749 SPTLC1 ref|NM_001034749 unmapped Bos taurus similar to Homo sapiens serine palmitoyltransferase, long chain base subunit 1 (SPTLC1), transcript variant 1 GTGCCTTGTGATTGCTGCTGCTTTAAAAGATACAGTACTCTGGGGGATGAATCTGTTCTG A_73_102473 A_73_102473 FALSE XM_880718 XM_880718 LOC540770 ref|XM_880718 unmapped Bos taurus similar to Homo sapiens thyroid hormone receptor associated protein 2 (THRAP2) TTTTTTAATGGGCTGTTTTTAATGCAGGGGCTTTTCTTCTCTAGAAACCCAATTCTCAGC A_73_102474 A_73_102474 FALSE XM_614530 XM_614530 LOC534678 ref|XM_614530 unmapped Bos taurus similar to Homo sapiens transmembrane protein 163 (TMEM163) TTGTACGTTCAGAGCCCAAACATATATGTGTAAACACAGGATCCCTTTGGAGAGATGTGA A_73_102475 A_73_102475 FALSE XM_591630 XM_591630 LOC513873 ref|XM_591630 unmapped Bos taurus similar to Homo sapiens NADPH dependent diflavin oxidoreductase 1 (NDOR1) CAGCACCGGCTCCGGGCGCTCGGGCCGCTGGTGTGGGAGCTGCTGGACGGCCGGGGCGCC A_73_102476 A_73_102476 FALSE XM_609625 XM_609625 LOC531139 ref|XM_609625 unmapped Bos taurus similar to Homo sapiens ubiquitin specific peptidase 40 (USP40) GGTTGAAGACGATGATGATTTCAGTACCGTCCAAGACTACATCGGAAGAGAAAAACTGAA A_73_102477 A_73_102477 FALSE NM_001035493 NM_001035493 HSF2BP ref|NM_001035493 unmapped Bos taurus similar to Homo sapiens heat shock transcription factor 2 binding protein (HSF2BP) TGGTCACAGCAGTGTGTTTCAGCAGGTTTACCTTATGTAAATAACTGGGAAACTGGGAAG A_73_102478 A_73_102478 FALSE XM_587911 XM_587911 LOC510731 ref|XM_587911 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 1, subfamily J, member 4 (OR1J4) AACAGAGACATGAAATCGGCCCTGGGAATTCTATACAAGAAGGGGATTATTTTTGCCAAG A_73_102479 A_73_102479 FALSE XM_592419 XM_592419 LOC514550 ref|XM_592419 unmapped Bos taurus similar to Homo sapiens zinc finger, CW type with PWWP domain 1 (ZCWPW1) GGTTAACTTGTTTGGTTTCTGGAGCCGATACAGTGGACCTGACAATGATGGGGAAGAAAA A_73_102480 A_73_102480 FALSE NM_001017951 NM_001017951 TRIM54 ref|NM_001017951 unmapped Bos taurus tripartite motif-containing 54 (TRIM54) ACCTGGAGAAGCAGCTCATTTGCCCCATCTGCCTGGAGATGTTCTCCAAACCGGTGGTGA A_73_102481 A_73_102481 FALSE NM_177490 NM_177490 ZFX ref|NM_177490 unmapped Bos taurus zinc finger protein X-linked (ZFX) AAATCATATAGGGATGTGTGACATTATTGTAATTGTGTACTTGAGAATAACGTGCAAAAA A_73_102482 A_73_102482 FALSE XM_868508 XM_868508 LOC616476 ref|XM_868508 unmapped Bos taurus similar to PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein U-like 2 (HNRPUL2) GCAGAGAGCAAGCTTGTGACTGGGGCAGTGAAAATAAACGATTGGCTCTTATCAATCACT A_73_102483 A_73_102483 FALSE XM_876301 XM_876301 LOC507149 ref|XM_876301 unmapped Bos taurus similar to Homo sapiens cyclin- dependent kinase 8 (CDK8) CGTTGTTTAGGGTGCCCTTACTTCAGCAAAGAAGAAGGAGTAGGAGAGCCTTAGACTTTT A_73_102484 A_73_102484 FALSE AW431688 AW431688 gb|Unidentified transcripts unmapped Unknown TTAAATAATGGGCTGTAAGAAAACCTCAGTGTCATGGACATGAATAAAACTGAAACATCC A_73_102485 A_73_102485 FALSE NM_001014934 NM_001014934 CDK2 ref|NM_001014934 unmapped Bos taurus cyclin-dependent kinase 2 (CDK2) AGGCGGAATTGAAAGGACGCTTCAGTATTAGATGCACTTAAGTCAGCCTCCACTACCCTC A_73_102486 A_73_102486 FALSE XM_865241 XM_865241 LOC613972 ref|XM_865241 unmapped Bos taurus similar to Homo sapiens apolipoprotein D (APOD) GCGTTTTCAGCACAAATATAAAATACTCATTTCCTGGAGCGTTTGAGACTCTTCACTGCT A_73_102487 A_73_102487 FALSE XM_588991 XM_588991 LOC511618 ref|XM_588991 unmapped PREDICTED: Bos taurus similar to leucine rich repeat containing 21 (LOC511618) CAGACTCCCTCTGGGAAGATGATTTGGCAAAAGAGACTTATATCCAGTTTGAGACGCTGT A_73_102488 A_73_102488 FALSE CB458916 CB458916 gb|Unidentified transcripts unmapped Unknown AACGACATGATTTCATCAGCGACACATAAACGAATACATAAATAAATAATTCGAAAATCA A_73_102489 A_73_102489 FALSE EE900078 EE900078 gb|Unidentified transcripts unmapped Unknown AAAGGAACAGGTGGAGCTTATGTTTTTGGATTGACCACCTCATTGATATTGATAAATGAA A_73_102490 A_73_102490 FALSE NM_001034723 NM_001034723 MGC128838 ref|NM_001034723 unmapped Bos taurus similar to Homo sapiens peroxisomal LON protease like (LONPL) AATGTCCCTGATTTGTGAATGTAATCACAGCAGTAACAAGCCTCACTCAAGTGGTGGCTA A_73_102491 A_73_102491 FALSE NM_001034287 NM_001034287 TM4SF18 ref|NM_001034287 unmapped Bos taurus similar to Homo sapiens transmembrane 4 L six family member 18 (TM4SF18) TTTTTTCCCTCCAGATGGTGTTTGCTGTCCTCACTGGAATGCCGTCCTTCCTTTTAAAAT A_73_102492 A_73_102492 FALSE XM_581298 XM_581298 LOC505068 ref|XM_581298 unmapped Bos taurus similar to Homo sapiens translocation associated membrane protein 1-like 1 (TRAM1L1) TAACTCCAAAATTCATGTGTCAGTGACACAGTTCTTACTCCTGCCAATCTTTTGTAATGT A_73_102493 A_73_102493 FALSE BP107681 BP107681 gb|Unidentified transcripts unmapped Unknown GGTCAAGTAGACAAAATCAGATGGATCCGGAAGATTCAGATGAGAGTGTTTATAAGCTTG A_73_102494 A_73_102494 FALSE XM_610028 XM_610028 LOC531530 ref|XM_610028 unmapped PREDICTED: Bos taurus similar to pancreas- enriched phospholipase C (LOC531530), partial mRNA. ATCAGAAGAAAAATGGTCTCTTATTGCCTCCTGGGAGAGTCATGGAACGGCTGTCAACAA A_73_102495 A_73_102495 FALSE NM_001015575 NM_001015575 RNF25 ref|NM_001015575 unmapped Bos taurus ring finger protein 25 (RNF25) ACAGGGAATTGGGTCGGGAATGGGTAATAAAGAGATTGGCCTTGTTTGGCTTTCCTTACT A_73_102496 A_73_102496 FALSE NM_174078 NM_174078 GUK1 ref|NM_174078 unmapped Bos taurus guanylate kinase 1 (GUK1) CATGCCCTGTCAACCCCTTACCCGTGGAAGCCAGGCCAACATCCAAATAAAGAACTGCTG A_73_102497 A_73_102497 FALSE NM_001035070 NM_001035070 ASB14 ref|NM_001035070 unmapped Bos taurus similar to Homo sapiens ankyrin repeat and SOCS box-containing 14 (ASB14) GAAGGCTGGACATCTACAGTTATCAAAGATACAATGGTAAGTACACACCATAGCAGCTGT A_73_102498 A_73_102498 FALSE AV590739 AV590739 gb|Unidentified transcripts on BTA15 position 13552325-13552821 unmapped Unknown CTTTACAAGACACTTAGCATCTGCTTCTCTTCACTTGTGGGGGGAACTATGTATTCATAT A_73_102499 A_73_102499 FALSE XM_612160 XM_612160 LOC540574 ref|XM_612160 unmapped Bos taurus similar to Homo sapiens topoisomerase (DNA) II binding protein 1 (TOPBP1) CCAAGTGTGTAGTTTAGTGGAAGTTTGAGCAAGGTGTTAGATTTTGCCTTAAAATGTCTG A_73_102500 A_73_102500 FALSE NM_001024574 NM_001024574 NFIC ref|NM_001024574 unmapped Bos taurus nuclear factor I/C (CCAAT-binding transcription factor) (NFIC) TCCTTTCAACAGCCCATTTTCCCAGGACTCACCTTGCCTTTTCAGCTTTACCCAGCACCA A_73_102501 A_73_102501 FALSE BE588479 BE588479 gb|Bos taurus similar to Homo sapiens dishevelled associated activator of morphogenesis 2 (DAAM2) unmapped Unknown TTTCAGACGACAGATGAGGCTAATGTACAAAATCTGCAGTGTCCTTTTCGCCTGCACCTT A_73_102502 A_73_102502 FALSE XM_583977 XM_583977 SLC2A5 ref|XM_583977 unmapped PREDICTED: Bos taurus solute carrier family 2 (facilitated glucose/fructose transporter), member 5, transcript variant 1 (SLC2A5) GGAGCTTACAGCTTCGTCATTTTTGCGGTGATATGTCTCCTCACCACCATCTACATCTAA A_73_102503 A_73_102503 FALSE XM_582296 XM_582296 LOC408016 ref|XM_582296 unmapped PREDICTED: Bos taurus caspase-3 (LOC408016) CTGTAACTTTTTCTGAGTAAATGAAGCATGCTATGGTATCAGAAGGTATGTTCCTATGTG A_73_102504 A_73_102504 FALSE XM_610211 XM_610211 LOC531710 ref|XM_610211 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 5, member C (FAM5C) GTTCCGTGGCAATGCTTTTGTGCATTACATCCTCTAGAGGGAACATAAAAAGATACCAAT A_73_102505 A_73_102505 FALSE XM_603516 XM_603516 LOC525169 ref|XM_603516 unmapped PREDICTED: Bos taurus similar to bromodomain and WD repeat domain containing 2 (LOC525169) AAGGCTCAGTGCTCTCATTTCTGTCTTTGTGTTCTTCCAATGACTGAACTATATGAAATA A_73_102506 A_73_102506 FALSE XM_584199 XM_584199 LOC507563 ref|XM_584199 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 10, subfamily A, member 3 (OR10A3) TCCACTGATCTACAGCTTGCGAAACAGTGAGATGAAAAGAGCTTTGATGAAATTATGGCG A_73_102507 A_73_102507 FALSE XM_587330 XM_587330 NFKBIA ref|XM_587330 unmapped PREDICTED: Bos taurus nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha, transcript variant 1 (NFKBIA) GTGGGGTTAAAAGTCACTACCTGTCAAGGTGTGTGTTCCCCTCCTGTAAATAGTGTACAT A_73_102508 A_73_102508 FALSE XM_610522 XM_610522 LOC532015 ref|XM_610522 unmapped Bos taurus similar to Homo sapiens elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 (ELOVL4) TCTAAATTATTCCCTGCTGCCAATTTCTAATGTAGACAAGAAATGAAACTAGAACTTCGG A_73_102509 A_73_102509 FALSE CB462451 CB462451 gb|Bos taurus similar to Homo sapiens mitogen activated protein kinase binding protein 1 (MAPKBP1) unmapped Unknown TACACCCCAGGTCTCACAGGGCAGAGGCTGTTTTTAACATGTCCGTTTGTATTGATGTAT A_73_102510 A_73_102510 FALSE XM_866692 XM_866692 LOC510504 ref|XM_866692 unmapped Bos taurus similar to Homo sapiens glycosyltransferase-like 1B (GYLTL1B) TCCCCTGCCGCAAACCCAACACCATGAGCCTGAGAGACTTTATTTGGCTTTATTTAGTAA A_73_102511 A_73_102511 FALSE NM_001038180 NM_001038180 MGC134075 ref|NM_001038180 unmapped Bos taurus similar to Homo sapiens outer dense fiber of sperm tails 2 (ODF2), transcript variant 1 TACAAAAGCTTTTATAATCAATATTTAAGTTTCCACGGGATAGTCTCCTTTACCCACACG A_73_102512 A_73_102512 FALSE XM_613916 XM_613916 LOC534225 ref|XM_613916 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 107 (C6orf107) AGCCAACCAGGATAAAGAAAAACTTCTTGAAGAGATTAGGAAATATAACCCCCTCTTTGA A_73_102513 A_73_102513 FALSE CB426068 CB426068 gb|Bos taurus similar to Homo sapiens vestigial like 4 (Drosophila) (VGLL4) unmapped Unknown CAGTGCGTTCAGACCATTCTCTCCGTGTTTGTAAATCTGTAATATACCATTCTCTGTGGC A_73_102514 A_73_102514 FALSE XM_612191 XM_612191 LOC532963 ref|XM_612191 unmapped Bos taurus similar to Homo sapiens protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1) TGCTGTGTAAGCTGTGTCCTAGTTACTGAACAGTTTATGCAGTGCTGCTTTGCCAAATAA A_73_102515 A_73_102515 FALSE XM_869355 XM_869355 LOC617154 ref|XM_869355 unmapped Bos taurus similar to Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14B (PPP1R14B) TTTATATTGACTGCGGCGCGGGCCCTTTAATAAAGCTAGGATACGCCTTTGGTGCAGTCC A_73_102516 A_73_102516 FALSE XM_585092 XM_585092 LOC508330 ref|XM_585092 unmapped Bos taurus similar to Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) (MLL) AGGTAAACAGTAAGGTCCTACCATATAGCACAGGGAACCATATTCAATCCTGTAATAAAC A_73_102517 A_73_102517 FALSE NM_174819 NM_174819 NDUFS3 ref|NM_174819 unmapped Bos taurus NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) (NDUFS3) CATGTGGATCCTAGAAAGCACCTTACCTATAATTGAGTGTCCTGTAAATAAAATCCTACT A_73_102518 A_73_102518 FALSE XM_612859 XM_612859 LOC540731 ref|XM_612859 unmapped Bos taurus similar to Homo sapiens PR domain containing 4 (PRDM4) GAGTGGAGAGGACTCTGGTGGGAAGGTTTTGCTGCTAATGTATTTATGGAATGAATGTAT A_73_102519 A_73_102519 FALSE XM_614134 XM_614134 LOC534383 ref|XM_614134 unmapped Bos taurus similar to Homo sapiens F-box protein, helicase, 18 (FBXO18), transcript variant 1 AAACAAAACAAAACATTTTATGTATTTAAACTTTTATTACAAGGTCTCAATTAAACAGGC A_73_102520 A_73_102520 FALSE XM_584353 XM_584353 LOC507694 ref|XM_584353 unmapped Bos taurus similar to Homo sapiens ubiquitin- conjugating enzyme variant Kua (Kua) GGGGTGGAAAACAAGTTAACAAATTCCCAAAACGCCCACAACCCCCTTACCAAATGGGGC A_73_102521 A_73_102521 FALSE XM_870561 XM_870561 LOC618232 ref|XM_870561 unmapped Bos taurus similar to Homo sapiens PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich- associated protein (PCQAP), transcript variant 2 GTGCATTACCGTGTCTTCTGTGGTTCTTATAATAAATTTATCATTCCTGTGTTTGTCATG A_73_102522 A_73_102522 FALSE NM_001033936 NM_001033936 HF1 ref|NM_001033936 unmapped Bos taurus similar to Homo sapiens complement factor H (CFH), transcript variant 1 ATTGAGAGATGGGTCCAATGAATCACTTCTTAAAAGTACCTCATTAAACTCGGCAAACCA A_73_102523 A_73_102523 FALSE XM_587820 XM_587820 LOC510653 ref|XM_587820 unmapped Bos taurus similar to Homo sapiens LysM, putative peptidoglycan-binding, domain containing 1 (LYSMD1) TGGAGCAGTTCTATTGGCAAGAGTAGGGGATGGGAAATAGACCCCTTCTCTGTTCTTGGG A_73_102524 A_73_102524 FALSE NM_174117 NM_174117 MYH1 ref|NM_174117 unmapped Bos taurus myosin, heavy polypeptide 1, skeletal muscle, adult (MYH1) TTATCATCTATCCTACTCTACTGCAAAGGAAATAAAGAGCATAGGGCACTGTATAAGCAA A_73_102525 A_73_102525 FALSE XM_581693 XM_581693 LOC538641 ref|XM_581693 unmapped Bos taurus similar to Homo sapiens proline rich 7 (synaptic) (PRR7) TGGCTTTCAGACTTGACCTGGTTTTCGTTTTGCCTCTAAAACAGGGATGACCGCGGCCTC A_73_102526 A_73_102526 FALSE CB445860 CB445860 gb|Unidentified transcripts unmapped Unknown TTAAAGACCGGAAATGCTGGTCATCTTAGTTTTTTGTCTGGTGCTTTCTGTATAATGATG A_73_102527 A_73_102527 FALSE XM_871210 XM_871210 LOC618893 ref|XM_871210 unmapped Bos taurus similar to Homo sapiens mitogen- activated protein kinase 8 interacting protein 2 (MAPK8IP2), transcript variant 1 GCGCCTTCCTGGAGTACTACCAGCAGCATCTGGAGTACGCCTGCCCCACAGAGGACATCT A_73_102528 A_73_102528 FALSE XM_878699 XM_878699 LOC522105 ref|XM_878699 unmapped PREDICTED: Bos taurus similar to AT hook, DNA binding motif, containing 1, transcript variant 2 (LOC522105) GTGGATTGTATATTGCATTCTGTAAACCTGCTGTGGTCCCGTGGTGTGCAAATTCGCATG A_73_102529 A_73_102529 FALSE XM_616129 XM_616129 LOC536011 ref|XM_616129 unmapped Bos taurus similar to Homo sapiens Cdon homolog (mouse) (CDON) TACAAATATAATGGCTTTCCAGGAGAGAATTTTGGTCGAATTGACAGAGTAGAATTCATG A_73_102530 A_73_102530 FALSE NW_928453 NW_928453 gb|Putative orthologue of human miRNA hsa-mir-15a on chr 13, (-) strand. Mature length 22 nt, stem-loop length 83 nt. Source: NW_928453.1:c173739-173657 unmapped Unknown TAGCAGCACATAATGGTTTGTGTATCCTACTATACGTATCACATA A_73_102531 A_73_102531 FALSE XM_610589 XM_610589 LOC532079 ref|XM_610589 unmapped Bos taurus similar to Homo sapiens zinc finger protein 19 (ZNF19) AGAGAAGCCTGTGCTGGATGTTGGTTGTTTTGGGCTCCCAGAATTTTTTACCCCCTTTTA A_73_102532 A_73_102532 FALSE XM_870665 XM_870665 CENPC1 ref|XM_870665 unmapped Bos taurus similar to Homo sapiens centromere protein C 1 (CENPC1) TGCTCTTGGGGATATACAGACAAACCTTGGAAATGTCATGGGTTGATTTCAGACCACCAC A_73_102533 A_73_102533 FALSE XM_589654 XM_589654 LOC512193 ref|XM_589654 unmapped Bos taurus similar to Homo sapiens BTB (POZ) domain containing 12 (BTBD12) ACAGTTCTTTGTTACCTGGTTTTGCCAGTACGTGTGGTAGCTGTGGAACACAGGTGAGGG A_73_102534 A_73_102534 FALSE U63639 U63639 gb|Bos taurus IgG3 heavy chain, constant region unmapped Unknown ACTACACGTGTGCAGTGATGCACGAAGCTTTACGGAATCACTACAAAGAGAAGTCCATCT A_73_102535 A_73_102535 FALSE CB167779 CB167779 gb|Bos taurus similar to Homo sapiens kelch-like 18 (Drosophila) (KLHL18) unmapped Unknown CCTCCCCCCAATTTATTGTTTCCCAGAAAACCTTCATTCCTTTTATTTATAGAACGCATG A_73_102536 A_73_102536 FALSE XM_608822 XM_608822 LOC530353 ref|XM_608822 unmapped Bos taurus similar to Homo sapiens TruB pseudouridine (psi) synthase homolog 1 (E. coli) (TRUB1) TGAGCAAGTTTTGAGCTGTGAGTGTATAACTCTGAATGAGACAAAGGGAGAAGACGATGT A_73_102537 A_73_102537 FALSE XM_605463 XM_605463 LOC527075 ref|XM_605463 unmapped Bos taurus similar to Homo sapiens enamelin (ENAM) CCACTTAATGCAGATGATCACACTCCATTTGATCCTCTTCAAGTAGGGACCAATCCACAG A_73_102538 A_73_102538 FALSE XM_878685 XM_878685 LOC510183 ref|XM_878685 unmapped Bos taurus similar to Homo sapiens EH-domain containing 3 (EHD3) CGTATCTACAATGTGCTTACTACTGCAGTGCATTTGTCATTAGTATTCATGTTAATACAG A_73_102539 A_73_102539 FALSE XM_600355 XM_600355 LOC522082 ref|XM_600355 unmapped PREDICTED: Bos taurus similar to Rho-GTPase- activating protein 6 (Rho-type GTPase-activating protein RhoGAPX-1) (LOC522082), partial mRNA. TCCAGCAGAGAAAGTTCCAGTCCCCACCCGACAGCCACGGCCAACCCTATGTCGTGTGGA A_73_102540 A_73_102540 FALSE XM_592679 XM_592679 LOC540252 ref|XM_592679 unmapped Bos taurus similar to Homo sapiens fem-1 homolog b (C. elegans) (FEM1B) TTAATCACAGCCAATAGAATTATGTGTTCATAAATTGTACTTTTCTTCCCACTACCCTCC A_73_102541 A_73_102541 FALSE XM_618568 XM_618568 LOC538365 ref|XM_618568 unmapped Bos taurus similar to Homo sapiens solute carrier family 35, member F3 (SLC35F3) TCTTGGAATCGTCCTCAGCGTACCTGTGAATGCAGTGGTTGATCATTACACCAGTAAGAT A_73_102542 A_73_102542 FALSE CB426453 CB426453 gb|Unidentified transcripts unmapped Unknown CCTCCTGCTTTATTCTTTGGCTAGGTTTTGAGGCTTGTTTTCTCTTGGGCTTTTCTTGCA A_73_102543 A_73_102543 FALSE XM_613617 XM_613617 LOC534013 ref|XM_613617 unmapped Bos taurus similar to Homo sapiens transmembrane protein 68 (TMEM68) AGAAAAACAAGCTCTTTCCTCTGCTTCTCATTCCTTTCATGACCTTCAGCAAATCACATA A_73_102544 A_73_102544 FALSE NM_001038509 NM_001038509 MGC133692 ref|NM_001038509 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 72 (C6orf72) TGATTGTATCCTGTACCAAGACTACTTACCTTGAATGAACCAGGATTTTAAAATAGTGAC A_73_102545 A_73_102545 FALSE NM_001015624 NM_001015624 HRMT1L2 ref|NM_001015624 unmapped Bos taurus HMT1 hnRNP methyltransferase-like 2 (HRMT1L2) GGGGGGCACATCGTGACTGTGTTTTTCATAACTTATGTTTTTATATGGTTGCATTTACGC A_73_102546 A_73_102546 FALSE XM_580345 XM_580345 LOC504257 ref|XM_580345 unmapped Bos taurus similar to Homo sapiens short coiled-coil protein (SCOC) GCATCTCTTTGTGACCTAATTTTCAAACATTTAAAATTGTGTTGCAGTTACGCTTTGCTG A_73_102547 A_73_102547 FALSE BI774268 BI774268 gb|Bos taurus similar to PREDICTED: Homo sapiens pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2, transcript variant 2 (PLEKHA2) unmapped Unknown GGCTGAGCTGAGTGCATGGAAACTCTTAAGCTTCTCATTTTATGTGATCTCCTAATTGGT A_73_102548 A_73_102548 FALSE XM_585196 XM_585196 LOC508424 ref|XM_585196 unmapped Bos taurus similar to Homo sapiens pim-2 oncogene (PIM2) TTCTCCCCCCTGCCTGGATTATTTAAAAAGCCCATGCGTGGAAACCCCACTATTTAATAA A_73_102549 A_73_102549 FALSE XM_585400 XM_585400 LOC508604 ref|XM_585400 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 1, subfamily J, member 4 (OR1J4) ACAATTATTGGACTGTATTTTTTCCCCTCATCCAGCACCTCCAGGGACAAGAGCACCATT A_73_102550 A_73_102550 FALSE AV667221 AV667221 gb|Unidentified transcripts on BTA5 position 67775861-67777575 unmapped Unknown GTGGAGTTTACAGAAAACAACTGACCTACAAAGGGGAATGGGCCATTTTATGCGCAATAA A_73_102551 A_73_102551 FALSE XM_588270 XM_588270 LOC511023 ref|XM_588270 unmapped Bos taurus similar to Homo sapiens signal transducer and activator of transcription 2, 113kDa (STAT2) ATGCCTCCAAAGCACTGCTAGGCCAATTAACTACCTTAATTGAGCTATTGCTGCCCAAGT A_73_102552 A_73_102552 FALSE XM_866949 XM_866949 LOC520470 ref|XM_866949 unmapped PREDICTED: Bos taurus similar to Import inner membrane translocase subunit TIM44, mitochondrial precursor (LOC520470) CTCTGCCAAGACAAGGACAAGCTAAACCCCTATGTGGACGGGCAGCTCCTGGACATTTCC A_73_102553 A_73_102553 FALSE NM_001035060 NM_001035060 SFXN4 ref|NM_001035060 unmapped Bos taurus similar to Homo sapiens sideroflexin 4 (SFXN4), transcript variant 2 TCTATTTGTTTGTCAGCCTGTGAAAGGATACTGTGAAATCACCAATAAACTTGTCTATAG A_73_102554 A_73_102554 FALSE XM_585326 XM_585326 LOC508538 ref|XM_585326 unmapped PREDICTED: Bos taurus similar to FYVE, RhoGEF and PH domain containing 4 (LOC508538) ACACTTATTTTGCCTCGCGGACAAGTATAAATGTATCTCTTCCTTCTGACTCTCTGGGCC A_73_102555 A_73_102555 FALSE NM_176618 NM_176618 PAG7 ref|NM_176618 unmapped Bos taurus pregnancy-associated glycoprotein 7 (PAG7) TGGAACCCCGTGGCTGTGGCGCCGATAGATCCTCTGTATGTATCAATCAGTTCTTCCCCT A_73_102556 A_73_102556 FALSE XM_867342 XM_867342 LOC615511 ref|XM_867342 unmapped Bos taurus similar to Homo sapiens hypothetical protein BC011824 (LOC113179) TCCTTAGCATTCCTCACATCGCCAGGGGCTTTTGCCCGGTCTCAACTCATGGACACTCAT A_73_102557 A_73_102557 FALSE BI537887 BI537887 gb|Bos taurus similar to Homo sapiens splA/ryanodine receptor domain and SOCS box containing 4 (SPSB4) unmapped Unknown ACGGCACTGCCTCCTGCCACCTTAATGTGAATTGACTGATGAATGAAGAGCGTTTCTAAT A_73_102558 A_73_102558 FALSE XM_876745 XM_876745 LOC533499 ref|XM_876745 unmapped Bos taurus similar to Homo sapiens MMS19-like (MET18 homolog, S. cerevisiae) (MMS19L) TCGTCTTGGGGCTCTTCCATTTATATGTCAGAAAAAAGGAGCTATGCTGCTGAGGGTGAA A_73_102559 A_73_102559 FALSE NM_174064 NM_174064 GDI1 ref|NM_174064 unmapped Bos taurus GDP dissociation inhibitor 1 (GDI1) TGCCCACCCTATTCCTTCCCATTAGTGGTGGGAAATCCTTATCTTGCAAAGTGAATGTGT A_73_102560 A_73_102560 FALSE NM_001040497 NM_001040497 EGR4 ref|NM_001040497 unmapped Bos taurus similar to Homo sapiens early growth response 4 (EGR4) TGGAGAGCTGTGTGCGCAGTTTCGCGCGCTCCGACGAGCTCAACCGCCACCTGCGCATCC A_73_102561 A_73_102561 FALSE XM_612086 XM_612086 LOC540560 ref|XM_612086 unmapped Bos taurus similar to Homo sapiens amiloride- sensitive cation channel 5, intestinal (ACCN5) TCTACTTTTCCAAGCCAAAAAGCTTTGAAATATCTTTCCAAGAAGTTGAATCAAAGCCAG A_73_102562 A_73_102562 FALSE XM_866674 XM_866674 LOC614998 ref|XM_866674 unmapped Bos taurus similar to Homo sapiens ribonucleoprotein, PTB-binding 2 (RAVER2) AAAGAAGAGAGTGTACTGAGTTAAGTTCTCTCCTTATAAACTCATAAGGTTCTTTGCAGT A_73_102563 A_73_102563 FALSE XM_863831 XM_863831 SMC4L1 ref|XM_863831 unmapped Bos taurus similar to Homo sapiens structural maintenance of chromosomes 4 (SMC4), transcript variant 1 AACGGAACTACATCAAAGGGATTTGACTTAGGTAGCTAGGCAGACTCCCCTTACAATTCA A_73_102564 A_73_102564 FALSE XM_592513 XM_592513 LOC514631 ref|XM_592513 unmapped Bos taurus similar to Homo sapiens cell division cycle associated 7-like (CDCA7L) GAGAGACACGGGTTACAAGCGTGCTGGTGTAGGCAATAAATGTTCTGGTTTTGTCACTTT A_73_102565 A_73_102565 FALSE XM_616238 XM_616238 LOC536117 ref|XM_616238 unmapped Bos taurus similar to Homo sapiens centrosomal protein 152kDa (CEP152) GTCACACAGAAAGCAAATCAAACAATCTAAAAACGATCCCCAGAAGTATGTGCGACCAAG A_73_102566 A_73_102566 FALSE AW356108 AW356108 gb|Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L34 (MRPL34), nuclear gene encoding mitochondrial protein unmapped Unknown TGTCTTATAAAATGTCATAATTCCCACAAGTTCTAGGAAGGCTTGTGAGCGGTGGAAGGG A_73_102567 A_73_102567 FALSE XM_594574 XM_594574 LOC516421 ref|XM_594574 unmapped PREDICTED: Bos taurus similar to solute carrier family 15 (H+/peptide transporter), member 2 (LOC516421) AGGCGGCCTGGTTGTTGACTATAGCATTTGGGAATATCATCGTGATTATTGTGGCACAGT A_73_102568 A_73_102568 FALSE XM_866673 XM_866673 LOC614997 ref|XM_866673 unmapped PREDICTED: Bos taurus similar to RNA-binding protein LIN-28 (LOC614997) GGAGGCCGTGGAGTTCACCTTTAAGAAGTCCGCCAAAGGCCTGGAATCTATCCGAGTCAC A_73_102569 A_73_102569 FALSE XM_585380 XM_585380 LOC508586 ref|XM_585380 unmapped Bos taurus similar to Homo sapiens SCO cytochrome oxidase deficient homolog 1 (yeast) (SCO1), nuclear gene encoding mitochondrial protein AAGAAGAATGCAGAAATAGCTGGTTCAATTGCTGCACACATGAGGACCCACAGGAAAAAG A_73_102570 A_73_102570 FALSE XM_586754 XM_586754 LOC509728 ref|XM_586754 unmapped PREDICTED: Bos taurus similar to putative UST1-like organic anion transporter (LOC509728) ACCAGTTACTGTGTCCACTGTGATGAACTCATGCCCACTCTTCTCAAGGCAAAAGCTTTT A_73_102571 A_73_102571 FALSE XM_866262 XM_866262 LOC614684 ref|XM_866262 unmapped Bos taurus similar to Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (ABCC4) CTGAACTTCCCATAAACCAAGCCAAGAAGAGAAGTATATTGAGTTCCATGGTTCTTAGTA A_73_102572 A_73_102572 FALSE XM_876621 XM_876621 LOC507481 ref|XM_876621 unmapped Bos taurus similar to Homo sapiens caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant E AGGGCCCAGATCTCTGCCTACAGGATTCTGCTTTTCCAGATTTCAGAAGATGTGAACAAA A_73_102573 A_73_102573 FALSE XM_606532 XM_606532 LOC528120 ref|XM_606532 unmapped PREDICTED: Bos taurus similar to double C2-like domains, alpha (LOC528120) GTCACAGTCTGGGACTATGACATCGGCAAATCCAACGACTTCATCGGTGGCGTGTCCCTG A_73_102574 A_73_102574 FALSE AW347838 AW347838 gb|Bos taurus similar to Homo sapiens regulating synaptic membrane exocytosis 4 (RIMS4) unmapped Unknown CTGGGTTGGAGCAGGTCACGTTGCATTGTGTTCATGACCATGTAGCTCATGTTGAAAATT A_73_102575 A_73_102575 FALSE XM_581080 XM_581080 LOC504888 ref|XM_581080 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 7, subfamily A, member 17 (OR7A17) CATCTCACCTCTTGGTTGTTTCCTTATTTTATTGTACAAGCCTTGGAGTGTACCTTGGCT A_73_102576 A_73_102576 FALSE XM_588771 XM_588771 LOC511438 ref|XM_588771 unmapped Bos taurus similar to Homo sapiens metastasis associated 1 (MTA1) GGCCGAGCTGCCTGGTGGGGTTGGCCCCTTGTCTTTTCAAGTAATTTTCATATTAAAAAA A_73_102577 A_73_102577 FALSE XM_615582 XM_615582 LOC535482 ref|XM_615582 unmapped Bos taurus similar to Homo sapiens chromosome 21 open reading frame 59 (C21orf59) AAACAAGACAGCTGCGCCCTTTGTGAACGTTGTTGAAATCTCTAGTTTTCCTTTCAGTTT A_73_102578 A_73_102578 FALSE XM_874852 XM_874852 LOC514613 ref|XM_874852 unmapped Bos taurus similar to Homo sapiens cyclin L1 (CCNL1) TTTTTTGCACATAAAATGCCCTAGCAGTATCTAATTGAAAACCATGGTCAGGTTCAATTG A_73_102579 A_73_102579 FALSE XM_615341 XM_615341 LOC535297 ref|XM_615341 unmapped Bos taurus similar to Homo sapiens dystonin (DST), transcript variant 1eA TGGACAGTAGCGCCTGTACCATTGAACTCATTTTGTATCAAAGCAAGTTTGCTTGCGGAA A_73_102580 A_73_102580 FALSE NM_001034496 NM_001034496 MGC128215 ref|NM_001034496 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 50, member A (FAM50A) CACACGGGTATTGCGTACATTCACGGTGTTGTGAATCACTCCTGAAGGAGACCCCATGTT A_73_102581 A_73_102581 FALSE CB166839 CB166839 gb|Bos taurus similar to Homo sapiens MAP/microtubule affinity-regulating kinase 1 (MARK1) unmapped Unknown TCACTGGTGCACACTGAAATTTTACTTGAACAGTTCTCATAATAAAGCACTTGTCTTTTG A_73_102582 A_73_102582 FALSE XM_603925 XM_603925 LOC525572 ref|XM_603925 unmapped Bos taurus similar to Homo sapiens G protein pathway suppressor 1 (GPS1), transcript variant 2 CAGCCTCCACGTTGACGCATCGTTTGAGGTTGCAGCGTTATTGAATCTTAGTCCATTAAA A_73_102583 A_73_102583 FALSE XM_588580 XM_588580 LOC539655 ref|XM_588580 unmapped Bos taurus similar to Homo sapiens PCTAIRE protein kinase 2 (PCTK2) AAGTGTCTCTGTGCCAGTAGCAATTAATTTATAATTGTGCTGGCCATTCATTTACTAATC A_73_102584 A_73_102584 FALSE NM_001037471 NM_001037471 UXT ref|NM_001037471 unmapped Bos taurus similar to Homo sapiens ubiquitously-expressed transcript (UXT), transcript variant 1 GGTTTTTTCCTGGAGTTAACACTGGCAGAAGCTCTCAAGTTCATTGATCGTAAGAGCAGT A_73_102585 A_73_102585 FALSE XM_586455 XM_586455 LOC509487 ref|XM_586455 unmapped PREDICTED: Bos taurus similar to semaphorin sem2 (LOC509487) TCCCCCTACTCCAAGGCCTGGTATAAGGATATCATGCAGCTCATCGGCTTCGCCAACCTG A_73_102586 A_73_102586 FALSE CB449940 CB449940 gb|Bos taurus similar to Homo sapiens apoptosis-inducing, TAF9-like domain 1 (APITD1), transcript variant C unmapped Unknown TAATGGCAAAAACCACAAAAATCTTTATCAAAAACTCTCTTCTTTGATCAGACTTGAGGT A_73_102587 A_73_102587 FALSE XM_866348 XM_866348 LOC614749 ref|XM_866348 unmapped PREDICTED: Bos taurus similar to interferon stimulated exonuclease gene 20kDa-like 1 (LOC614749) CGCCTGAGGACAGAGAGCCCGACAGCAGCACAGACATGGAGCAGTACATGGAGGACCAGT A_73_102588 A_73_102588 FALSE XM_867476 XM_867476 LOC615616 ref|XM_867476 unmapped PREDICTED: Bos taurus similar to granulosa cell HMG-box protein-1 (LOC615616) TCCCTGGAGCAGTGGCATTTGACACTAAGGCATTTGACAGCCCTCTCATTAATGCCAGGC A_73_102589 A_73_102589 FALSE NM_177432 NM_177432 IRF1 ref|NM_177432 unmapped Bos taurus interferon responsive factor 1 (IRF1) GCGCCTTGGTGTGATTTAAAATTGGAAGTATCATCTGACCACTAAGTCATGTGTGACCAC A_73_102590 A_73_102590 FALSE XM_600655 XM_600655 LOC522375 ref|XM_600655 unmapped Bos taurus similar to Homo sapiens ADAM metallopeptidase domain 11 (ADAM11) TCGGCTGGGGGATCTAGGGGGAGACATCAGCAGCGTCACTTTCTACCACCAGGGCAAGGA A_73_102591 A_73_102591 FALSE XM_592682 XM_592682 LOC514777 ref|XM_592682 unmapped Bos taurus similar to Homo sapiens BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) (BUB1) AGGTTTATATTTTGCGTAAAATAAGCAAAATTTCCCCAAATGTATCCAGCGGACTTCATG A_73_102592 A_73_102592 FALSE XM_870071 XM_870071 LOC617754 ref|XM_870071 unmapped Bos taurus similar to Homo sapiens transmembrane protein 58 (TMEM58) CTCCTGTTTGCCGTGGACTTGGGGGTGGGGAGGCTCCACCAGCCACGGGCAGAAGCGGCC A_73_102593 A_73_102593 FALSE XM_585215 XM_585215 LOC508439 ref|XM_585215 unmapped Bos taurus similar to Homo sapiens KIAA0090 (KIAA0090) CTGTCGGGAGAGAGGTACGTTTAAGTGTCCGAATAAAGCGAGTGGCGAATGACATAAAAA A_73_102594 A_73_102594 FALSE XM_590254 XM_590254 LOC512692 ref|XM_590254 unmapped Bos taurus similar to Homo sapiens CGI-96 protein (CGI-96) CTAGGAAATTGTAGAACCACTCAGTTGGGCATGGCCCAGGAATACAGGAGGACAATAAAA A_73_102595 A_73_102595 FALSE CB462745 CB462745 gb|Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 4E binding protein 2 (EIF4EBP2) unmapped Unknown AAACATGAATCTAGGTGGTGGGTTACTGGGCTGAAGAATAGCTAACCATTCAGATCCAGA A_73_102596 A_73_102596 FALSE XM_592701 XM_592701 LOC514797 ref|XM_592701 unmapped Bos taurus similar to Homo sapiens C-type lectin domain family 4, member E (CLEC4E) AAAGAACAAGTGATAATCATAACCACACAACTCCAACGTGAGAAAAGCATGCACTGCACT A_73_102597 A_73_102597 FALSE EE940832 EE940832 gb|Bos taurus similar to Homo sapiens trafficking protein, kinesin binding 1 (TRAK1) unmapped Unknown CCTAAACCATTACTTTTTTGATTGAGAAACAAAGATGCATAAAGGCATAAACCTGTGCTC A_73_102598 A_73_102598 FALSE NM_001038024 NM_001038024 MGC133659 ref|NM_001038024 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 146 (C1orf146) GCAGAGATTCCTGGGTAGTAACTTACGGATACTTCCAGTACACAACACAGTAAATGCGAT A_73_102599 A_73_102599 FALSE XM_590425 XM_590425 LOC512840 ref|XM_590425 unmapped Bos taurus similar to Homo sapiens POU domain, class 2, transcription factor 1 (POU2F1) AAATTTGCCTAATTTTTTAATAAAACACTGTCTTTTCAGGATTGCTTCATGGATTGGAGA A_73_102600 A_73_102600 FALSE XM_616596 XM_616596 LOC536464 ref|XM_616596 unmapped PREDICTED: Bos taurus similar to zinc finger, CCHC domain containing 11 isoform b (LOC536464) TACCAATTGCCGATATCTATGCAAACTTTGCTTAATTCACATTGAAAACATCCAGGGAGC A_73_102601 A_73_102601 FALSE XM_612914 XM_612914 KLRB1 ref|XM_612914 unmapped Bos taurus similar to Homo sapiens killer cell lectin-like receptor subfamily B, member 1 (KLRB1) ACATATCAAAGACACAATGTATTTCTGATTACTGTGCTGCAAAAAATAGATGGATCTGCC A_73_102602 A_73_102602 FALSE XM_586827 XM_586827 LOC509789 ref|XM_586827 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ20581 (FLJ20581) AGGGCCACAAAATTTAATCATACCTTTAGTTCAGAAACTCCATCTTTGGAAATCACTACA A_73_102603 A_73_102603 FALSE XM_616274 XM_616274 LOC536153 ref|XM_616274 unmapped Bos taurus similar to Homo sapiens glypican 6 (GPC6) CTTCTTGTTTTGTGCTGCTCAAAGAAGGGATTCCTCAATTATCTGGGAGCACCAAGAATC A_73_102604 A_73_102604 FALSE EE902394 EE902394 gb|Unidentified transcripts on BTA13 position 44898106-44897237 unmapped Unknown AGCGGAGTCATTTGGATTCCAGAAAGCAGGACTTGGTGTCATTATTGAGATCAGAGAAAG A_73_102605 A_73_102605 FALSE XM_584887 XM_584887 LOC508148 ref|XM_584887 unmapped Bos taurus similar to Homo sapiens hepsin (transmembrane protease, serine 1) (HPN), transcript variant 2 ACTTCTACGGGAACCAGATCAAGCCCAAGATGTTCTGTGCTGGCTACCCTGAGGGTGGCA A_73_102606 A_73_102606 FALSE XM_587740 XM_587740 LOC539501 ref|XM_587740 unmapped Bos taurus similar to Homo sapiens helicase with zinc finger (HELZ) ATGCTGGGTTTCTGTACCAGAAATGGCCAGTTGATGTACAAATGTATGTTATTTTTGCTT A_73_102607 A_73_102607 FALSE XM_875851 XM_875851 LOC509111 ref|XM_875851 unmapped Bos taurus similar to Homo sapiens tumor protein p53 binding protein, 1 (TP53BP1) GGCGATCGTGTTTTAACCAGGTTTTAAATGTGTCTTGTGTGTAACTGGATTCCTTGCATG A_73_102608 A_73_102608 FALSE XM_587970 XM_587970 LOC510773 ref|XM_587970 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ20701 (FLJ20701) AGCACACCTTCTGGAGTTCCGCTTGCTGCTTCACGACAAATGTAAACTACTCTTTAGCAT A_73_102609 A_73_102609 FALSE XM_864962 XM_864962 LOC613812 ref|XM_864962 unmapped PREDICTED: Bos taurus similar to ring finger protein 168 (LOC613812) TTGTAATGTATCTAAAACTGCTCATTCCCTACAGCCTACGTGTGCCTATTCTGAATGCAG A_73_102610 A_73_102610 FALSE XM_869964 XM_869964 LOC617663 ref|XM_869964 unmapped PREDICTED: Bos taurus similar to protease, serine, 34 (LOC617663) TTGAAAACAGCACCAAGCCAATCAAGGATGACATGCTGTGTGCCGGGAGCAAGGGCCAGG A_73_102611 A_73_102611 FALSE XM_589289 XM_589289 LOC511869 ref|XM_589289 unmapped Bos taurus similar to Homo sapiens transmembrane 4 L six family member 5 (TM4SF5) TTGCTTGGGGCTTTTATACCTTGCTTGCTATTTTCTTAATAAATACTGAGCTGTTGGTGC A_73_102612 A_73_102612 FALSE XM_868057 XM_868057 LOC616090 ref|XM_868057 unmapped Bos taurus similar to Homo sapiens methyl-CpG binding domain protein 3 (MBD3) AGCTAGGAGGCTGAGGGAGGCTTCTGTGGGTGGCATCGAATAAAGCGTGTCAGGCAAGTA A_73_102613 A_73_102613 FALSE XM_616214 XM_616214 LOC536094 ref|XM_616214 unmapped PREDICTED: Bos taurus similar to CLIP- associating protein 1 (LOC536094), partial mRNA. CTCCACCCACAGCTAATGCAACGCCAGAATCTCTGTGTAGCCCTGGAAGCAATCGGTGGT A_73_102614 A_73_102614 FALSE XM_587904 XM_587904 LOC539526 ref|XM_587904 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 138 (C9orf138) GTTGACAGTGTCAGCCTGATTTTTAAAGGTTGTAATTTAGAAATTGCACAATACTTATAA A_73_102615 A_73_102615 FALSE NM_001035498 NM_001035498 BAIAP2L2 ref|NM_001035498 unmapped Bos taurus similar to Homo sapiens BAI1-associated protein 2-like 2 (BAIAP2L2) TCTCCCACCCCGCATAGCTCCCTGTTTAACTTTTGTAAATGGTGAGAAATAAAGCAAGTG A_73_102616 A_73_102616 FALSE NM_001038107 NM_001038107 MGC134139 ref|NM_001038107 unmapped Bos taurus similar to Homo sapiens ligase III, DNA, ATP-dependent (LIG3), nuclear gene encoding mitochondrial protein, transcript variant alpha TGGGTCCTTCCCCAAACACCTCCTATAATTCTAGTGATTAAGGAATGGAGGGGAGGCTGG A_73_102617 A_73_102617 FALSE XM_590936 XM_590936 LOC513273 ref|XM_590936 unmapped Bos taurus similar to Homo sapiens Williams- Beuren syndrome chromosome region 16 (WBSCR16) AATTTATAGTGAAAGTCACAGAGTTCATAGGATGCAGGACTTCGATGGACAGGTGGTCCA A_73_102618 A_73_102618 FALSE CB167096 CB167096 gb|Bos taurus similar to Homo sapiens TYRO3 protein tyrosine kinase (TYRO3) unmapped Unknown GGCAGGCCCTTGCTGTTAGGGACTTTTCCAAGCCGTTAGATGCTGTTTAAAAACAGAAAT A_73_102619 A_73_102619 FALSE CB431313 CB431313 gb|Unidentified transcripts on BTA20 position 20432722-20433753 unmapped Unknown CATGGTTGCCAGCATATAGTAGTGCTCAGCAAATCCAGTTCTCTTCCTTCCTTTCCTTTG A_73_102620 A_73_102620 FALSE XM_583806 XM_583806 LOC538938 ref|XM_583806 unmapped Bos taurus similar to Homo sapiens translocation protein 1 (TLOC1) ATCTGTGATCTTTCTACAGCAGCTTCAGTTTTGTGCCAACATTCCATGTATTTGAATATG A_73_102621 A_73_102621 FALSE XM_581445 XM_581445 LOC505194 ref|XM_581445 unmapped PREDICTED: Bos taurus similar to M142.8 (LOC505194) GAGGATCACCACACACAGCTTTGCCATCGTCGTGGCAGATCACCCCTATCACTTGGAGGA A_73_102622 A_73_102622 FALSE XM_878251 XM_878251 LOC535231 ref|XM_878251 unmapped Bos taurus similar to Homo sapiens v-ets erythroblastosis virus E26 oncogene like (avian) (ERG), transcript variant 1 GTTCTTAGAATGCAGAATGTATGTAATAAAATAAGCTTGGCCTAGCATGGCAAATCAGAT A_73_102623 A_73_102623 FALSE XM_864054 XM_864054 LOC613366 ref|XM_864054 unmapped PREDICTED: Bos taurus similar to Squamous cell carcinoma antigen 1 (SCCA-1) (Protein T4-A) (LOC613366) GCAGCTGCTACTGGTGTAGAAATTATTGAAAGAGCAGGAAGAAATTCTGAGAGCTTCCGC A_73_102624 A_73_102624 FALSE EE899059 EE899059 gb|Unidentified transcripts on BTA26 position 34945351-34944976 unmapped Unknown AGCTCCAGCCAGCTCGGCGGTTCCTCGTAATCAGCGCCAATGCATTTTTCTGCCCCTTTT A_73_102625 A_73_102625 FALSE NW_930072 NW_930072 gb|Bovine miRNA bta- mir-26a on chr 5, (-) strand. Mature length 21 nt, stem-loop length 84 nt. Source: NW_931541.1:c119297-119214 unmapped Unknown TTCAAGTAATCCAGGATAGGCTATCCTACTATACGTATCACATAG A_73_102626 A_73_102626 FALSE XM_598320 XM_598320 LOC520088 ref|XM_598320 unmapped Bos taurus similar to Homo sapiens maternal embryonic leucine zipper kinase (MELK) AACTGTTTACTTTCTTGGAGTCACTTCCATACATGATTGTAAGCTCTTAACTATGTCTTC A_73_102627 A_73_102627 FALSE NM_001034714 NM_001034714 MGC127654 ref|NM_001034714 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ20558 (FLJ20558) TGCACATCCCCACCCTTTGACAACTTTAAATACTAGTTAGACACTTAGATGGCTCTGTTC A_73_102628 A_73_102628 FALSE XM_878643 XM_878643 LOC506910 ref|XM_878643 unmapped Bos taurus similar to Homo sapiens solute carrier family 37 (glycerol-3-phosphate transporter), member 3 (SLC37A3), transcript variant 1 TCACTACAGGAATTAATGATTTTTATTTATCCGCTGCTGTCCATGAATGTACTGAATGGC A_73_102629 A_73_102629 FALSE XM_590935 XM_590935 LOC513272 ref|XM_590935 unmapped Bos taurus similar to Homo sapiens IQ motif containing D (IQCD) GAAGCCCCTGGGATGGGGAGCCCCGTGGTTTATGACTTCAACGATTTTTCAAAATTAAAA A_73_102630 A_73_102630 FALSE XM_618046 XM_618046 PLEX2 ref|XM_618046 unmapped PREDICTED: Bos taurus putative plexin 2 (PLEX2) TGGCACACCCATCATCCTGAAGGGCAAGAATCTGATCCCACCTGTTGCTGGGGGCAATGT A_73_102631 A_73_102631 FALSE XM_615612 XM_615612 LOC535508 ref|XM_615612 unmapped PREDICTED: Bos taurus similar to 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 (LOC535508) ATGTTAATAAATCATGTCATCCTGTTCGTGACGCCAGTTGTCTCGCTGTATCTCACTGTG A_73_102632 A_73_102632 FALSE BE752053 BE752053 gb|Bos taurus similar to Homo sapiens protein tyrosine phosphatase, non-receptor type 1 (PTPN1) unmapped Unknown GTCTCAGGGTCTTCTGTGACCTCACAGAACTGTCAAACTGTACAGTTTTCCAATTTGCCA A_73_102633 A_73_102633 FALSE XM_869526 XM_869526 LOC617292 ref|XM_869526 unmapped PREDICTED: Bos taurus similar to synaptotagmin-like 4 (granuphilin-a) (LOC617292) TTGTGTGTGTGTGTGTGTGTGATGTATGTGTGTGTATATAAATGTGTATTTCTACAGATC A_73_102634 A_73_102634 FALSE XM_582557 XM_582557 LOC506150 ref|XM_582557 unmapped Bos taurus similar to Homo sapiens leucine- rich repeats and calponin homology (CH) domain containing 3 (LRCH3) ATAGCTTCACAGCTAATCAGGAGTCTGATTTCTCTACTTGGTAACAGTCCAGCAATGACT A_73_102635 A_73_102635 FALSE XM_592180 XM_592180 LOC514346 ref|XM_592180 unmapped Bos taurus similar to Homo sapiens serine dehydratase (SDS) AGGCTGTGAACTGAAGTCTTTTGAGTGTTTGGTTTTTTCTCAGGAAGCCCAAAGCCTACC A_73_102636 A_73_102636 FALSE BI542267 BI542267 gb|Bos taurus similar to Homo sapiens metastasis associated 1 family, member 3 (MTA3) unmapped Unknown AGTAGATGTCATCCACTGATCAATTTGTATCCTGTTTCCAATAAACTTCTGGAAATTCTA A_73_102637 A_73_102637 FALSE XM_607130 XM_607130 LOC528699 ref|XM_607130 unmapped Bos taurus similar to Homo sapiens KISS1 receptor (KISS1R) CCTGGCGGCCTGGACCCTCGGACACTGCGGCCGTCCACCAAACCCAGCTGCGACGCCTGG A_73_102638 A_73_102638 FALSE XM_870729 XM_870729 LOC618398 ref|XM_870729 unmapped Bos taurus similar to Homo sapiens DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) (DMC1) AATTGCCAAGATTTACGACAGCCCTGAGATGCCTGAAAATGAAGCCACCTTCGCAATAAC A_73_102639 A_73_102639 FALSE XM_588136 XM_588136 LOC510910 ref|XM_588136 unmapped Bos taurus similar to Homo sapiens CD84 molecule (CD84) ACACCTGTAACCTGCCATGACACACCACTTAAGAGCCTCTGTTCATACTCAATATATGGG A_73_102640 A_73_102640 FALSE CB171132 CB171132 gb|Bos taurus similar to Homo sapiens zinc finger protein 664 (ZNF664) unmapped Unknown TTTATCATGCTGTTGCTGGGGAATATGACTAACACTTTTGAAGCTACTAATTTTATGTCG A_73_102641 A_73_102641 FALSE XM_584997 XM_584997 LOC508245 ref|XM_584997 unmapped Bos taurus similar to Homo sapiens ribonuclease T2 (RNASET2) AAACAGTGGTCTGCTGATACTCCTTGGACACTAGTCTTTCTAAAATTTGCCTGCGTGCTT A_73_102642 A_73_102642 FALSE BE684314 BE684314 gb|Unidentified transcripts on BTA13 position 3511779-3511016 unmapped Unknown TCCTCCTCTTTCTGGATTATTTTGAACAATTTTAAACCCAACAAAAATCAGTAGCAGAGG A_73_102643 A_73_102643 FALSE XM_591989 XM_591989 LOC514182 ref|XM_591989 unmapped Bos taurus similar to Homo sapiens hypothetical protein BC008207 (LOC92345) AGTGAGCACCAAGCCTGGCTGTTTCTCTCAAGAGAGTCTGGAGAAATAATTCTGAAGTGT A_73_102644 A_73_102644 FALSE AW327184 AW327184 gb|Unidentified transcripts on BTA11 position 75666213-75665562 unmapped Unknown CTCTTGTCTGGCTGCTGCAGCTTGTCTATAATGCCCTGACATGTTGCATTTTCCTCATTT A_73_102645 A_73_102645 FALSE NM_174014 NM_174014 CD69 ref|NM_174014 unmapped Bos taurus CD69 antigen (p60, early T-cell activation antigen) (CD69) TCCTAAGTGCAATAAGGTGTGTTTATTTGTTTGTCTTTTGTATCCAGTGCAATTACAAGC A_73_102646 A_73_102646 FALSE EE908179 EE908179 gb|Unidentified transcripts on BTA29 position 7898150-7899285 unmapped Unknown TTTAAAAGGCTGAATATAGCTTAGTTGAATATTCTAGTTTTCTATCCTTCCCCTCTCACC A_73_102647 A_73_102647 FALSE XM_587269 XM_587269 LOC510157 ref|XM_587269 unmapped PREDICTED: Bos taurus similar to solute carrier family 12 member 5 (LOC510157) CAAGCTTGTTTTGCTCAACATGCCTGGGCCTCCCCGCAACCGCAACGGTGACGAAAACTA A_73_102648 A_73_102648 FALSE XM_617511 XM_617511 LOC537349 ref|XM_617511 unmapped Bos taurus similar to Homo sapiens zinc finger DAZ interacting protein 3 (DZIP3) TTGGGTATTACCTGACATTACTGTTTATGTATGGAGTAGCACTCACTGAAAGAGGAAAGA A_73_102649 A_73_102649 FALSE BG688352 BG688352 gb|Bos taurus similar to Homo sapiens major histocompatibility complex, class I, B (HLA-B) unmapped Unknown TCGCAGGATTCGCGGTCGAACTTGAAGGTCATCGTTGGCAACCACAACCACAGTGAGCTG A_73_102650 A_73_102650 FALSE XM_591230 XM_591230 LOC513536 ref|XM_591230 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 43 (C20orf43) ATATTTATGCTCAAAATAATTAAAGACTCCAGGTTCCTCCTGGGTGTGTGGTCAGCTCAA A_73_102651 A_73_102651 FALSE XM_607652 XM_607652 LOC529211 ref|XM_607652 unmapped Bos taurus similar to Homo sapiens aristaless related homeobox (ARX) TTTGTGTAACGTGTAATTGTTATCACTTTTCCTTGCTATCTAGTGGAGAAGTGTCACGCT A_73_102652 A_73_102652 FALSE CB424794 CB424794 gb|Bos taurus similar to Homo sapiens zinc finger protein 606 (ZNF606) unmapped Unknown GAGAGATTGACTCCAGAGTTCATGTTTATAACCACTGTGTTACGCTGCCTCTGCAGTGAT A_73_102653 A_73_102653 FALSE AW314086 AW314086 gb|Bos taurus similar to Homo sapiens solute carrier family 43, member 2 (SLC43A2) unmapped Unknown ATCAGACTCCTTTTTATAAAGCAATAAATCCACTTCCCTACTGGTAAGGGATGCCCCCTT A_73_102654 A_73_102654 FALSE XM_600866 XM_600866 LOC522581 ref|XM_600866 unmapped Bos taurus similar to Homo sapiens transient receptor potential cation channel, subfamily M, member 5 (TRPM5) ACCAGAAGGTGGTCACCTGGGAGGCGGTGCAGAAGGAGAACTTCCTGAGCGAGCTGGAGA A_73_102655 A_73_102655 FALSE XM_868309 XM_868309 LOC616315 ref|XM_868309 unmapped Bos taurus similar to Homo sapiens target of myb1-like 2 (chicken) (TOM1L2), transcript variant 2 TAAATTCCTTGAAGAAAGGGCCAAAGCTGCTGAAATGGTTCCCAGCCTCCCCTCTCCCCC A_73_102656 A_73_102656 FALSE XM_583894 XM_583894 LOC538957 ref|XM_583894 unmapped PREDICTED: Bos taurus similar to Transforming growth factor beta 3 precursor (TGF-beta 3), transcript variant 1 (LOC538957) AGGACCCCCAAAGTGGAGCAGCTGTCTAACATGGTGGTGAAGTCCTGCAAGTGCAGCTGA A_73_102657 A_73_102657 FALSE XM_596290 XM_596290 LOC518106 ref|XM_596290 unmapped PREDICTED: Bos taurus similar to Extracellular matrix protein 2 precursor (Matrix glycoprotein SC1/ECM2) (LOC518106) TGGAGAACAACCTTATTGACCGGCGCCGCATCCCACCCACTGCCTTCTCCTGCATCCGAG A_73_102658 A_73_102658 FALSE XM_868101 XM_868101 caV2.3 ref|XM_868101 unmapped PREDICTED: Bos taurus voltage-gated calcium channel alpha 1E subunit (caV2.3) TTCTACAATTCTCCAAAATTTCCCACCCACCTTGTGCTGCTTTACAGCGTGCCTCTCTTA A_73_102659 A_73_102659 FALSE AW477592 AW477592 gb|Bos taurus similar to Homo sapiens checkpoint suppressor 1 (CHES1) unmapped Unknown TAACACTTTCCCCCCAGACCTACCATAAGGTTTCTGTGATGTATTGTCTTCCAGTTGCAA A_73_102660 A_73_102660 FALSE XM_588314 XM_588314 LOC511058 ref|XM_588314 unmapped Bos taurus similar to Homo sapiens protein phosphatase 6, catalytic subunit (PPP6C) CAGCATACGTTGTTAGCTTAAAGTTATTCTTTCTTTTTTCCTAATCAGAGTTCTTGACCC A_73_102661 A_73_102661 FALSE XM_582733 XM_582733 LOC506305 ref|XM_582733 unmapped Bos taurus similar to Homo sapiens arginyl- tRNA synthetase (RARS) TCACCAAAGTGGCCATTAGCATTGTTTGCTTTTTTACAATCATGTGGATACAAAAACAAG A_73_102662 A_73_102662 FALSE BM431615 BM431615 gb|Bos taurus similar to Homo sapiens regenerating islet-derived family, member 4 (REG4) unmapped Unknown CCTTTCTTCTTCCTTCTCTGCCATGCTGCCTATCTGATCATTGTCTCGAAGAGTAAACAT A_73_102663 A_73_102663 FALSE AW353206 AW353206 gb|Intergenic region between DNAJA1 and LOC540842 on BTA5 unmapped Unknown GGATTACTAGCTACAAAGTGGTATATCTCACCGAATTTTCATGTTATTTCCCTCATGACT A_73_102664 A_73_102664 FALSE XM_867722 XM_867722 LOC615815 ref|XM_867722 unmapped PREDICTED: Bos taurus similar to Pericentrin-2 (Pericentrin B) (Kendrin) (LOC615815) CAGGAGGGCGTGAGAGCCGTCCGGCTATCCATGGCTCACAAGTCATGGGTTTCCTGGTGA A_73_102665 A_73_102665 FALSE NM_001038194 NM_001038194 CCT4 ref|NM_001038194 unmapped Bos taurus similar to Homo sapiens chaperonin containing TCP1, subunit 4 (delta) (CCT4) CCCACCATTTTCAGTAATACATATGCGGTTTGAAAAGTTAACAGTACAGAAAGAGTGAAC A_73_102666 A_73_102666 FALSE XM_592398 XM_592398 LOC514530 ref|XM_592398 unmapped Bos taurus similar to Homo sapiens nucleolar complex associated 4 homolog (S. cerevisiae) (NOC4L) TTCAAGCACACGACTGGTGCTAGCTTACATTTGGCAGGGACTGAGCAAGCCGTGGCAGGG A_73_102667 A_73_102667 FALSE XM_867609 XM_867609 LOC615730 ref|XM_867609 unmapped PREDICTED: Bos taurus similar to delta- sarcoglycan isoform 1 (LOC615730) CACAGTGTTCCCTAAATCTATAGAGACACCTAATGTCAGGGCAGATCCCTTCAAGGAACT A_73_102668 A_73_102668 FALSE XM_613987 XM_613987 LOC540985 ref|XM_613987 unmapped Bos taurus similar to Homo sapiens malic enzyme 1, NADP(+)-dependent, cytosolic (ME1) CAGACCAAACTTGACTAGTAGCATAATAGCTGACATTTCTAACTCCATTAATGAGGTCTT A_73_102669 A_73_102669 FALSE XM_870836 XM_870836 LOC618503 ref|XM_870836 unmapped PREDICTED: Bos taurus similar to basic FGF- repressed Zic binding protein isoform a (LOC618503) TGGCAGTACGCAGTGGATATACCGTAGTGCTGGTGGTCTCAAATCATCCCTTTTAATGAT A_73_102670 A_73_102670 FALSE XM_608596 XM_608596 LOC530131 ref|XM_608596 unmapped PREDICTED: Bos taurus similar to CG7092-PA (LOC530131) GTTCTTGTCCACGGGATGTTCATGGATGCTTCTCGATGGGATAATAAGGACATGGTGATA A_73_102671 A_73_102671 FALSE XM_586381 XM_586381 LOC509429 ref|XM_586381 unmapped Bos taurus similar to Homo sapiens leucyl-tRNA synthetase (LARS) TGGCCACTTCTCAACCAAAATTGAAATCAGGCAAGGAGATAACCGTGATTCTATACTCAG A_73_102672 A_73_102672 FALSE NM_001014391 NM_001014391 CLDN4 ref|NM_001014391 unmapped Bos taurus claudin-4 (CLDN4) CTGGACAGCTAACAACGTCATCCGCGACTTCTACAACCCCCTGGTGGCCTCGGGCCAGAA A_73_102673 A_73_102673 FALSE NM_001015640 NM_001015640 MRLC2 ref|NM_001015640 unmapped Bos taurus fast skeletal myosin light chain 2 (MRLC2) TAGCACCTGCCTTAACTCTTGCCTTTAGTGTGTTCCTGAATTTCATTCAGTGGATTAAAT A_73_102674 A_73_102674 FALSE XM_870755 XM_870755 LOC618426 ref|XM_870755 unmapped Bos taurus similar to Homo sapiens ORM1-like 3 (S. cerevisiae) (ORMDL3) GGATTTTTACTCCCTTTGTACAGTATTCTGAGAAATGCAAATAAAGGACAATGTGCCCCC A_73_102675 A_73_102675 FALSE XM_591836 XM_591836 LOC540151 ref|XM_591836 unmapped Bos taurus similar to Homo sapiens solute carrier family 10 (sodium/bile acid cotransporter family), member 4 (SLC10A4) GTTCACATCATTATACATGTAACGATTTTGATCTACCCACCATAAGGTTGCATTGGTATA A_73_102676 A_73_102676 FALSE XM_581000 XM_581000 LOC504823 ref|XM_581000 unmapped Bos taurus similar to Homo sapiens nucleoporin 107kDa (NUP107) TAATGCTCCTCGACCAGGGCCTTGATCCATTAGGATATGAAATTCAGTCATGATTCATTC A_73_102677 A_73_102677 FALSE NM_001034438 NM_001034438 MGC128832 ref|NM_001034438 unmapped Bos taurus similar to Homo sapiens ribosomal protein S20 (RPS20) TATTGAGCCGGGAGTCGAGGTGGAAGTCACCATTGCTGATGCCTAAATCAACCTTTTTAA A_73_102678 A_73_102678 FALSE XM_604909 XM_604909 LOC526536 ref|XM_604909 unmapped PREDICTED: Bos taurus similar to Crooked neck- like protein 1 (Crooked neck homolog) (hCrn) (LOC526536) GCATGAAGAAAAAGTTACTCTTTGGGGAGACTATCACTTCTCTCTCACCTCCACCAAAAT A_73_102679 A_73_102679 FALSE AW437582 AW437582 gb|Bos taurus similar to Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1 unmapped Unknown CAGAAGAACAGACCTAACTAGTGAATGTATTAATGAAAATGCTTCTATTTCAGAGCTGAC A_73_102680 A_73_102680 FALSE BE665081 BE665081 gb|Bos taurus similar to Homo sapiens protein phosphatase 1A (formerly 2C), magnesium- dependent, alpha isoform (PPM1A), transcript variant 2 unmapped Unknown GGGGGGCTCCTAATGTTATTACTTTGCACGTTAAAGACCTTTAATAGCATGTAAACATTG A_73_102681 A_73_102681 FALSE XM_595195 XM_595195 LOC517031 ref|XM_595195 unmapped Bos taurus similar to Homo sapiens golgi associated, gamma adaptin ear containing, ARF binding protein 2 (GGA2) TCAGGGTGGGGGTTTTATAAGCCAAAGGTGGCACTGGTGTTCTCCATGTATTATTACCTT A_73_102682 A_73_102682 FALSE XM_598998 XM_598998 LOC520748 ref|XM_598998 unmapped PREDICTED: Bos taurus similar to Interferon- induced transmembrane protein 3 (Interferon-inducible protein 1-8U) (LOC520748) TGGTCCTGGGCCTCCTTCTGATTATCGTCCTCATCATCATGTCCATCGGCTCCCTGATGA A_73_102683 A_73_102683 FALSE XM_606860 XM_606860 LOC528437 ref|XM_606860 unmapped Bos taurus similar to Homo sapiens estrogen- related receptor beta (ESRRB) ACAACTTCAAAGCTTCTTCCACACAATCTTCCGGGGCCCTTGGTGGAGCTGAGCCCCAGT A_73_102684 A_73_102684 FALSE XM_867578 XM_867578 grp78 ref|XM_867578 unmapped Bos taurus similar to Homo sapiens heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5) ATTTAACAATTGGGTCATGTGTATCTGGTGTAGGAACTTTTTTCTACCATAAGTGACACC A_73_102685 A_73_102685 FALSE BF776812 BF776812 gb|Unidentified transcripts on BTA16 position 32239510-32239159 unmapped Unknown TTTTTGTATGTCAAATGTACCATCTATTTTTTAAACAATAAAATTGTTTCCCTCTAAAAA A_73_102686 A_73_102686 FALSE AW656321 AW656321 gb|Bos taurus similar to Homo sapiens growth arrest-specific 7 (GAS7), transcript variant a unmapped Unknown CGCCCTTCCAACCCCACCCCCGTAATAGCATTCGTGTGTATTAATGCTGAAAAATTAAAT A_73_102687 A_73_102687 FALSE AV614903 AV614903 gb|Bos taurus similar to Homo sapiens thyroid hormone receptor interactor 11 (TRIP11) unmapped Unknown CACGGAGGAAGTGGAAGCAGATTTACCTAATGCTAGGAGAAAGGAAGTTGAAGCCATTCA A_73_102688 A_73_102688 FALSE XM_585224 XM_585224 LOC508448 ref|XM_585224 unmapped Bos taurus similar to Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3) AGGACTACATGGAGGGCATCCTGGAGGTACAGGCCAAGAAGAAGGCCAACCTGCAGTACT A_73_102689 A_73_102689 FALSE NM_173979 NM_173979 ACTB ref|NM_173979 unmapped Bos taurus actin, beta (ACTB) GGTGATCGCTTTTGTGTAAATTATGTACTCCAAAACAAATTTTGTTTTTAATCTTCGCCT A_73_102690 A_73_102690 FALSE BE722771 BE722771 gb|Bos taurus similar to Homo sapiens alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) (ATRX), transcript variant 2 unmapped Unknown AATATGTAATCTGTGCCAATCTAAAAGGAGTGACCAAGTTTCAGAAATGCTTTTTGTCTG A_73_102691 A_73_102691 FALSE XM_871101 XM_871101 LOC618779 ref|XM_871101 unmapped Bos taurus similar to Homo sapiens NOL1/NOP2/Sun domain family, member 4 (NSUN4) CCATTAGGGGTTTAGGAGGAGGAACCAGTATGTTGTAAATTGGGAGGAAGCATTTAGCCA A_73_102692 A_73_102692 FALSE BF600093 BF600093 gb|Bos taurus similar to Homo sapiens Ral GEF with PH domain and SH3 binding motif 1 (RALGPS1) unmapped Unknown ACCGAGGAAGGTCAGAGTGAGAGCCCAGTTTCCTCCTGTGTTAAGGGTCCCTCGCATTCT A_73_102693 A_73_102693 FALSE XM_870863 XM_870863 LOC618530 ref|XM_870863 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 52 (C20orf52) GTGTACTATAATAAAGCAAGTCTTTGAGTATTCGGTAAAACCAATTAACGGCAGTACACT A_73_102694 A_73_102694 FALSE XM_864536 XM_864536 LOC528003 ref|XM_864536 unmapped Bos taurus similar to Homo sapiens ankyrin repeat, family A (RFXANK-like), 2 (ANKRA2) GGAAATTATTCCTCCCTATTCATCTTCACTCTTGTCTTAACTCATTGACTTTATATAGGG A_73_102695 A_73_102695 FALSE NM_001014942 NM_001014942 RARA ref|NM_001014942 unmapped Bos taurus retinoic acid receptor alpha (RARA) CCCCAGAGCCCGCTGGTGCACCTGTTACTGTTGGACTTGCCACTGAGATCTACTGGATAA A_73_102696 A_73_102696 FALSE CB452742 CB452742 gb|Bos taurus similar to Homo sapiens zinc finger protein 574 (ZNF574) unmapped Unknown CCCCCCACACCTGTTAGCACTGGTGGCCCCAAGGTAAAACAGTCAATAAAGACTGAGTTG A_73_102697 A_73_102697 FALSE CB422577 CB422577 gb|Bos taurus similar to Homo sapiens SH3 and PX domains 2A (SH3PXD2A) unmapped Unknown TGCAGAAAATGTTCTGTCTTGGCATGCTTCTAGACTGTAAGATTTGGGTTGTTTTGTTTT A_73_102698 A_73_102698 FALSE XM_590995 XM_590995 LOC513331 ref|XM_590995 unmapped Bos taurus similar to Homo sapiens PHD finger protein 11 (PHF11), transcript variant 2 CATGCTCAGTAAACGTTAAATGGATAAACTGTTTTTATCTTTTGAGACTAGTTCCAGTCC A_73_102699 A_73_102699 FALSE XM_866578 XM_866578 LOC614927 ref|XM_866578 unmapped PREDICTED: Bos taurus similar to interleukin 27 (LOC614927) TACACTTACCGGTTGCTACACTCCTTGGAACTTCTCTTATCTCGGACCGTGCGGGACTTG A_73_102700 A_73_102700 FALSE XM_868648 XM_868648 LOC616591 ref|XM_868648 unmapped Bos taurus similar to Homo sapiens leucine zipper, down-regulated in cancer 1 (LDOC1) AACAAAAGCAGGTACTCAGCCCAGCTCCTCAATGCTACCTGGAAAAAGCATTTGCATTCT A_73_102701 A_73_102701 FALSE XM_866051 XM_866051 LOC614238 ref|XM_866051 unmapped Bos taurus similar to Homo sapiens density- regulated protein (DENR) ATTGGCAAATGCAGTTTCAGTCCATTTATAGCCACAGTGGATGTTACTGCAGGAAAATGC A_73_102702 A_73_102702 FALSE BF599394 BF599394 gb|Unidentified transcripts on BTA23 position 12882640-12883381 unmapped Unknown TGTACCAGATGTTTAACCCAGGTTCCCCTTCCCTGTACTCCCAATCAACTTTGATTTATG A_73_102703 A_73_102703 FALSE XM_880656 XM_880656 LOC511053 ref|XM_880656 unmapped Bos taurus similar to Homo sapiens solute carrier family 27 (fatty acid transporter), member 3 (SLC27A3) TGTATTTTGTAATAAACTTGACCAGAGGTCCCCTGGCTCTTTCTGCTCCACAGTATCAGC A_73_102704 A_73_102704 FALSE XM_599363 XM_599363 LOC521106 ref|XM_599363 unmapped Bos taurus similar to Homo sapiens disrupter of silencing 10 (SAS10) TTTGTACATTTTATTGTGGGAAAAGCTTAGGAAAGAAGGGGAACTTGGTTGAAAATAGAG A_73_102705 A_73_102705 FALSE XM_583253 XM_583253 AQP8 ref|XM_583253 unmapped Bos taurus similar to Homo sapiens aquaporin 8 (AQP8) CTGATTTCTCTGTTACAAAAGGGCCTTCTGTGGTCTGTTTCCCTGCTGCCTGAGCTGTCA A_73_102706 A_73_102706 FALSE CB429159 CB429159 gb|Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 (PLEKHA1), transcript variant 1 unmapped Unknown TGTCTTCTCTCAGAATGGGAATGTATGTGTGCTTCCCCAATGTTTACTTTTATGTCTGGT A_73_102707 A_73_102707 FALSE XM_605562 XM_605562 LOC527172 ref|XM_605562 unmapped Bos taurus similar to PREDICTED: Homo sapiens chromosome 1 open reading frame 34, transcript variant 1 (C1orf34) GAAATTTCGCAGGTGAAGTTTCTCAGACACTAGTCTGCTATACGCCAAACTGAAACCACT A_73_102708 A_73_102708 FALSE XM_607307 XM_607307 LOC528871 ref|XM_607307 unmapped Bos taurus similar to Homo sapiens granzyme K (granzyme 3; tryptase II) (GZMK) AGGTCCCAAATGTGGTGATGCCAAGAAACCTGGAATCTACATCCTACTAACCCGGAAATT A_73_102709 A_73_102709 FALSE XM_590471 XM_590471 LOC539950 ref|XM_590471 unmapped Bos taurus similar to Homo sapiens heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) (HNRPU), transcript variant 2 CCTTCTCCCACAAAATACTGTATAACTAGTGTGCTTGTAGTAGTTAACTCCACCATCTTT A_73_102710 A_73_102710 FALSE XM_595818 XM_595818 LOC517644 ref|XM_595818 unmapped PREDICTED: Bos taurus similar to Rho GTPase activating protein 19 (LOC517644) ATGAACTTGTTATTTTCTGGCTCTCCAGCTGTCATGATGACACCAACAAGACTGAAATGG A_73_102711 A_73_102711 FALSE XM_583576 XM_583576 LOC507031 ref|XM_583576 unmapped Bos taurus similar to Homo sapiens syntaxin 7 (STX7) TTTGATAGTGAAGGCAATGTTTTACATGGCAAGCTATGAGACTTCAGATGGGAACAAATA A_73_102712 A_73_102712 FALSE XM_595399 XM_595399 LOC517231 ref|XM_595399 unmapped Bos taurus similar to Homo sapiens chromosome 13 open reading frame 18 (C13orf18) AGAATGGACCAGTATAAGCATAAAACAACCCTAGCCAGTGGACTTTTATTATTATTTTGG A_73_102713 A_73_102713 FALSE XM_616959 XM_616959 LOC536815 ref|XM_616959 unmapped Bos taurus similar to Homo sapiens roundabout, axon guidance receptor, homolog 1 (Drosophila) (ROBO1), transcript variant 1 CCTTATAAGCTCAAATGGAGGCATTACTTGCTTTGAATTGCCAAATGATGTCCTCTGACT A_73_102714 A_73_102714 FALSE XM_864820 XM_864820 LOC614195 ref|XM_864820 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein LOC136288 (LOC136288) TGTTTGGGGAATCTGGGTGACGGGTATAGCGGAATTCATACCATATGAGGGAACTTTTGT A_73_102715 A_73_102715 FALSE XM_867122 XM_867122 LOC615342 ref|XM_867122 unmapped PREDICTED: Bos taurus similar to BCL2/adenovirus E1B 19-kDa protein-interacting protein 3 (LOC615342) ATGGTATTAACATACGGTTTAAAACTAAACGGCATACAAGCTTTTTGGTGAAGCCAGGTG A_73_102716 A_73_102716 FALSE XM_876918 XM_876918 LOC517066 ref|XM_876918 unmapped Bos taurus similar to Homo sapiens zinc finger, DHHC-type containing 1 (ZDHHC1) ATTGTGCAGCATCGTCCACCACAGGAGGCAAAGGGGGCCCACAGGGAGCTCGAGTCATGT A_73_102717 A_73_102717 FALSE NM_001035025 NM_001035025 MGC128326 ref|NM_001035025 unmapped Bos taurus similar to Homo sapiens myosin, light polypeptide 2, regulatory, cardiac, slow (MYL2) ACAGCTGGCAGATGGAAATTCACCCAGAGTCCGTGTTCAAATAAAAAGGAGGTCGTGTAA A_73_102718 A_73_102718 FALSE XM_596681 XM_596681 LOC518488 ref|XM_596681 unmapped PREDICTED: Bos taurus similar to inositol 1,3,4-triphosphate 5/6 kinase (LOC518488) GTGTAAGCGAGTTCTTCACCGACCTCCTGAACCACATCGCCAGCGTGCTGCAGGGCCAGA A_73_102719 A_73_102719 FALSE CA035759 CA035759 gb|Bos taurus similar to Homo sapiens phytanoyl-CoA 2-hydroxylase interacting protein-like (PHYHIPL) unmapped Unknown CCTTGAAGCCTAGAATTGTCAGCACTTCCAACTTGTTGTTTGACAGTGTTATTTATGTTA A_73_102720 A_73_102720 FALSE XM_591602 XM_591602 LOC513847 ref|XM_591602 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 121B (FAM121B) AAGTCAGTACTGAATGTAGTAAATTGGCATTCTTCTTCTGGCAAAACTGTCCTAGGCCTC A_73_102721 A_73_102721 FALSE XM_586402 XM_586402 LOC539315 ref|XM_586402 unmapped PREDICTED: Bos taurus similar to activin A type IB receptor isoform a precursor (LOC539315) AGGCTTTTGGGTCCAAATGTACCACTGACGACAGAGACTTCGGCTGGGCTATTCCCACCA A_73_102722 A_73_102722 FALSE XM_612077 XM_612077 LOC532872 ref|XM_612077 unmapped Bos taurus similar to Homo sapiens myomesin family, member 3 (MYOM3) TGTCACCTTCCTGGACCGCTACCACATGGATGTGAAGGGGACAGAGGTCACCATCACCAT A_73_102723 A_73_102723 FALSE XM_611689 XM_611689 LOC532572 ref|XM_611689 unmapped Bos taurus similar to Homo sapiens laminin, gamma 1 (formerly LAMB2) (LAMC1) AAAGTCACACAGTTTTAAAGAGAAGCAAATTAAACATCGTGAATCAGGAACAAAGGGTTC A_73_102724 A_73_102724 FALSE XM_865505 XM_865505 LOC614135 ref|XM_865505 unmapped Bos taurus similar to Homo sapiens syntaxin 18 (STX18) TGAGATGTGTGCTCACAGAAGGGACACCAGACCTGTGGCTTAAGCATTCAGTAATGAAAA A_73_102725 A_73_102725 FALSE XM_587980 XM_587980 LOC539543 ref|XM_587980 unmapped Bos taurus similar to Homo sapiens adrenergic, alpha-1D-, receptor (ADRA1D) GTACTACCTGCCAGGCTTATAAACTGGAGGACTACAGCCATCTCCAAGAGACTGATATTT A_73_102726 A_73_102726 FALSE XM_584735 XM_584735 LOC508019 ref|XM_584735 unmapped Bos taurus similar to Homo sapiens cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) (CER1) ACAGAGCATCAGCATGGCTACCCCGCACAGGCTGGCTTTCGGGCAGAATTTCATGTCCAA A_73_102727 A_73_102727 FALSE XM_874197 XM_874197 LOC510036 ref|XM_874197 unmapped Bos taurus similar to Homo sapiens reticulon 4 interacting protein 1 (RTN4IP1), nuclear gene encoding mitochondrial protein GGACATGCACGAGGAAAGACCGTCATTAACGTTGTTTAAATAAATATTCGGTTCGTGGAA A_73_102728 A_73_102728 FALSE XM_616284 XM_616284 LOC536163 ref|XM_616284 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 120C (FAM120C) TGGGAAGAATGGCGAGAAGAACCACTTACAAGAGCAAAAGCTAGGAACTGTGACACAACA A_73_102729 A_73_102729 FALSE XM_879394 XM_879394 LOC506031 ref|XM_879394 unmapped Bos taurus similar to Homo sapiens protein kinase C binding protein 1 (PRKCBP1), transcript variant 3 TAAAGCCATGACGATGCTCACCATCGAACAGTTATCATACCTGCTCAAGTTCGCCATTCA A_73_102730 A_73_102730 FALSE AW313809 AW313809 gb|Unidentified transcripts on BTA13 position 28112943-28113764 unmapped Unknown TGGGACAGTGACCAGGGCCTCAAAATGATCTGCAGGGCCGTTCAAATAAAGCTTTATTTT A_73_102731 A_73_102731 FALSE BI537318 BI537318 gb|Bos taurus similar to Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma (CEBPG) unmapped Unknown TCTCAGGAAAAAGTACTTGTTCTTTTTGTTCCTGGCTTTCCTCAGTTTGTGAGATAACTC A_73_102732 A_73_102732 FALSE XM_867040 XM_867040 LOC615280 ref|XM_867040 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 62 (GPR62) CAGAGACCTCCAGAGGGCCCTGCCCTTGGCCCTTCTGAGGCACCTGATCAAGGCCGGGAT A_73_102733 A_73_102733 FALSE CB460262 CB460262 gb|Unidentified transcripts on BTA10 position 55545047-55545698 unmapped Unknown TGCTCCCATCCTTCCTTGCCTCATTCCTCCTTGCAGCAGTGATTTTTGGAAATACTGTTT A_73_102734 A_73_102734 FALSE NM_174563 NM_174563 MRPL43 ref|NM_174563 unmapped Bos taurus mitochondrial ribosomal protein L43 (MRPL43) CTGTGAGCTGGCATTGGGCTAGGCCTTGTATCTATGTGATGTTTGTGTGCAGATTAGAAA A_73_102735 A_73_102735 FALSE NM_174674 NM_174674 TNFRSF1A ref|NM_174674 unmapped Bos taurus tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A) CCACTCTGTACACTAATAGAAACTTTGTTGCCCTGCCTGGACCAGCTGAACTGTCCCCAG A_73_102736 A_73_102736 FALSE XM_867207 XM_867207 LOC615408 ref|XM_867207 unmapped Bos taurus similar to Homo sapiens septin 5 (SEPT5) TTCTGTTGTGAATGCTGCACCCTGTCCTGGTGACAGGAGAACAATGTTGGTGAACGTCCA A_73_102737 A_73_102737 FALSE XM_866467 XM_866467 LOC614827 ref|XM_866467 unmapped PREDICTED: Bos taurus similar to P antigen family, member 3 (prostate associated) (LOC614827) CACACCTAGAAAGGAGGAAGTACATGGAGAGGATCCAGTGAATCGTGATGAAGAAGAGGA A_73_102738 A_73_102738 FALSE XM_604179 XM_604179 LOC525823 ref|XM_604179 unmapped Bos taurus similar to Homo sapiens solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2) GCTAGAGGGAAGAAAAATAGCTGAGCTTTCTCAAATGAAAGTTCTCTATTTTTAAATGGG A_73_102739 A_73_102739 FALSE AJ491862 AJ491862 gb|Bos taurus similar to Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1F (HTR1F) unmapped Unknown GGATGAGTGCATCATCAAACACGACCACATCATTTCCACTATTTACTCCACGTTTGGAGC A_73_102740 A_73_102740 FALSE NM_001015622 NM_001015622 LOC520278 ref|NM_001015622 unmapped Bos taurus prostacyclin receptor (LOC520278) CTTACCGGCTGTACAGCTACCCACCAGTACCGTGGGAACACCCTCCAAAGCGGGGTCTGA A_73_102741 A_73_102741 FALSE NM_174719 NM_174719 CHRNA3 ref|NM_174719 unmapped Bos taurus cholinergic receptor, nicotinic, alpha polypeptide 3 (CHRNA3) TGAGGGAGAGGGGGCTCACTTTTTAGTTTTCATTGTAAAGTACACAGCATAAAATTTATC A_73_102742 A_73_102742 FALSE NM_001038130 NM_001038130 MGC133492 ref|NM_001038130 unmapped Bos taurus similar to Homo sapiens chromosome 1 open reading frame 123 (C1orf123) AGTTTGTGAAGTGCTGAACCCTCTTCCTGTACACTTGCCTCTAAGAACTGAAAAGGGACA A_73_102743 A_73_102743 FALSE XM_881399 XM_881399 LOC505539 ref|XM_881399 unmapped Bos taurus similar to Homo sapiens high- mobility group protein 2-like 1 (HMG2L1), transcript variant 1 TAGTCCAGTGTCAGCTATCTTTTTCCTGTGGCAACCAAAGTGCCTATGAAATTTTAAACC A_73_102744 A_73_102744 FALSE XM_607085 XM_607085 LOC528655 ref|XM_607085 unmapped PREDICTED: Bos taurus similar to [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitochondrial precursor (Pyruvate dehydrogenase kinase isoform 1) (LOC528655), partial mRNA. ATGCTGACAAAGGTGTTTATCCGCCTATTCAGGTCCATGTCACACTGGGTAAAGAGGATT A_73_102745 A_73_102745 FALSE NM_001034467 NM_001034467 DCP1B ref|NM_001034467 unmapped Bos taurus similar to Homo sapiens DCP1 decapping enzyme homolog B (S. cerevisiae) (DCP1B) AGACGAGTACACGAAGTGTAAAACCTGCTCCGAGCCCAAACAGATCAGCAGCTCGTCCGC A_73_102746 A_73_102746 FALSE CB455927 CB455927 gb|Unidentified transcripts unmapped Unknown TTCTGTTTCTCTGGATGATTATTTCATTTGGTAAAACATGTAAGAGTTTCCCCCCTCTGT A_73_102747 A_73_102747 FALSE AV594529 AV594529 gb|Unidentified transcripts unmapped Unknown GCCTCTTGTTGACTAGAAGCGTTACTGATAATATAGACAGTTGACTGAACAACATTTTTA A_73_102748 A_73_102748 FALSE XM_605753 XM_605753 LOC527362 ref|XM_605753 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ10357 (FLJ10357) GCCAGTGCATACTCCCAGGACACAGCTCCGTGTCATAGGACACGGAGCTATGCAAACCAT A_73_102749 A_73_102749 FALSE XM_615945 XM_615945 LOC535831 ref|XM_615945 unmapped Bos taurus similar to Homo sapiens ankyrin repeat and SOCS box-containing 4 (ASB4), transcript variant 2 CGGAAGCCAATCTCATGGACATCAACGGCTGCGCTGCCATCCAGTATGTGCTGAAGGTCA A_73_102750 A_73_102750 FALSE XM_868812 XM_868812 LOC616716 ref|XM_868812 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily L, member 2 (OR2L2) CCTGAGAAACAAGGAGGTGATTGGGGCCCTGAGAAGAATAAAATTAAAAGACAGAATACT A_73_102751 A_73_102751 FALSE CB440633 CB440633 gb|Unidentified transcripts on BTA9 position 41101663-41100829 unmapped Unknown TACAGCCTGATGTCATTTCTTGTGTTCTAACTTCCTCTTCTGACAAGTAGCCAAGACAGC A_73_102752 A_73_102752 FALSE XM_612205 XM_612205 FGF8 ref|XM_612205 unmapped Bos taurus similar to Homo sapiens fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant E TGCATGAACAAGAAGGGAAAATTGATTGCCAAGAGCAACGGCAAAGGCAAGGACTGCGTG A_73_102753 A_73_102753 FALSE CB456831 CB456831 gb|Bos taurus similar to Homo sapiens DNA-damage-inducible transcript 4-like (DDIT4L) unmapped Unknown TGTCTTTGACTCTCTTGTCTTTTATACTCACAAAATAGTGATGGCTTTATAGAGACCCTT A_73_102754 A_73_102754 FALSE CB166435 CB166435 gb|Bos taurus similar to Homo sapiens CD47 molecule (CD47), transcript variant 2 unmapped Unknown GCTATTTGTCAGTAGCCATTTTTTGCAGTGATTTAAAGACCAAAGTTGTTTTACAGCTGT A_73_102755 A_73_102755 FALSE XM_864078 XM_864078 LOC533896 ref|XM_864078 unmapped Bos taurus similar to Homo sapiens dual specificity phosphatase 26 (putative) (DUSP26) GGTCGTGGCCCAAAAACAGCAGAGGTGCATGACTGCGAGTCTATCACTGATCACTCGCTT A_73_102756 A_73_102756 FALSE XM_588340 XM_588340 LOC511078 ref|XM_588340 unmapped Bos taurus similar to Homo sapiens lectin, galactoside-binding, soluble, 3 (galectin 3) (LGALS3) TGACATAACTCTGACCAGTGCTTCGCACACTATGATATAATCTTAAATGGGCAGATACTT A_73_102757 A_73_102757 FALSE XM_617867 XM_617867 LOC537690 ref|XM_617867 unmapped PREDICTED: Bos taurus similar to Exocyst complex component Sec8 (LOC537690) ACTGGATCTGGCTTTTCAGACAGCTTGCTTATTAATCAGTAGTGCACAAAGGCCGTTTGC A_73_102758 A_73_102758 FALSE NM_001014873 NM_001014873 WDR55 ref|NM_001014873 unmapped Bos taurus WD repeat domain 55 (WDR55) GGGCAAAGGCAGATGTTTGACCCTTTGGTTCCACCAGCCCTCAAATAAAAACTTCAACAA A_73_102759 A_73_102759 FALSE XM_593650 XM_593650 LOC515605 ref|XM_593650 unmapped Bos taurus similar to Homo sapiens DIP13 beta (DIP13B) CCAAGTTCAACAGAAATACCACTGTCTTTGTAATAAATTAACCTAGCAATAAACGCTAGC A_73_102760 A_73_102760 FALSE BF773936 BF773936 gb|Unidentified transcripts on BTA18 position 46240501-46242575 unmapped Unknown ACTCAAGGGTGGGTTGACCTGTGTGTGGTGCTTTTTGGAGGAGTGAATAAAAAAGTAGAA A_73_102761 A_73_102761 FALSE NM_001034742 NM_001034742 SURF5 ref|NM_001034742 unmapped Bos taurus surfeit 5 isoform b (SURF5) AAGCTCATCGCACTGCGGGACGAGGTTTCCATCGACCTGTACGAGCTGGAAGAGGAGTAT A_73_102762 A_73_102762 FALSE AW656245 AW656245 gb|Unidentified transcripts unmapped Unknown GCCACGGGGAGGAGTCGGATGCCCAGTGGACCTGTGCACTTAGTAAAACACAGTGATTCA A_73_102763 A_73_102763 FALSE XM_869405 XM_869405 LOC617196 ref|XM_869405 unmapped Bos taurus similar to Homo sapiens solute carrier family 26, member 7 (SLC26A7), transcript variant 2 TCTTTGGTCCATTGCACAGCTTCCTTGATAAAAGCAATGAAATACTGTGGAAACCTAGAT A_73_102764 A_73_102764 FALSE XM_605846 XM_605846 LOC527455 ref|XM_605846 unmapped PREDICTED: Bos taurus similar to cocoacrisp (LOC527455) TGTGCCATTAATTTGTGCCACAACATGAACATCTGGGGGCAAATATGGCCCAAAGCTGTT A_73_102765 A_73_102765 FALSE NM_001008668 NM_001008668 SIAT2 ref|NM_001008668 unmapped Bos taurus similar to Homo sapiens ST6 beta- galactosamide alpha-2,6-sialyltranferase 2 (ST6GAL2) TTGTTTAGCTCCTTGAATCTATTAGGCAGTTATAGTTGATGTGTTGACTCTTCTCGTCAG A_73_102766 A_73_102766 FALSE NM_173939 NM_173939 MUT ref|NM_173939 unmapped Bos taurus methylmalonyl Coenzyme A mutase (MUT) GATGATATTGAAAAGTGTTTGGAAAAGAAGCAACAGTCTATATAACATCCTGTTTTGGGG A_73_102767 A_73_102767 FALSE XM_589444 XM_589444 LOC539784 ref|XM_589444 unmapped Bos taurus similar to Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 (PSMD2) ACACTGCTCCAGACCTTTAGGGGAATCCAGACCTTCTTTTGTTACTGAGTGCGATAACTT A_73_102768 A_73_102768 FALSE CB419959 CB419959 gb|Bos taurus similar to Homo sapiens KIAA0523 protein (KIAA0523) unmapped Unknown CCTGTGACTGGCCCTGCCTGTGGATGGTTTTGTTACATGAGCCAATAAATTCCGTTTATT A_73_102769 A_73_102769 FALSE NM_173981 NM_173981 AGC1 ref|NM_173981 unmapped Bos taurus aggrecan 1 (chondroitin sulfate proteoglycan 1, large aggregating proteoglycan, antigen identified by monoclonal antibody A0122) (AGC1) CCTAGCCAGGCTGACACCCCATCCGGATGGTGTCCTCTCCTTGTCGCTTTCTGTCATATA A_73_102770 A_73_102770 FALSE NM_001035066 NM_001035066 CMTM6 ref|NM_001035066 unmapped Bos taurus similar to Homo sapiens CKLF-like MARVEL transmembrane domain containing 6 (CMTM6) TACGTTTTTCCCTTACACATGTAAAACCCAGGCTTTTACCATATCTCACTCTGCCAAAAA A_73_102771 A_73_102771 FALSE XM_586496 XM_586496 LOC509518 ref|XM_586496 unmapped Bos taurus lysozyme 14D mRNA TTATTGTTTGATATTGGGCCTACAACATTTTTAAGCTTGCTAACAGAACTAATGCTGGTG A_73_102772 A_73_102772 FALSE XM_605443 XM_605443 LOC527056 ref|XM_605443 unmapped PREDICTED: Bos taurus similar to RING finger protein 6 (RING-H2 protein) (LOC527056) GAAACAAGCTCAGGCAGTTACCCTGCATGCACGAGTTCCACATCCACTGCATCGACCGGT A_73_102773 A_73_102773 FALSE XM_594667 XM_594667 LOC516512 ref|XM_594667 unmapped PREDICTED: Bos taurus similar to diaphanous 2 isoform 156 (LOC516512) AATTCCTTGTCAGTTGCAGTGCCTTGATTCATACTTGGTCAATAGGTGGCAGGATCAGTA A_73_102774 A_73_102774 FALSE XM_607350 XM_607350 LOC528914 ref|XM_607350 unmapped PREDICTED: Bos taurus similar to Olfactory receptor 1F12 (Hs6M1-35P) (LOC528914) ACAATGAGCTAAAGGGGGCTTTAAAGAAGATTTTAGGCCAGAGCAAAATCTTCTCCCAGT A_73_102775 A_73_102775 FALSE XM_602462 XM_602462 LOC524142 ref|XM_602462 unmapped Bos taurus similar to Homo sapiens optic atrophy 1 (autosomal dominant) (OPA1), nuclear gene encoding mitochondrial protein, transcript variant 1 TCATATAATCACCTCAGCATACATCTGAAGAAAGAAAACTCAAAAGTCTTTTGTCTTGCC A_73_102776 A_73_102776 FALSE XM_602931 XM_602931 LOC524603 ref|XM_602931 unmapped Bos taurus similar to Homo sapiens arylsulfatase G (ARSG) TTCCTCTGGTTTACAGGGGACAATGGCCCGTGGGCTCAGAAGTGTGAGCTGGCCGGGAGT A_73_102777 A_73_102777 FALSE CB441125 CB441125 gb|Unidentified transcripts on BTA16 position 49959197-49958437 unmapped Unknown TTCTCACTGCCCTTGTCATTGCTGTTAAATGTTTCATATGTGCCTTTACAAATGTGAGAT A_73_102778 A_73_102778 FALSE NM_174591 NM_174591 RABEX5 ref|NM_174591 unmapped Bos taurus putative Rab5 GDP/GTP exchange factor homologue (RABEX5) CTGTTCTTTTAGTCATTGTACATTATGTTTACTAAATAAAATGTGCATATCGGCCTCCCC A_73_102779 A_73_102779 FALSE NW_928413 NW_928413 gb|Bovine miRNA bta- mir-199b on chr 11, (-) strand. Mature length 23 nt, stem-loop length 100 nt. Source: NW_928413.1:c40326-40227 unmapped Unknown CCCAGTGTTTAGACTATCTGTTCTATCCTACTATACGTATCACAT A_73_102780 A_73_102780 FALSE BE845976 BE845976 gb|Bos taurus similar to Homo sapiens beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) (B3GALNT1), transcript variant 2 unmapped Unknown AACTAATAGGACCAAACAGTTCGAACATATCATTCTATAGTCTAGAGCTTCTTAAATGGG A_73_102781 A_73_102781 FALSE AW660819 AW660819 gb|Bos taurus similar to Homo sapiens membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) (MPP2) unmapped Unknown CCTCAGCCATCTAATCCCCAAGCTTTCTCTCTGACTGGTTTTCTTTCCTTTGATTAAATG A_73_102782 A_73_102782 FALSE NM_001034500 NM_001034500 MGC128402 ref|NM_001034500 unmapped Bos taurus similar to Homo sapiens emopamil binding protein (sterol isomerase) (EBP) TCAGGAGCCAATAGGACAAAGGTACAAGAGAACCTAGGAAGTCTGTGATGGGGACAATTT A_73_102783 A_73_102783 FALSE BI848985 BI848985 gb|Bos taurus similar to Homo sapiens arachidonate 15-lipoxygenase (ALOX15) unmapped Unknown CTTAGTTTGTTTCCTGTTCTCTCATTCAGATTCCAAGGAAGAAAAATAAAGATGCTTTCC A_73_102784 A_73_102784 FALSE XM_585460 XM_585460 LOC508652 ref|XM_585460 unmapped Bos taurus similar to Homo sapiens replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1 CTGTTGCTTTAGAATTTCCCAGTGAATTTTGTAGAAATGCTTTGTTTGTTGGCAAAATGC A_73_102785 A_73_102785 FALSE XM_869306 XM_869306 LOC617115 ref|XM_869306 unmapped PREDICTED: Bos taurus similar to ABI gene family, member 3 (NESH) binding protein isoform 5 (LOC617115) AGCCCTGAAGCACCTCAGACCAAATTGGGTAAATGTGTTATTCCATGGTTTGAGGGGTAA A_73_102786 A_73_102786 FALSE XM_866099 XM_866099 LOC614556 ref|XM_866099 unmapped Bos taurus similar to Homo sapiens golgi phosphoprotein 3 (coat-protein) (GOLPH3) TGGTTAACCTTCAATGCAAAAGTACTAGATGGTGTATAACTCTAGAGTTGAGTTTTAAGG A_73_102787 A_73_102787 FALSE XM_593767 XM_593767 LOC515695 ref|XM_593767 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 20 (GPR20) GGCTCAGCCCACCATCACATCCTCGGGGCCAGAGCTCAGGCCGTCACACAGGCCCTGCCC A_73_102788 A_73_102788 FALSE BE589060 BE589060 gb|Unidentified transcripts on BTA29 position 36872781-36871315 unmapped Unknown GAAATACGGTGTGTCTGTATTGTTGGAAATAGTGTTGAGGCAGCTGAGATGAAATGCAGT A_73_102789 A_73_102789 FALSE XM_868921 XM_868921 LOC513399 ref|XM_868921 unmapped Bos taurus similar to Homo sapiens cyclin H (CCNH) AAAGACGTGTAGAGGTTTTATTTCATCATTGATCAGCTAAGTGACTCTAAGTCCTACAAA A_73_102790 A_73_102790 FALSE XM_582327 XM_582327 LOC505955 ref|XM_582327 unmapped PREDICTED: Bos taurus similar to Leukocyte immunoglobulin-like receptor subfamily B member 3 precursor (Leukocyte immunoglobulin-like receptor 3) (LIR-3) (Immunoglobulin-like transcript 5) (ILT-5) (Monocyte inhibitory receptor HL9) (CD85a antigen)... TGCTCCTCGTCCTCCTCTTCCTCTTCCTCCGACACCGGGGTCAGGACAGACACAGGAAGT A_73_102791 A_73_102791 FALSE XM_611967 XM_611967 LOC532789 ref|XM_611967 unmapped Bos taurus similar to Homo sapiens PRKC, apoptosis, WT1, regulator (PAWR) AAGCAGGAGAATAAAACTCTTTTGAAGGTTGTTGGGCAGCTAACAAGGTAGAAGATTCAA A_73_102792 A_73_102792 FALSE NM_173952 NM_173952 PPY ref|NM_173952 unmapped Bos taurus pancreatic hormone (PPY) AGCAGTCCCCAGGTGGGTTTTTTCTTTGTCCTGTGTGCCCAGATGCCTGGGGCAGGAAAA A_73_102793 A_73_102793 FALSE NM_001034499 NM_001034499 MGC128242 ref|NM_001034499 unmapped Bos taurus similar to Homo sapiens transgelin 3 (TAGLN3), transcript variant 1 ATTTGCCAAAAATGTCCCTCCTCAACTTACAGAACGCACCTAATAAACAAATTAGTCTTG A_73_102794 A_73_102794 FALSE XM_866973 XM_866973 LOC615226 ref|XM_866973 unmapped PREDICTED: Bos taurus similar to glutamate receptor 6 isoform 1 precursor (LOC615226), partial mRNA. TGCCTTTTGGGGCAGAAAGCATGCTGGTTATGTCAGTAAGCTATAGATGCGTTAGAGATT A_73_102795 A_73_102795 FALSE CB461587 CB461587 gb|Bos taurus similar to Homo sapiens KIAA1632 (KIAA1632) unmapped Unknown CAGGAAATGTTCTGTGTGCTGCTTTCTTTGAGGAAGATGTAATTACTGATATCCTAGAAT A_73_102796 A_73_102796 FALSE XM_590610 XM_590610 LOC512999 ref|XM_590610 unmapped Bos taurus similar to Homo sapiens MANSC domain containing 1 (MANSC1) GTTAGGATTCCTAGGCTCCATTTCACTAATGTTTCTGGTTCCAGATAAAGTTGACTGTTT A_73_102797 A_73_102797 FALSE XM_603686 XM_603686 LOC525334 ref|XM_603686 unmapped Bos taurus similar to Homo sapiens monocyte to macrophage differentiation-associated 2 (MMD2) ACTACTATGCCATCTGGAGGTACTTGTATCTGCCCAGCACCCTGCACGCCAAGGTGTCCA A_73_102798 A_73_102798 FALSE NM_182655 NM_182655 TRIM21 ref|NM_182655 unmapped Bos taurus 52kD Ro/SSA autoantigen (TRIM21) ATTCCTGCCCTATGTTGCTTTATCATTCCCTCCATGAAATAAACTACTTGCATTTGGCCC A_73_102799 A_73_102799 FALSE NM_174113 NM_174113 MSR1 ref|NM_174113 unmapped Bos taurus macrophage scavenger receptor 1 (MSR1) TTCACCAGCCTGCTTCATTTAATATCCTTGGTAAACGCACATGTAAAAACAAAGTTTCGA A_73_102800 A_73_102800 FALSE NM_175818 NM_175818 NDUFB10 ref|NM_175818 unmapped Bos taurus NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa (NDUFB10) AGAAAAGCCGCCAAAGAGGCTGCTGCTGCCTGAGGCAGCAGTGTCAGCTTTGTCACTGTT A_73_102801 A_73_102801 FALSE XM_589873 XM_589873 LOC512364 ref|XM_589873 unmapped Bos taurus similar to Homo sapiens zinc finger protein 84 (ZNF84) ATATAGGACAATCTTCGGCAAGTAACCCCACCATATTGTGTCCTGTGGGTGTACCTAACA A_73_102802 A_73_102802 FALSE XM_596295 XM_596295 LOC518111 ref|XM_596295 unmapped Bos taurus similar to Homo sapiens solute carrier family 30 (zinc transporter), member 6 (SLC30A6) TTGACTGCAGCGTGATATAACATTACCTTTATAAGAGAACCACTTGATGGAGTAGATTTG A_73_102803 A_73_102803 FALSE NM_205773 NM_205773 LOC404072 ref|NM_205773 unmapped Bos taurus eotaxin (LOC404072) GAAGACATCACTCTCGTAAAGCAAAGGTTTATGAGACTCATAAATGTTAAATGGAAATGC A_73_102804 A_73_102804 FALSE XM_866830 XM_866830 LOC615110 ref|XM_866830 unmapped PREDICTED: Bos taurus similar to Alkaline phytoceramidase (aPHC) (Alkaline ceramidase) (Alkaline dihydroceramidase SB89) (LOC615110) CAGGTCATGTATGGAATGTTGGTCTTCACTTTAGTGGTTCGATCTATTTATATTGTTACA A_73_102805 A_73_102805 FALSE XM_878134 XM_878134 LOC511765 ref|XM_878134 unmapped PREDICTED: Bos taurus hypothetical LOC511765, transcript variant 3 (LOC511765) GCAAGGAGAATGACAAAATGAACTGATCCTTTTTCCTTGGCATTAAAGTTATTTCTGATC A_73_102806 A_73_102806 FALSE XM_867029 XM_867029 LOC615269 ref|XM_867029 unmapped PREDICTED: Bos taurus similar to CREBBP/EP300 inhibitor 2 (LOC615269) GTCTTTCCAGTTTCCCTTTATATACACAAGTAAATGCAAAGCTGGGTCGTTTTTTGGTTT A_73_102807 A_73_102807 FALSE XM_587124 XM_587124 LOC510040 ref|XM_587124 unmapped Bos taurus similar to Homo sapiens similar to CG10671-like (LOC161247) CTCCCACACCTTCCTGCTCACCTTCTGCTGCCTGCTCATGGCCGAGGAAGCAGCAGTGTT A_73_102808 A_73_102808 FALSE AW653633 AW653633 gb|Bos taurus similar to Homo sapiens TNF receptor-associated factor 4 (TRAF4), transcript variant 1 unmapped Unknown AGGTGCCTTTGACAATCTCCTCGAGTGGCCCTTCGCCCGCCGTGTGACCTTCTCCCTACT A_73_102809 A_73_102809 FALSE NM_174418 NM_174418 PDE6B ref|NM_174418 unmapped Bos taurus phosphodiesterase, cyclic GMP ( rod receptor), beta polypeptide (PDE6B) ACAGGTGGAGAAATGGATACATGGATGCCAGTTCTCATCTGGTTTAGGAACAAATATGTG A_73_102810 A_73_102810 FALSE XM_613343 XM_613343 LOC533815 ref|XM_613343 unmapped PREDICTED: Bos taurus similar to Serine /threonine-protein kinase 3 (STE20-like kinase MST2) (MST-2) (Mammalian STE20-like protein kinase 2) (Serine/threonine-protein kinase Krs-1) (LOC533815) TTTGTCAGGGTGAAGCAGATAGGAATCGGATAGACTGGAACCCTAGGACAGCTGTATTAA A_73_102811 A_73_102811 FALSE CB166928 CB166928 gb|Unidentified transcripts on BTA13 position 42703677-42704800 unmapped Unknown TAATTTGTGTGCAGACAGTTATGTGGTTCCCTCAGAATAGAAACTACATGGTTGGGTGCA A_73_102812 A_73_102812 FALSE XM_588485 XM_588485 LOC539632 ref|XM_588485 unmapped Bos taurus similar to Homo sapiens zinc finger protein 366 (ZNF366) CAGAGATGAGAGTTTAAAAGAATTACTGGAGAGGAAAATGGAAAAACAAGCAGTGCTTTT A_73_102813 A_73_102813 FALSE XM_864934 XM_864934 LOC613801 ref|XM_864934 unmapped Bos taurus similar to Homo sapiens ubiquitin specific peptidase 32 (USP32) TGCTGAAAGACAAAAATGTGAGTGTGTTAAACATTGTCACAAAATTTGCAAACGATACGG A_73_102814 A_73_102814 FALSE XM_602780 XM_602780 LOC524456 ref|XM_602780 unmapped Bos taurus similar to Homo sapiens solute carrier family 39 (zinc transporter), member 6 (SLC39A6) TTTCTAGAACTAATTTAATATAGTGATTCCCATGCTGGATTTTAGGCCTCTGAAAACTGC A_73_102815 A_73_102815 FALSE XM_591180 XM_591180 LOC513491 ref|XM_591180 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 2, subfamily Z, member 1 (OR2Z1) CCCCCTCATATACAGCCTGAGGAACCGGGAAGTGTGGATGGCTTTGGTCAAAGTTCTCCG A_73_102816 A_73_102816 FALSE AV603593 AV603593 gb|Bos taurus similar to Homo sapiens ataxin 10 (ATXN10) unmapped Unknown AACCCCTTTCTAACCCAGATCATTAATGTAATCAGCAAACACTCTCGGGGCAGGTTGTGT A_73_102817 A_73_102817 FALSE XM_617182 XM_617182 LOC537028 ref|XM_617182 unmapped Bos taurus similar to Homo sapiens MOCO sulphurase C-terminal domain containing 1 (MOSC1) ACCCATGGATGAGAAGAAATGTGATTGTGTGATTTGAAATAAACCACTGTATTTCAGGTT A_73_102818 A_73_102818 FALSE XM_598733 XM_598733 LOC520488 ref|XM_598733 unmapped PREDICTED: Bos taurus similar to Protein kinase C and casein kinase substrate in neurons protein 1 (LOC520488) TCTACGACTACGACGGCCAAGAGCAGGACGAGCTCAGCTTCAAGGCGGGAGACGAGCTCA A_73_102819 A_73_102819 FALSE CB466367 CB466367 gb|Unidentified transcripts on BTA2 position 55159762-55160035 unmapped Unknown CTGTATATAGTGTGACAAAATGATTTTTCTTTCTTTCTTTTGGATGTATTAATAAATCTT A_73_102820 A_73_102820 FALSE XM_871000 XM_871000 LOC618674 ref|XM_871000 unmapped PREDICTED: Bos taurus hypothetical protein LOC618674 (LOC618674) AACTACAAAACTTAAGTAAAACTTCTTTAGAGAATTTCAGGGCTGAAAAGGTCTTGGAAA A_73_102821 A_73_102821 FALSE NM_176631 NM_176631 MUC15 ref|NM_176631 unmapped Bos taurus mucin 15 (MUC15) CATCAATCACTGGATATATTTAGGATACAGTCCAAGTGTTTTTTAATCAGACATGACCTG A_73_102822 A_73_102822 FALSE NM_001033614 NM_001033614 RPS18 ref|NM_001033614 unmapped Bos taurus similar to Homo sapiens ribosomal protein S18 (RPS18) TGTCCAAGAAGAAATAATGTGTGGGCTTTGTGTTAATAAATAGTTTATACAGTTAAAACA A_73_102823 A_73_102823 FALSE NM_001038214 NM_001038214 SCAP2 ref|NM_001038214 unmapped Bos taurus similar to Homo sapiens src family associated phosphoprotein 2 (SCAP2) ATTTTGTGCTTCTGATCCAAGTGAAGATTTTAGTCCTGGGCCAGTAGATGGCAGCAGCTT A_73_102824 A_73_102824 FALSE XM_612956 XM_612956 LOC533523 ref|XM_612956 unmapped Bos taurus similar to Homo sapiens discoidin domain receptor family, member 2 (DDR2), transcript variant 2 TTTCACCTTTTGCCAGGAACAGCCCTATTCCCAACTGTCAGATGAACAGGTCATTGAGAA A_73_102825 A_73_102825 FALSE XM_585665 XM_585665 LOC539211 ref|XM_585665 unmapped PREDICTED: Bos taurus similar to phosphatidylinositol-4-phosphate 5-kinase, type II, beta (LOC539211) GCGCTTCAACGAGTTCATGTCCAACATCCTGACGTAGTTATCGTCTACCTTCAGCCAGAG A_73_102826 A_73_102826 FALSE XM_870803 XM_870803 LOC618469 ref|XM_870803 unmapped PREDICTED: Bos taurus similar to keratin associated protein 10-8 (LOC618469) GCCCCAGCTGTGTGTCCAGCTGCTGTCAGCCTTCCTGTTGCTGATCACTTCACCAAAGAA A_73_102827 A_73_102827 FALSE XM_865271 XM_865271 LOC613991 ref|XM_865271 unmapped Bos taurus similar to Homo sapiens collectin sub-family member 11 (COLEC11), transcript variant 1 CTTTGCTTTGCTGCAAACCCAGATTTCAAGAACAAGAGAAATAAAGGCTCTGAATCTGCT A_73_102828 A_73_102828 FALSE XM_868160 XM_868160 LOC616192 ref|XM_868160 unmapped Bos taurus similar to Homo sapiens pancreatic lipase-related protein 3 (PNLIPRP3) TCAGTACCCAAGCTGTGACCTCTGAGTCTGTTGAATTTTGCATCTCTCTACCTACTTGCT A_73_102829 A_73_102829 FALSE XM_869675 XM_869675 LOC617422 ref|XM_869675 unmapped Bos taurus similar to Homo sapiens polymerase (RNA) II (DNA directed) polypeptide D (POLR2D) TAGAACAACCCAGTGCTTCGTCTTGGTTTAGGTTGCTATTTCAAGCTTGACTGTTGGCCA A_73_102830 A_73_102830 FALSE XM_879178 XM_879178 LOC513711 ref|XM_879178 unmapped Bos taurus similar to Homo sapiens RNA binding motif protein 23 (RBM23) GTCTTGATGAAGGACTCAGAAACAGGCCGCTCCAAAGGTTATGGTTTTATTACGTTCTCT A_73_102831 A_73_102831 FALSE NM_174836 NM_174836 DNAJC6 ref|NM_174836 unmapped Bos taurus DnaJ (Hsp40) homolog, subfamily C, member 6 (DNAJC6) CAGGTTTTCGCATTCCTTTTAAATATCTGGTTGTGACAGAGCTTGTTGTTGATCGGATTC A_73_102832 A_73_102832 FALSE XM_601997 XM_601997 LOC523694 ref|XM_601997 unmapped Bos taurus similar to Homo sapiens selenoprotein W, 1 (SEPW1) CCTCTCGGCAGACGCTTCATGACAGGAAGGACTGAAATGTCTCTTGGACGCCTGGTCCTT A_73_102833 A_73_102833 FALSE NM_174412 NM_174412 PCSK1 ref|NM_174412 unmapped Bos taurus proprotein convertase subtilisin/kexin type 1 (PCSK1) CTTGCACAAGTCAAATGTTTTGTTCTTTTCTGGGGCCACAGTTCACACCTGGTCCTCATA A_73_102834 A_73_102834 FALSE XM_618000 XM_618000 LOC537815 ref|XM_618000 unmapped Bos taurus similar to Homo sapiens POU domain, class 6, transcription factor 2 (POU6F2) AGCACGAGCCGACCACGGCGGTCCCTTTGGAACCCTTAACAGACTCGCTGGAAGAAAATT A_73_102835 A_73_102835 FALSE NM_001038673 NM_001038673 MGC134508 ref|NM_001038673 unmapped Bos taurus similar to Homo sapiens actin related protein M1 (ARPM1) TAATGGAGAAGCAGTCAAATAACAGATGCTTACTGAGTTGAACCAAATTAAATGCTCATG A_73_102836 A_73_102836 FALSE NM_174234 NM_174234 AIPL1 ref|NM_174234 unmapped Bos taurus aryl hydrocarbon receptor interacting protein-like 1 (AIPL1) TACTACGAGGTGCTGGAACACACTAGTGACATCCTCCGGCATCACCCAGGCATCGTGAAG A_73_102837 A_73_102837 FALSE XM_590131 XM_590131 LOC512590 ref|XM_590131 unmapped Bos taurus similar to Homo sapiens core- binding factor, beta subunit (CBFB), transcript variant 1 GCCTTAAGCTACCAGATTGCTTTTGCCACCATTAGCCATATTGTGTGTTTGTACGTTTAA A_73_102838 A_73_102838 FALSE XM_583879 XM_583879 LOC507292 ref|XM_583879 unmapped Bos taurus similar to Homo sapiens COMM domain containing 8 (COMMD8) TTTCCTCTGCACGACTACAGGATTTTGATTGGCAGATAAAGCTTTGCACTTTCTTAGTGA A_73_102839 A_73_102839 FALSE CB460006 CB460006 gb|Unidentified transcripts on BTA16 position 13960483-13962289 unmapped Unknown TTTATACTGTACATCAAACAACAAAGGAGAAGACTGAGTCAGAATGAGGAGACATGGGCC A_73_102840 A_73_102840 FALSE XM_588199 XM_588199 LOC510957 ref|XM_588199 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L19 (MRPL19), nuclear gene encoding mitochondrial protein CTGTTACTGGAATGCTCTTCATTGAGCTTGGGATCTGAACAAGGAAGTCAGTAGGATGAT A_73_102841 A_73_102841 FALSE NM_001015658 NM_001015658 TCFL1 ref|NM_001015658 unmapped Bos taurus similar to Homo sapiens vacuolar protein sorting 72 (yeast) (VPS72) CCCAGCTCGTCTCTGTATTTCTTTCACATCTTTCCCCCTAGTTCCTACAGGTTTGTGTTT A_73_102842 A_73_102842 FALSE XM_587985 XM_587985 LOC539545 ref|XM_587985 unmapped Bos taurus similar to Homo sapiens lethal giant larvae homolog 2 (Drosophila) (LLGL2), transcript variant 1 GGCTGTCCCTCCCCGGGCCCTGACTCTCCTGGTTCCTTTGTTAATGTTGCACAATTTTGA A_73_102843 A_73_102843 FALSE XM_602464 XM_602464 LOC524144 ref|XM_602464 unmapped PREDICTED: Bos taurus similar to potassium channel, subfamily U, member 1 (LOC524144) CTGTGGAAGAAAATGGAAAAGAAAGCATGGAGGAAACCACAGTGGAAGATGCCTATGCCT A_73_102844 A_73_102844 FALSE XM_582671 XM_582671 LOC538785 ref|XM_582671 unmapped Bos taurus similar to Homo sapiens STAM binding protein-like 1 (STAMBPL1) TGTCTTAAGAGGTTACAGTGGATTTGTCAGTATCCATTAGTGTGCCTGAATACTATGACC A_73_102845 A_73_102845 FALSE XM_614060 XM_614060 LOC541003 ref|XM_614060 unmapped Bos taurus similar to Homo sapiens ubiquitin- conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) (UBE2D2), transcript variant 2 GGTATGGTGTGTTCTTGGATGGGGAAGAAAAGCTCCACTGACCTGTAGGAGATTGTTTTT A_73_102846 A_73_102846 FALSE XM_603356 XM_603356 LOC525013 ref|XM_603356 unmapped Bos taurus similar to Homo sapiens thyroid peroxidase (TPO), transcript variant 1 CCCGCGGGCATCTGTGGTCTCGCTGGTGCTGGGTGCCATGCTCGTCTGCAGTCTGGCCGG A_73_102847 A_73_102847 FALSE BE665842 BE665842 gb|Bos taurus similar to Homo sapiens l(3)mbt-like 3 (Drosophila) (L3MBTL3), transcript variant 1 unmapped Unknown TTTTGTTGTAGTTCAAGGTAAAACAGGGCCCATGAAATCTGCCATGGCCCCTTCGTTTCT A_73_102848 A_73_102848 FALSE AW313777 AW313777 gb|Bos taurus similar to PREDICTED: Homo sapiens RNA binding motif protein 20 (RBM20) unmapped Unknown TGAGTGTGTCCTATTAATCGTCACTTTTCCTGATCTGTATAATTGACCTCAAGCGTTTGT A_73_102849 A_73_102849 FALSE EE911885 EE911885 gb|Unidentified transcripts on BTA5 position 5060765-5061364 unmapped Unknown GTTCAGAAGCATGGATTTCATGAATATAGATGGGAGGAGCAGAAAGTAAGGAATGGGAGT A_73_102850 A_73_102850 FALSE XM_589619 XM_589619 LOC512164 ref|XM_589619 unmapped Bos taurus similar to Homo sapiens inter-alpha (globulin) inhibitor H2 (ITIH2) TCAGCTCTATAGCTTCCTCAGACGGCCTTAAAAGTTTATAGCTGGGGAAATTCTCGGTCA A_73_102851 A_73_102851 FALSE XM_877081 XM_877081 LOC513054 ref|XM_877081 unmapped Bos taurus similar to Homo sapiens Wolf- Hirschhorn syndrome candidate 1-like 1 (WHSC1L1), transcript variant short AGGAGAATGAGTACCAAAACCGGGACAGATTGTTAATGCACTGTGTTTAGTTAGTAGCAG A_73_102852 A_73_102852 FALSE NM_001015527 NM_001015527 GTF2F1 ref|NM_001015527 unmapped Bos taurus general transcription factor IIF, polypeptide 1, 74kDa (GTF2F1) TGCATTTCTCCCTCAAGGAGTGATGCTCCCCCAATAAACAGGCTCTGTTTTCCACAAAAA A_73_102853 A_73_102853 FALSE XM_866156 XM_866156 LOC534286 ref|XM_866156 unmapped Bos taurus similar to Homo sapiens aminolevulinate, delta-, synthase 1 (ALAS1), transcript variant 1 TGTCTGCTCAGGCCTGAATGTGCTGTGCCCTAAGTTGCTCCACCTACCCCAAGTCACGTT A_73_102854 A_73_102854 FALSE XM_618109 XM_618109 LOC537921 ref|XM_618109 unmapped Bos taurus similar to Homo sapiens FK506 binding protein 6, 36kDa (FKBP6) GTCTTTGCAGTGGCTTCTCTCGTTGCAGACACAGGCTGCAGGTGTCAGGCTTCCGTAGTT A_73_102855 A_73_102855 FALSE XM_597433 XM_597433 LOC519219 ref|XM_597433 unmapped Bos taurus similar to Homo sapiens serpin peptidase inhibitor, clade I (pancpin), member 2 (SERPINI2) AGATAAATGAAGAAGGCAGTGAAGTTGCAACATCAACTGGTAGGACAAATGATGTCACAG A_73_102856 A_73_102856 FALSE NM_174822 NM_174822 NDRD ref|NM_174822 unmapped Bos taurus NADPH-dependent retinol dehydrogenase/reductase (NDRD) GAGATGGGACAGAAGGAACTTGGAGTGGAAGGAACTGAGTTGGAAATTAACAACTTGCAA A_73_102857 A_73_102857 FALSE XM_581357 XM_581357 LOC505118 ref|XM_581357 unmapped Bos taurus similar to Homo sapiens YME1-like 1 (S. cerevisiae) (YME1L1), nuclear gene encoding mitochondrial protein, transcript variant 3 TCAGAGGTGTGAAACACTTTGTCACTCTGTTGTCACATTCATCTAATTTTGATTATTCTC A_73_102858 A_73_102858 FALSE NM_181021 NM_181021 GNAS1 ref|NM_181021 unmapped Bos taurus guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1 (GNAS1) AAAGGCCACAAATGTTCCCTTCTCTCTTTAAGTAACTACAATAATAGCAGCAAACAGAAA A_73_102859 A_73_102859 FALSE XM_589428 XM_589428 LOC511996 ref|XM_589428 unmapped Bos taurus similar to Homo sapiens aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) (AKR7A3) TTGCCTTCACGATGCGTAACGCCTTGGGCTGAGGCCCTTGGGCATTTCCCGTCTGAATAA A_73_102860 A_73_102860 FALSE XM_871007 XM_871007 LOC618683 ref|XM_871007 unmapped PREDICTED: Bos taurus similar to Tyrosine- protein kinase Tec (LOC618683), partial mRNA. AAGGTGGTTTTATGGTAAGAGATTCCAGTCAACCAGGCATGTACACAGTTTCCCTTTATA A_73_102861 A_73_102861 FALSE NM_174534 NM_174534 DNASE1 ref|NM_174534 unmapped Bos taurus deoxyribonuclease I (DNASE1) TAAAACTAAGAAATGCCTTTTAATTTAAATAAAGCTCAAAAGGGGGTGTTGTCATTCACG A_73_102862 A_73_102862 FALSE BF652849 BF652849 gb|Unidentified transcripts on BTA9 position 20671033-20670107 unmapped Unknown TTTTTTCACTAAAGAGTAGGGTTTCCTTCCCCATCCCAGCTTTGAAACTAAATTGAATCA A_73_102863 A_73_102863 FALSE XM_588603 XM_588603 LOC511296 ref|XM_588603 unmapped Bos taurus similar to Homo sapiens cyclin G associated kinase (GAK) CTGCGCTGCTAACCTGCAGAGTCTGTCTGTGAGCGTTCATGTCTCCCCTGTAATCAGCCT A_73_102864 A_73_102864 FALSE XM_583601 XM_583601 LOC507051 ref|XM_583601 unmapped Bos taurus similar to Homo sapiens cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa (CSTF1), transcript variant 2 ATTCAATTCTAGCCTCATCAGAGAGCGCTGAGCTCCTCTTACCAGATAGATGTTCTGGTT A_73_102865 A_73_102865 FALSE NM_205794 NM_205794 AGO2 ref|NM_205794 unmapped Bos taurus argonaute 2 (AGO2) GACTGTGACATTTATTTTCCAAAGTTTCTAAAGAATACGGGTCTGTGGTGATAAATACAG A_73_102866 A_73_102866 FALSE XM_604902 XM_604902 LOC526529 ref|XM_604902 unmapped PREDICTED: Bos taurus similar to Gamma-tubulin complex component 3 (GCP-3) (Spindle pole body protein Spc98 homolog) (hSpc98) (hGCP3) (h104p) (LOC526529) CGGCCAGAGATGTGTTGGTTCTTTCTCGACTCATCTGTGAGGACAGTTCACCCCCAGGCT A_73_102867 A_73_102867 FALSE XM_585092 XM_585092 LOC508330 ref|XM_585092 unmapped Bos taurus similar to Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) (MLL) GATTCAGACAACACAGAATCCAGCACATGAACCAGAAAATTCAGAACCTAAAACGGCGGA A_73_102868 A_73_102868 FALSE XM_588659 XM_588659 LOC511340 ref|XM_588659 unmapped PREDICTED: Bos taurus similar to Tumor protein p53 inducible nuclear protein 2 (Diabetes and obesity regulated protein) (LOC511340) ATCGAGCACCCCAGCATGTCCGTTTACGTGACCGGCAGCACCATAGTGCTGGAGTCTGGC A_73_102869 A_73_102869 FALSE XM_866294 XM_866294 LOC614707 ref|XM_866294 unmapped Bos taurus similar to Homo sapiens semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A) CAACTGCATCCTGTTCATCGAGAACCTCACGGACCTCCATTATGGCCACTACTACTGCGA A_73_102870 A_73_102870 FALSE BI774772 BI774772 gb|Bos taurus similar to Homo sapiens UDP-glucuronic acid epimerase (GLCE) unmapped Unknown GGAGTTTTCTAGGGTTTTAAATCATGCAAAATGTTTAGTCTGAGATTAGAGAAAATGGGG A_73_102871 A_73_102871 FALSE XM_593815 XM_593815 LOC515741 ref|XM_593815 unmapped PREDICTED: Bos taurus similar to Calpain-2 catalytic subunit (Calpain-2 large subunit) (Calcium-activated neutral proteinase 2) (CANP 2) (Calpain M-type) (M-calpain) (Millimolar- calpain) (Calpain large polypeptide L2) (LOC515741) TGATGTTCTATCAGGAGGTTTTCCACAAGCAAGACACTAACCGGTCAGGATCCCTGAATT A_73_102872 A_73_102872 FALSE NM_001034531 NM_001034531 CHEK2 ref|NM_001034531 unmapped Bos taurus similar to Homo sapiens CHK2 checkpoint homolog (S. pombe) (CHEK2), transcript variant 2 GTTTGTTGAAAGTGGCTGGTTGCCAGTCTTTACCAGACAGTTGGTACTTTGGTGCACATA A_73_102873 A_73_102873 FALSE BE899887 BE899887 gb|Unidentified transcripts on BTA29 position 30626826-30627732 unmapped Unknown TGCCCCTCGTCATTGGCATTAATCTGGGCACCAGCTAGTTCCATAGCAGTGACTTCCCTC A_73_102874 A_73_102874 FALSE XM_603483 XM_603483 LOC525136 ref|XM_603483 unmapped Bos taurus similar to Homo sapiens WD repeat domain 51B (WDR51B) TCAAGCGTTTATAAGACTAAGTGGCACTGTATATTTTATAACCTCGTTGAGAAGACTAAG A_73_102875 A_73_102875 FALSE AV611778 AV611778 gb|Unidentified transcripts on BTA1 position 93479842-93479253 unmapped Unknown CAGGTCCCAATGTGTAACAGGTGATTGGAGAGAATTGTCTGCGTTGTGTCAGTTTGTGTT A_73_102876 A_73_102876 FALSE XM_584240 XM_584240 LOC507596 ref|XM_584240 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 156 (C9orf156) ACTACGGAGAAACCCAAATGTCCTGAAGATAGAACTTCAGGGGAAAACATTGCGGGATCT A_73_102877 A_73_102877 FALSE AW655713 AW655713 gb|Unidentified transcripts unmapped Unknown AACGCCTTGGAAGCTACAGGCAATAGATCAAAACCCTGTGGTTACTACAGACTACATAGG A_73_102878 A_73_102878 FALSE XM_616570 XM_616570 LOC536439 ref|XM_616570 unmapped PREDICTED: Bos taurus similar to N-acetylated- alpha-linked acidic dipeptidase II (NAALADase II) (LOC536439) GCATGGGTCAAATAAGGGTCAGGGAGGTTTGTGGCACAGAGGGAAGTTTCTGGCATTATG A_73_102879 A_73_102879 FALSE NM_001038505 NM_001038505 MGC133835 ref|NM_001038505 unmapped Bos taurus similar to Homo sapiens stress 70 protein chaperone, microsome-associated, 60kDa (STCH) AGTGAACTGCCAAAGGACAAATTTTCCCAAGCAAATGACCCCCATGTGGACAGCATGTTT A_73_102880 A_73_102880 FALSE CB463707 CB463707 gb|Bos taurus similar to Homo sapiens transmembrane protein 60 (TMEM60) unmapped Unknown TGCTCCCATTAAAATAGTCTTGGTGACTTCTACTTGACCCCAAACTTAATCATTCAATAT A_73_102881 A_73_102881 FALSE XM_616955 XM_616955 LOC536811 ref|XM_616955 unmapped Bos taurus similar to Homo sapiens junctophilin 1 (JPH1) AATCATGATCATCCTCGTCATGCTGTTGAATATCGGGTTGGCCATTCTTTTTGTTCACTT A_73_102882 A_73_102882 FALSE XM_580454 XM_580454 LOC504346 ref|XM_580454 unmapped Bos taurus similar to Homo sapiens asparagine- linked glycosylation 9 homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase) (ALG9) ACAGTGTATGCAAACTATACCATCCTCAAACCCCGGAAAGCAAAGCAAACCAGGAAGAGA A_73_102883 A_73_102883 FALSE XM_867160 XM_867160 LOC615424 ref|XM_867160 unmapped Bos taurus similar to Homo sapiens metaxin 2 (MTX2), transcript variant 1 CTTGCTTTCTGTAGAAGAATTGAACAACACTATTTTGGCAAAGGCAGCTCATCTATCAGA A_73_102884 A_73_102884 FALSE AU233909 AU233909 gb|Bos taurus similar to Homo sapiens zinc finger protein 91 homolog (mouse) (ZFP91), transcript variant 1 unmapped Unknown TTCACTCTGATGATGACAATACTCTGATAGCATTTAATATCAGTGCTCCTTCACAAAACT A_73_102885 A_73_102885 FALSE XM_613117 XM_613117 LOC533646 ref|XM_613117 unmapped Bos taurus similar to Homo sapiens Ras-like without CAAX 1 (RIT1) AGAATTCAGCTGCCCCTTTTTTGAGACATCTGCTGCATACCGCTACTACATCGATGATGT A_73_102886 A_73_102886 FALSE XM_602491 XM_602491 LOC524171 ref|XM_602491 unmapped Bos taurus similar to Homo sapiens sterile alpha motif domain containing 7 (SAMD7) AAACCCTCTTTTGGATTTTAACTCCTGGAGTGATACATTGGACATTCCTTGTTCCCAGGA A_73_102887 A_73_102887 FALSE XM_590607 XM_590607 LOC512995 ref|XM_590607 unmapped Bos taurus similar to Homo sapiens aconitase 1, soluble (ACO1) ACTCACTGGGCGTGAACGATACACTATTAGCATTCCAGAAACCCTGAAACCACGAATGAA A_73_102888 A_73_102888 FALSE XM_882065 XM_882065 LOC538671 ref|XM_882065 unmapped Bos taurus similar to Homo sapiens suppressor of Ty 6 homolog (S. cerevisiae) (SUPT6H) CCTCACCCCTTGCTGCCGCCGCTTCCTGCCTGTCATTTGAATAAACAGTGTTTCTACAGA A_73_102889 A_73_102889 FALSE NM_176872 NM_176872 THBS2 ref|NM_176872 unmapped Bos taurus thrombospondin 2 (THBS2) TGTTGCTTCTTTGAGGCTAATTGCCTTCTTGCTGTGCTGCACTTTTTACGTTTTTCGGTG A_73_102890 A_73_102890 FALSE NM_174606 NM_174606 SLC5A1 ref|NM_174606 unmapped Bos taurus solute carrier family 5 (sodium/glucose cotransporter), member 1 (SLC5A1) CACTTTGAAAAGTGGATGAGTGAAAAGAGGCTGGCATCTTTCTTACACACATGAAGAATG A_73_102891 A_73_102891 FALSE NM_174177 NM_174177 SCIN ref|NM_174177 unmapped Bos taurus scinderin (SCIN) AAACTTTACCTTTTTGGCCTTTTAAGAAGCCTTTGAAAGCACAGCTCTTTCTTGACAAAT A_73_102892 A_73_102892 FALSE XM_598897 XM_598897 LOC520649 ref|XM_598897 unmapped PREDICTED: Bos taurus similar to histone 1, H2bh (LOC520649) TTCCATGCTTTGTGTCACAGCCTACTGGGGCTAAGCACCCAGTCTGTGTTGTTGGGTGTT A_73_102893 A_73_102893 FALSE NM_001015569 NM_001015569 PRSS15 ref|NM_001015569 unmapped Bos taurus ATP-dependent Lon protease (PRSS15) AGGAAGCTTGGGGGAAGACTGGAAGCCCGATCCTACTATGACTCAATCAGTGTATTTAAT A_73_102894 A_73_102894 FALSE XM_882731 XM_882731 LOC535288 ref|XM_882731 unmapped Bos taurus similar to Homo sapiens zinc ribbon domain containing 1 (ZNRD1), transcript variant a TTAGGGAAACAAAAAGTGGGAGTTTGGATACTGAGCTTCAACAGAAAACTCTGGATCAGA A_73_102895 A_73_102895 FALSE NM_177504 NM_177504 NMT1 ref|NM_177504 unmapped Bos taurus N-myristoyltransferase 1 (NMT1) TTTTTGTTTCTTTTTCTTCTTTTTGGCTCCAGTGTCATTGGCTGGACTCAAACCACCCCG A_73_102896 A_73_102896 FALSE XM_593587 XM_593587 LOC515552 ref|XM_593587 unmapped Bos taurus similar to PREDICTED: Homo sapiens pleckstrin homology domain containing, family M (with RUN domain) member 2 (PLEKHM2) CCCTCTGGGGAAGAGGGTCAGGTGGCCTGGGGTTTGTTTTTTAAAATAAAATAGACATGT A_73_102897 A_73_102897 FALSE NM_001037465 NM_001037465 SYK ref|NM_001037465 unmapped Bos taurus similar to Homo sapiens spleen tyrosine kinase (SYK) AATTTTGTGCACAGAGATCTGGCTGCAAGAGTGATGTTTGGAGCTTCGGAGTGTTGATGT A_73_102898 A_73_102898 FALSE XM_872302 XM_872302 LOC540922 ref|XM_872302 unmapped Bos taurus similar to Homo sapiens zinc finger CCCH-type containing 7A (ZC3H7A) AAAGATTACACTTGTACTGTTGGTATTGCGTAGTGTATGGACCAATATTGCCTGTAATAA A_73_102899 A_73_102899 FALSE BE685551 BE685551 gb|Unidentified transcripts unmapped Unknown TTTTTCATAAAATAACTCTTGGATTTGTTATATATTGTTCCTGTTATTTTTGACACCTTT A_73_102900 A_73_102900 FALSE XM_606192 XM_606192 LOC527790 ref|XM_606192 unmapped Bos taurus similar to Homo sapiens chromosome 10 open reading frame 64 (C10orf64) CACACGCTCTGTGCTTTGTCTGCTGCACTGCACCTGGACCCAGTCAACGGTGACTTCTTT A_73_102901 A_73_102901 FALSE BM258431 BM258431 gb|Bos taurus similar to Homo sapiens adaptor protein containing pH domain, PTB domain and leucine zipper motif 1 (APPL) unmapped Unknown AGAATTAAATTTGAAGAACCTGACTTTATGTAATGGTGGTATACATGTGGAGTGGAGAAC A_73_102902 A_73_102902 FALSE XM_594101 XM_594101 LOC515984 ref|XM_594101 unmapped Bos taurus similar to Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript variant 3 GGAGTAAAGGGACCAGAGTGGTATCTCTGGCACCACACTAGGGATTATCAGGTAATAAAA A_73_102903 A_73_102903 FALSE CB459613 CB459613 gb|Bos taurus similar to Homo sapiens PHD finger protein 16 (PHF16) unmapped Unknown ACATTTCAACTGCCCCAAAATGTATTTGCTACATTTTGCTGTTGTTTGAAGTATTACCTC A_73_102904 A_73_102904 FALSE XM_869031 XM_869031 LOC616897 ref|XM_869031 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 21 (C9orf21) CACCGGTTGAATAGCATGCTGAGAGACATCAGTTGTCAAAATATGTGATATCTGTAATTT A_73_102905 A_73_102905 FALSE XM_616204 XM_616204 LOC536084 ref|XM_616204 unmapped PREDICTED: Bos taurus similar to ephrin receptor EphA7 (LOC536084), partial mRNA. CCTATAGACTTGAACTCCTAAGTGCCACCAGAATATATAAAAAGGGAATTGAGGATCCAC A_73_102906 A_73_102906 FALSE XM_614891 XM_614891 LOC541172 ref|XM_614891 unmapped Bos taurus similar to Homo sapiens zinc finger, DHHC-type containing 17 (ZDHHC17) AAGGGTGACCCTTTGAGGAATAGTTCATATCAGCTTAATTGGATACTTTTAGCAAATAAG A_73_102907 A_73_102907 FALSE EE910740 EE910740 gb|Bos taurus similar to Homo sapiens chromosome 4 open reading frame 28 (C4orf28) unmapped Unknown ACATTTATACAGTCAGTTTGTACCTGTGTACTTACTTTTAGACATTCTGCTATTTCCTGG A_73_102908 A_73_102908 FALSE XM_864898 XM_864898 LOC613786 ref|XM_864898 unmapped PREDICTED: Bos taurus similar to trophoblast glycoprotein (LOC613786) CCCCCCACCTAGAAATCTGGATCTCCTTTGGGCAGTTTTCTATAAAGTCTGCAATAATCT A_73_102909 A_73_102909 FALSE XM_879021 XM_879021 LOC506031 ref|XM_879021 unmapped Bos taurus similar to Homo sapiens protein kinase C binding protein 1 (PRKCBP1), transcript variant 2 TTGGCCCCTTTCAAATACTACGTTGTCATGTTACAAAAAGCAAGCTCTCTGGACCAGAAG A_73_102910 A_73_102910 FALSE XM_598286 XM_598286 LOC520056 ref|XM_598286 unmapped Bos taurus similar to Homo sapiens neuropilin (NRP) and tolloid (TLL)-like 2 (NETO2) GCATCAATAATTCTTTAGTCTGTAATGGGATTCAAAACTGTGCATACCCTTGGGATGAAA A_73_102911 A_73_102911 FALSE NM_001034635 NM_001034635 ACTN2 ref|NM_001034635 unmapped Bos taurus similar to Homo sapiens actinin, alpha 2 (ACTN2) TCTTTACAACATTCAAGCAAGAGAATGGATCAACACTATCTGCTAACAAATGAAAAAGGG A_73_102912 A_73_102912 FALSE XM_869952 XM_869952 LOC617655 ref|XM_869952 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 106 (C6orf106), transcript variant 1 CGAAAAATTATTTTGCCTACAGACAGGTTGTAGTTTTGAGCACATGTTAATTTTCTTCCC A_73_102913 A_73_102913 FALSE BG693393 BG693393 gb|Bos taurus similar to Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1) unmapped Unknown TTAATGGCTGCATGGTATTTCATCTCCTGTGCCACATTTTATTAAACTACTGTTTTTAGG A_73_102914 A_73_102914 FALSE XM_865709 XM_865709 LOC614270 ref|XM_865709 unmapped Bos taurus similar to Homo sapiens hypothetical protein MGC40405 (MGC40405), transcript variant 1 GGAAAAAGAAAAAGAAGAGTCGTTCACATAAATCTTCTGAAAGTTCCATGTCAGAAACTG A_73_102915 A_73_102915 FALSE XM_591070 XM_591070 LOC513397 ref|XM_591070 unmapped Bos taurus similar to Homo sapiens DnaJ (Hsp40) homolog, subfamily A, member 3 (DNAJA3) GCTCTAAGAATGTAAAATGATTCTGTATCAATGTAAATAAGATTATCTACTGCAAAGAGA A_73_102916 A_73_102916 FALSE NM_001037584 NM_001037584 MGC133939 ref|NM_001037584 unmapped Bos taurus similar to Homo sapiens procollagen (type III) N-endopeptidase (PCOLN3) TACTCCTCATCAAAGGGAAGCCGGCAAAGCTTGCCTTCTGAAATGCTGTTCTGAGTAAAA A_73_102917 A_73_102917 FALSE NM_001034644 NM_001034644 RALA ref|NM_001034644 unmapped Bos taurus similar to Homo sapiens v-ral simian leukemia viral oncogene homolog A (ras related) (RALA) CAAATGACAAAGATGCATCACATGTCTTAGGCTGATGCCACTACCCGACTGGTTTATTTG A_73_102918 A_73_102918 FALSE NM_001034631 NM_001034631 SPG3A ref|NM_001034631 unmapped Bos taurus similar to Homo sapiens spastic paraplegia 3A (autosomal dominant) (SPG3A), transcript variant 2 TCACATAGGCATTTGTTAAAACATAGCTCAATAGGCTTGATTCAACCTATACCATCTTAC A_73_102919 A_73_102919 FALSE XM_867837 XM_867837 LOC615906 ref|XM_867837 unmapped PREDICTED: Bos taurus similar to Lanosterol synthase (Oxidosqualene--lanosterol cyclase) (2,3-epoxysqualene-- lanosterol cyclase) (OSC) (LOC615906) ACCAAAAGTGCTTAACGCATAATAAAAATGTACCTCCAAGAAAGTACTTTCCTTACTGAG A_73_102920 A_73_102920 FALSE XM_611706 XM_611706 LOC540492 ref|XM_611706 unmapped PREDICTED: Bos taurus similar to potassium voltage-gated channel, shaker-related subfamily, member 7 (LOC540492) CAGCTACTTTTACCACCGGGAGACAGATGACGAAGAGGCTGGGATGTACAGCCATGTGGA A_73_102921 A_73_102921 FALSE XM_581603 XM_581603 LOC505329 ref|XM_581603 unmapped Bos taurus similar to Homo sapiens cysteine- rich secretory protein LCCL domain containing 2 (CRISPLD2) ATTGTAAATTTATGTGTGCTTCGCTTGAACAGGGACCACGTTGCTGTCATTTCAATAAAA A_73_102922 A_73_102922 FALSE XM_874476 XM_874476 LOC538798 ref|XM_874476 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 155 (GPR155), transcript variant 2 TATGTTTTTTCAGAGTTTGAGGCACCTTCAAACATCTACTTAAAATAAATGGTCGTGTCC A_73_102923 A_73_102923 FALSE XM_869316 XM_869316 LOC617124 ref|XM_869316 unmapped Bos taurus similar to Homo sapiens chromosome 14 open reading frame 161 (C14orf161) AAAGACACAGATACAGAGAGATTTATGTTGACGAAGTCCCTCTGCCGTTTCCAGGACACA A_73_102924 A_73_102924 FALSE XM_869780 XM_869780 LOC617507 ref|XM_869780 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 5, subfamily B, member 3 (OR5B3) ACAAGGAGGTTAAAAGTGCTTTCAAGAAGGCAGTGGAAAAAGCAAACTTGTCTCTAGGCT A_73_102925 A_73_102925 FALSE XM_593633 XM_593633 LOC515590 ref|XM_593633 unmapped Bos taurus similar to Homo sapiens heat shock 70kD protein 12B (HSPA12B) AGGTTTTCAGCTGTGCATGGGGCTGGGAATTGATTAGAAAGGAGTGCTGCTGTCTCTGGT A_73_102926 A_73_102926 FALSE XM_873049 XM_873049 LOC530005 ref|XM_873049 unmapped PREDICTED: Bos taurus similar to wingless- related MMTV integration site 5A, transcript variant 2 (LOC530005) GTTGCTTGGGGGACGGCTGGAAGGGCAATGTCTTCCAAGTTCTTCCTAATGGCTTTGGCC A_73_102927 A_73_102927 FALSE NM_174207 NM_174207 TUFM ref|NM_174207 unmapped Bos taurus Tu translation elongation factor, mitochondrial (TUFM) GCCCAAGGGCCGTGTGGCCAGCCAGGTGAGGTAGGTCAATAAACCGTTCTGTGAATAGAA A_73_102928 A_73_102928 FALSE XM_870960 XM_870960 LOC618626 ref|XM_870960 unmapped PREDICTED: Bos taurus similar to stromal cell derived factor receptor 2 homolog (LOC618626), partial mRNA. TGTAATGCTTACTTTACAAACTTCGTAGCTTGTAGTCTTCATAGTTGTGACAAGGGTGGT A_73_102929 A_73_102929 FALSE XM_609874 XM_609874 LOC531382 ref|XM_609874 unmapped Bos taurus similar to Homo sapiens KIAA1627 protein (KIAA1627) TTCTGTGAGTGGAATTGTCGTCGTTACCAAATGAAAAAGGATTGACCTCAGATGAGACTG A_73_102930 A_73_102930 FALSE AY130298 AY130298 gb|Bos taurus similar to Homo sapiens cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant (CSTF2T) unmapped Unknown AATTCGGAGTAAAACAGTGTGAAAACTGCATCAAGACTAAAAGATGACCTGTTCAAATAG A_73_102931 A_73_102931 FALSE XM_602983 XM_602983 LOC524653 ref|XM_602983 unmapped Bos taurus similar to Homo sapiens par-6 partitioning defective 6 homolog alpha (C.elegans) (PARD6A), transcript variant 1 GACTTTCCCAGTGGGAGGTTTCAGCGTGCTCATGGGCCCTCTCAGTACGGGGAACATTAA A_73_102932 A_73_102932 FALSE XM_869685 XM_869685 LOC527577 ref|XM_869685 unmapped Bos taurus similar to Homo sapiens tripartite motif-containing 4 (TRIM4), transcript variant alpha ATTATTGCTGATAACCACCACTGCTAACCATTGTAATGTGTTTCCGCCTCGACTTTGAAT A_73_102933 A_73_102933 FALSE XM_583830 XM_583830 LOC507255 ref|XM_583830 unmapped PREDICTED: Bos taurus similar to sulfotransferase family, cytosolic, 1B, member 1 (LOC507255), partial mRNA. AAGCGAGATGTTATAACTGCTAAAGTTCCAATGTTGGAACTGGCTCTTCCTGGACTAAGG A_73_102934 A_73_102934 FALSE XM_872566 XM_872566 LOC528832 ref|XM_872566 unmapped Bos taurus similar to Homo sapiens dehydrogenase/reductase (SDR family) member 1 (DHRS1) CTTAACGCTGAAAAATGTTCTAGGGGCTAATAATAAAGCTCTCATTTCTCCGGGAAAAAA A_73_102935 A_73_102935 FALSE XM_614753 XM_614753 LOC541148 ref|XM_614753 unmapped Bos taurus similar to Homo sapiens pentraxin- related gene, rapidly induced by IL-1 beta (PTX3) GGGAGACTGGAGAAGGCTTTTGGGGATATTGTTACTAGATTTTATGCCATGGTGCTTTCA A_73_102936 A_73_102936 FALSE XM_872905 XM_872905 BMPR-IA ref|XM_872905 unmapped Bos taurus similar to Homo sapiens bone morphogenetic protein receptor, type IA (BMPR1A) TATCTGACCGAGATTTGCCAATCGCATAAAAGCCATTTACCTTGCAAGTGAGCTAGCTTC A_73_102937 A_73_102937 FALSE XM_868353 XM_868353 LOC540513 ref|XM_868353 unmapped Bos taurus similar to Homo sapiens Rho-related BTB domain containing 1 (RHOBTB1), transcript variant 1 AAGCTCACCATCAATGAGCCTGGACAAAAAGGGAAGTTGACGCTCACTGCATTCCTTAAA A_73_102938 A_73_102938 FALSE NM_001034415 NM_001034415 MGC128694 ref|NM_001034415 unmapped Bos taurus similar to Homo sapiens macrophage erythroblast attacher (MAEA), transcript variant 2 CAGCGCTTATTTTTGCATGTTGATGTTGATTAGCTAATAAACTGTAAACGTAAGACTCGC A_73_102939 A_73_102939 FALSE XM_609023 XM_609023 LOC530549 ref|XM_609023 unmapped Bos taurus similar to Homo sapiens EF-hand domain family, member B (EFHB) AGGGAGCTCAGAAAAGACTCTTCGGACACTTCTGAGGCCAAGCGATAAAGTTTCTAATCA A_73_102940 A_73_102940 FALSE XM_870904 XM_870904 LOC618573 ref|XM_870904 unmapped PREDICTED: Bos taurus similar to GTPase activating RANGAP domain-like 1 isoform 2 (LOC618573) AGGATGTTCTCCAAGAAGCCGCACGGGGACGTGAAGAAGTCTACCCAGAAGGTGCTGGAT A_73_102941 A_73_102941 FALSE NC_006853 gb|Bos taurus cytochrome c oxidase subunit II (COX2) unmapped Unknown GTCAATGCTCAGAAATTTGCGGGTCAAACCACAGTTTCATGCCCATTGTCCTTGAGTTAG A_73_102942 A_73_102942 FALSE BE845792 BE845792 gb|Bos taurus similar to Homo sapiens MLX interacting protein (MLXIP) unmapped Unknown GGCAGGGGGTTTGCTGTTTTCTGTTGAGGCTTATGAGAAGTCAGCCTTTGAGAAAGAAAA A_73_102943 A_73_102943 FALSE XM_582285 XM_582285 LOC505921 ref|XM_582285 unmapped Bos taurus similar to Homo sapiens zinc finger protein 157 (HZF22) (ZNF157) TGTAGTGATTGTGGAAAAATCTTCAGTATGAAGAAATCCCTTTGTCAACACCAGAGAACT A_73_102944 A_73_102944 FALSE XM_583891 XM_583891 LOC538956 ref|XM_583891 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ30046 (FLJ30046), transcript variant 2 AGCTAGGACGTTTTTGTAGAACTGATAATGTACCTGAATCCTTTTTGAGAGAGTTGAGGT A_73_102945 A_73_102945 FALSE XM_865103 XM_865103 LOC518504 ref|XM_865103 unmapped Bos taurus similar to Homo sapiens SIN3 homolog A, transcription regulator (yeast) (SIN3A) TTACCAAAGGGAGTTACCGTTGTAGTACTTTTGTGTAAAACTTGTCTTCCTTCTTGCCCC A_73_102946 A_73_102946 FALSE NM_001034623 NM_001034623 MGC128630 ref|NM_001034623 unmapped Bos taurus similar to Homo sapiens synaptogyrin 1 (SYNGR1), transcript variant 1b CATCACCTCCTTTGTTGATTCTTCACGTGTCTGTTCATTCAGTAAACATTTATTGAGCTA A_73_102947 A_73_102947 FALSE CB447949 CB447949 gb|Bos taurus similar to Homo sapiens alanyl-tRNA synthetase like (AARSL) unmapped Unknown ACTGAAAACTCAGGTGAAAGTCATGAGAGCTGGGCAGATCCTGTCTGGTGTCACTTATTT A_73_102948 A_73_102948 FALSE NM_001035286 NM_001035286 POLM ref|NM_001035286 unmapped Bos taurus similar to Homo sapiens polymerase (DNA directed), mu (POLM) TGGCCTCTGAGGAAGACATCTTCAGACTCCTGGACCTTGAGTACCTTCCCCCAGAGCTGA A_73_102949 A_73_102949 FALSE XM_869442 XM_869442 LOC616621 ref|XM_869442 unmapped Bos taurus similar to Homo sapiens polynucleotide kinase 3'-phosphatase (PNKP) TGAAGCAGAGGAAACCGGTCGTGATCGACAACACAAACCCCGACGTCCAGAGCCGGGCCA A_73_102950 A_73_102950 FALSE XM_595566 XM_595566 LOC517397 ref|XM_595566 unmapped PREDICTED: Bos taurus similar to amylo-1,6-glucosidase, 4-alpha-glucanotransferase isoform 1 (LOC517397) TATCCTGCAGACGACTCTGTTCCTTTGTCTGCCGGCACAGTGGTAAAGATCATTTCTTAA A_73_102951 A_73_102951 FALSE XM_864726 XM_864726 LOC515278 ref|XM_864726 unmapped Bos taurus similar to Homo sapiens ELMO/CED-12 domain containing 2 (ELMOD2) AAGCTACACTTGTTGTTCAGAGTGAAGTGGACAGATGTGTAGAAGATATAATGAAGGAAA A_73_102952 A_73_102952 FALSE XM_582494 XM_582494 LOC506099 ref|XM_582494 unmapped Bos taurus similar to PREDICTED: Homo sapiens hypothetical protein LOC202051, transcript variant 1 (LOC202051) TCCCAGGGAAAAATAAAATGGTTGTCGCCTTCCTGTTATCTGCTGTAAAGCCCAACCTCT A_73_102953 A_73_102953 FALSE CB456959 CB456959 gb|Bos taurus similar to Homo sapiens adenosine deaminase, RNA-specific (ADAR), transcript variant 1 unmapped Unknown GGTGCAGTCAGTTTTATGATTCTGCTTTTATGTGTCCTTTGGTATAAGTGACTAACAATA A_73_102954 A_73_102954 FALSE XM_865572 XM_865572 LOC614489 ref|XM_865572 unmapped Bos taurus similar to Homo sapiens protease, serine, 16 (thymus) (PRSS16) GCAACTGTCCTGCATAAAACCATCCTATGTCTGCAAAATCCTCACTCCTGACTAAAAGTG A_73_102955 A_73_102955 FALSE XM_866136 XM_866136 LOC614582 ref|XM_866136 unmapped Bos taurus similar to Homo sapiens signal recognition particle receptor, B subunit (SRPRB) GCTGTTTGATGAGCTCCTATTTTGTACTCATAGCATGAATGCTGTGGAACAAATACAAGA A_73_102956 A_73_102956 FALSE XM_866620 XM_866620 LOC520260 ref|XM_866620 unmapped Bos taurus similar to Homo sapiens fumarate hydratase (FH), nuclear gene encoding mitochondrial protein ATTGCTATTGAACTTGACTGTCTCTAGCAGAGCAGTTTGGTCAGTGTATAAAACCCCAGG A_73_102957 A_73_102957 FALSE NM_001014860 NM_001014860 HNRPF ref|NM_001014860 unmapped Bos taurus heterogeneous nuclear ribonucleoprotein F (HNRPF) GGAATTGGTGAGGCCTTGACTTAAAAACTTTCTTTGTACTGTGATTTCCTTTCGGGTGTA A_73_102958 A_73_102958 FALSE XM_582166 XM_582166 LOC505815 ref|XM_582166 unmapped PREDICTED: Bos taurus similar to zinc finger protein 550 (LOC505815) GAGGATAGTAACCTGTAATGTCATAAGTATTTCTTCCTTCTTTTGCCATGAATATGTGTG A_73_102959 A_73_102959 FALSE XM_591501 XM_591501 LOC513758 ref|XM_591501 unmapped Bos taurus similar to Homo sapiens DiGeorge syndrome critical region gene 14 (DGCR14) GAGCCCTGGCTGGGCACCAAGGGGGCAGGGCTGGGGCCGCGGGGGCAGGAAACGGCTGCT A_73_102960 A_73_102960 FALSE BE482638 BE482638 gb|Unidentified transcripts on BTA18 position 54872340-54871501 unmapped Unknown CTTTAAAGTCTTCTGTTATGAAAATAACGTGTGCATGTGGTTTGGAGACATGCAAGGAGC A_73_102961 A_73_102961 FALSE XM_869595 XM_869595 LOC513785 ref|XM_869595 unmapped Bos taurus similar to Homo sapiens gamma- aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript variant 2 TCGGTCCACACTCACAATCCTCCTCTACAAGAGTGTTCCCTTCGGTTTTGTATTTTTCTG A_73_102962 A_73_102962 FALSE XM_585540 XM_585540 LOC508720 ref|XM_585540 unmapped Bos taurus similar to Homo sapiens class II, major histocompatibility complex, transactivator (CIITA) AGGGGTGGGGCCGTGGCCTGGACCACATTCGCCTTTTTGCCTCCATTTCCTGTTTGTTTT A_73_102963 A_73_102963 FALSE XM_581393 XM_581393 LOC505149 ref|XM_581393 unmapped Bos taurus similar to Homo sapiens dual- specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (DYRK3), transcript variant 1 GTTAAAAGAACTCTTCACAAGGGCTAAATTACCTAACCAGCTTGTATTGGCCATCCTGGA A_73_102964 A_73_102964 FALSE NM_001037472 NM_001037472 MGC128730 ref|NM_001037472 unmapped Bos taurus similar to ribosomal protein S6 kinase-like 1 (MGC128730) GTGTGGCATCCAAGACAGAAATTTCCATAGACCTCTGCCCTCAACCCTTTCTCGCCTGTC A_73_102965 A_73_102965 FALSE XM_866039 XM_866039 LOC504468 ref|XM_866039 unmapped Bos taurus similar to Homo sapiens hexosaminidase A (alpha polypeptide) (HEXA) CCCATGCAGATCGCGAACCGCCCTCCCCAGAGCTTTTCTTCTGCTTTAGGTTTCTTGTTA A_73_102966 A_73_102966 FALSE XM_868633 XM_868633 LOC616580 ref|XM_868633 unmapped PREDICTED: Bos taurus similar to Cytochrome P450 2C8 (CYPIIC8) (P450 form 1) (P450 MP-12/MP-20) (P450 IIC2) (S-mephenytoin 4-hydroxylase) (LOC616580) TAAATTCAGAAATTACCTCATCCCCAAGGGCACAGATGTATTAACATTGCTGACTTCTGT A_73_102967 A_73_102967 FALSE XM_869232 XM_869232 LOC616028 ref|XM_869232 unmapped Bos taurus similar to Homo sapiens nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 TGTTGTACCTGAGTGGAGTGTCTGTGTTTTGTACGGCTTGAGATTTTCATGAATAAAATT A_73_102968 A_73_102968 FALSE BI534479 BI534479 gb|Bos taurus similar to Homo sapiens translin-associated factor X (TSNAX) unmapped Unknown AAGATTAGCCGCTCTGTTTGCAAGGGCTTATTCTTGGAAAGTGTAATTTTCCAAAAATTA A_73_102969 A_73_102969 FALSE NM_001024486 NM_001024486 SLC37A2 ref|NM_001024486 unmapped Bos taurus solute carrier family 37 (glycerol-3-phosphate transporter), member 2 (SLC37A2) AAAGAGTGTGTCTCTCCTTCTCATGTTAAACTTGAACCCGTGTAATCAGCCTCTGCCTGA A_73_102970 A_73_102970 FALSE NM_001011682 NM_001011682 AGO61 ref|NM_001011682 unmapped Bos taurus glycosyltransferase ago61 (AGO61) GTGGCTGCTTGGGTGGGTGTGGATGTACATCAGCTTCCACTGTCATGAAACTCACCTGTA A_73_102971 A_73_102971 FALSE XM_615982 XM_615982 LOC535868 ref|XM_615982 unmapped PREDICTED: Bos taurus similar to brain- selective kinase 2 isoform gamma (LOC535868) AACTGTATGGAAATGATGACGGGGAGGCTTTCCAAATGTGACGAGAAGAACGGGCAGGCG A_73_102972 A_73_102972 FALSE BF652982 BF652982 gb|Bos taurus similar to Homo sapiens F-box protein 32 (FBXO32), transcript variant 1 unmapped Unknown TCTCCCCATCTCCTTTGACATCACTGGAGGTGGTGTGGACAGAGTCAAGGAAAATTTTAA A_73_102973 A_73_102973 FALSE XM_869587 XM_869587 LOC517053 ref|XM_869587 unmapped Bos taurus similar to Homo sapiens tyrosyl-DNA phosphodiesterase 1 (TDP1), transcript variant 1 GCAGCACAGACTCAGTTTCAGAAGCTTCACCTTGCAAAAGACAGAAGACCGGTTCCCAGG A_73_102974 A_73_102974 FALSE XM_868149 XM_868149 LOC616180 ref|XM_868149 unmapped PREDICTED: Bos taurus similar to yippee-like 2 (LOC616180), partial mRNA. GGGGTGGGTGGGGCAGAGCCTGGAATAGTTTAGGTTTGAACTGTTACAGGTTAAGTGCAT A_73_102975 A_73_102975 FALSE CB438210 CB438210 gb|Bos taurus similar to Homo sapiens chromosome 8 open reading frame 37 (C8orf37) unmapped Unknown ATTCAAATGGGGATTAATGTGATATAATTTTGATAATTTCCTTTAAAATATCAATTAAAA A_73_102976 A_73_102976 FALSE XM_882025 XM_882025 LOC523206 ref|XM_882025 unmapped Bos taurus similar to Homo sapiens Mov10, Moloney leukemia virus 10, homolog (mouse) (MOV10) CCCACCTGACCCTGTAGGCTGCTAACAATTGGGGGAAGGGGGAGGAAGTACCACTGAAAA A_73_102977 A_73_102977 FALSE CB434190 CB434190 gb|Unidentified transcripts on BTA21 position 34504466-34505121 unmapped Unknown GCCCTGGTGGTGTTCTCTTTCCTGGCCAGTATACCTCTGCTAAATCCCTGATGACCTTAA A_73_102978 A_73_102978 FALSE XM_865122 XM_865122 LOC509192 ref|XM_865122 unmapped Bos taurus similar to Homo sapiens dullard homolog (Xenopus laevis) (DULLARD) TTCCCTCAGATCTGTAACCAGCTTTCTCTCTTTTTTCCTTTCCTCTCTTTTAAACCATGC A_73_102979 A_73_102979 FALSE XM_866046 XM_866046 LOC614514 ref|XM_866046 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 96 (CCDC96) CACTTTGTGGACATAGAAAACATGTGTAAAAAGGCAGAGCTCATGGACATTGAGGCTCAG A_73_102980 A_73_102980 FALSE XM_870295 XM_870295 LOC617961 ref|XM_870295 unmapped Bos taurus similar to Homo sapiens guanine nucleotide binding protein (G protein), alpha z polypeptide (GNAZ) AGCAGTAGCTTGGCGTCTCGGTGTTTAAAACGGGAAATGACCTGTGGCGTCTCCGCGTGT A_73_102981 A_73_102981 FALSE XM_864480 XM_864480 LOC534761 ref|XM_864480 unmapped Bos taurus similar to Homo sapiens glycogen synthase kinase 3 beta (GSK3B) TTCCCTCAAATTAAGGCACATCCTTGGACTAAGGATTCGTCAGGAACAGGACATTTCACC A_73_102982 A_73_102982 FALSE XM_615217 XM_615217 LOC535202 ref|XM_615217 unmapped PREDICTED: Bos taurus similar to organic anion transporter polypeptide-related protein 4 (LOC535202) AGCTGAGAGTGCCATTGTAACTGCTTTCATTACCTTCATCCCCAAGTTCATCGAGTCACA A_73_102983 A_73_102983 FALSE NM_174269 NM_174269 CHM-I ref|NM_174269 unmapped Bos taurus chondromodulin I (CHM-I) ATTACTTGCTATTGTTTTGCTTTTCTTTGCCAGGAAGGTCTGCTTTTAAGCCTTCCTTAC A_73_102984 A_73_102984 FALSE XM_588706 XM_588706 LOC511385 ref|XM_588706 unmapped PREDICTED: Bos taurus similar to lung- inducible neuralized-related C3HC4 RING domain protein (LOC511385) ACCAGGTTGCCAACACCTGCCTAGTCCCCTGTGGCCACACACACTTCTGCAGCTCCTGTG A_73_102985 A_73_102985 FALSE CB170224 CB170224 gb|Bos taurus similar to Homo sapiens chromosome 5 open reading frame 21 (C5orf21) unmapped Unknown AGGAGATGTACTTGTAATAATTGTTCTTTTCTCAAGTTTCTACCTTGTGCTTCAACTTGG A_73_102986 A_73_102986 FALSE XM_867614 XM_867614 LOC615736 ref|XM_867614 unmapped Bos taurus similar to Homo sapiens ankyrin 2, neuronal (ANK2), transcript variant 1 ATGAAGTTCGTAAAGCCAACGCCCCTGAAATGCTCAGTGATGGCGAATATATCTCAGATG A_73_102987 A_73_102987 FALSE NM_174080 NM_174080 HIP2 ref|NM_174080 unmapped Bos taurus huntingtin interacting protein 2 (HIP2) CTTTTGAGCTAAGCTAAAACCATGGAAAAAACATGCTACTTTAGTGTTTAGCAGTATACC A_73_102988 A_73_102988 FALSE BM031342 BM031342 gb|Bos taurus similar to Homo sapiens kin of IRRE like 3 (Drosophila) (KIRREL3) unmapped Unknown CACCTCAGTTATTAGACCAGGCATCCTCAGGCAGACCTAGGAGGCACCATGGGTTGGGTT A_73_102989 A_73_102989 FALSE XM_618037 XM_618037 LOC537850 ref|XM_618037 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 60 (C6orf60) AAATGCCCTGTACTTCCTGTGATATTTATTGGACTCACTCTAAGGTACTATATTATGTGT A_73_102990 A_73_102990 FALSE BI976749 BI976749 gb|Bos taurus similar to Homo sapiens TSC22 domain family, member 3 (TSC22D3), transcript variant 2 unmapped Unknown ACTGGATCGACTTGGTAAATGAACAGATCTAAGAATTAGCCTTAAGAGATAAGGGACCAC A_73_102991 A_73_102991 FALSE EE935191 EE935191 gb|Unidentified transcripts unmapped Unknown GCTGTTAATTGAAAATGTATCTGGGAAGAGAGGCCCAAGGGCATAGGGGATGATGGTTTA A_73_102992 A_73_102992 FALSE XM_869415 XM_869415 LOC617203 ref|XM_869415 unmapped Bos taurus similar to Homo sapiens zinc finger protein 146 (ZNF146) GAGGATGGGAACACTGTACCTATAGACATCATGTTCTAACGGATTCATTCCCAATCAACT A_73_102993 A_73_102993 FALSE CB433789 CB433789 gb|Bos taurus similar to Homo sapiens low density lipoprotein receptor-related protein 11 (LRP11) unmapped Unknown TTGTATTCTTTATGTGATGCTGTGCAGTTTGTTTTTATATAGAAGGATGTCACCTACAGC A_73_102994 A_73_102994 FALSE XM_603865 XM_603865 LOC525512 ref|XM_603865 unmapped PREDICTED: Bos taurus similar to Histone H2B F (H2B 291A) (LOC525512) TCCGGCTCCTAAAAAAGGCTCTAAGAAAGCCATCACTAAGGCACAGAAGAAAGATGGCAA A_73_102995 A_73_102995 FALSE XM_869851 XM_869851 LOC617569 ref|XM_869851 unmapped Bos taurus similar to Homo sapiens chromosome 3 open reading frame 44 (C3orf44) TCCTACCTTTCTTCACTTTCTCTAAAACTAATTGCCCTTTGTCACAATTCTGGTATGAAG A_73_102996 A_73_102996 FALSE XM_608264 XM_608264 LOC529805 ref|XM_608264 unmapped Bos taurus similar to Homo sapiens Cdk5 and Abl enzyme substrate 2 (CABLES2) GCTCGCTCTGTACCTTCCTGAGAACCAGGTGTTACCTCATTACAGACGCCTCACACAGCA A_73_102997 A_73_102997 FALSE XM_870985 XM_870985 LOC618656 ref|XM_870985 unmapped PREDICTED: Bos taurus similar to marapsin 2 (LOC618656) CAGGGTTGCGCATACCCTATGTATCCAACAGTTTTTGCCCGAGTCTCCTTTTTCTCAAAA A_73_102998 A_73_102998 FALSE XM_609503 XM_609503 LOC531019 ref|XM_609503 unmapped Bos taurus similar to Homo sapiens nuclear protein, ataxia-telangiectasia locus (NPAT) GCTACCCAGTTCATTTCCAGCTGGAATGGATGTGGACAAATTTTTGTTATCATTGCATTA A_73_102999 A_73_102999 FALSE XM_593447 XM_593447 LOC515425 ref|XM_593447 unmapped PREDICTED: Bos taurus hypothetical protein LOC614169 (LOC614169) GGAAGGACGAGGTGAAAAGCATGATATTTGTATTTGGGGAGTCTCGTTTAAGGCCGATCT A_73_103000 A_73_103000 FALSE NM_174036 NM_174036 DDX9 ref|NM_174036 unmapped Bos taurus nuclear DNA helicase II (DDX9) CTATACCAACTGATGTCATTACCTACAGTAGTTAGAATAAATAGCTTTGGAATGCTGTTG A_73_103001 A_73_103001 FALSE XM_606243 XM_606243 LOC527838 ref|XM_606243 unmapped PREDICTED: Bos taurus similar to lipoma HMGIC fusion partner-like 5 (LOC527838) GTCACCGTTAGCCCCACAATAGAGCCGCCGCAGACGACCCACAAACTGGAGCACAATTAT A_73_103002 A_73_103002 FALSE NM_001015542 NM_001015542 MC5 ref|NM_001015542 unmapped Bos taurus melanocortin 5 receptor (MC5) GCCAAGAGATGCGGAAGACCTTTAAGGAGATTGTTTGTTTTCAGAGCTTCAGAACACCCT A_73_103003 A_73_103003 FALSE XM_877236 XM_877236 LOC527471 ref|XM_877236 unmapped Bos taurus similar to Homo sapiens heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRPD), transcript variant 1 GTTACGGTGGTTATGGAGGATATGACTACACTGGTTACAACAACTACTATGGATATGGTG A_73_103004 A_73_103004 FALSE NW_930960 NW_930960 gb|Putative orthologue of human miRNA hsa-mir-375 on chr 2, (-) strand. Mature length 22 nt, stem-loop length 64 nt. Source: NW_930960.1:c189379-189316 unmapped Unknown TTTGTTCGTTCGGCTCGCGTGATATCCTACTATACGTATCACATA A_73_103005 A_73_103005 FALSE CB172347 CB172347 gb|Unidentified transcripts on BTA2 position 69942816-69941217 unmapped Unknown ATGGAACCTCAAAATACAGATGTGTATGTAAAATTGCATAAATGCACTGACTTCCTTCTC A_73_103006 A_73_103006 FALSE XM_595204 XM_595204 LOC517040 ref|XM_595204 unmapped PREDICTED: Bos taurus similar to Gamma- aminobutyric acid type B receptor, subunit 2 precursor (GABA-B receptor 2) (GABA-B-R2) (Gb2) (GABABR2) (G-protein coupled receptor 51) (GPR 51) (HG20) (LOC517040), partial mRNA. CCAGCTACAGTGGAACACAACAGAGCCCTCTCGAACATGCAAAGATCCTATAGAAGATAT A_73_103007 A_73_103007 FALSE XM_595858 XM_595858 LOC517684 ref|XM_595858 unmapped Bos taurus similar to Homo sapiens ATPase, Class V, type 10D (ATP10D) TCATGTATGCTGGCTTTAATTGAAACAAGGAAACTAGTTTCTACCATAACTGCCAGGTAT A_73_103008 A_73_103008 FALSE XM_612101 XM_612101 LOC540564 ref|XM_612101 unmapped Bos taurus similar to Homo sapiens RAD23 homolog A (S. cerevisiae) (RAD23A) TGTCTGCCTCTATAGATTGTGGCTCCTAGTGTACCCCGCCCCCACCACCAAGCTGTGTTA A_73_103009 A_73_103009 FALSE XM_595172 XM_595172 LOC517009 ref|XM_595172 unmapped Bos taurus similar to Homo sapiens chromosome 20 open reading frame 152 (C20orf152) GATTGTCCAAACTATTATAGCACCCCGGTACAAAATCCAGGAGCTCCTGCCTCAGTATAA A_73_103010 A_73_103010 FALSE CB427330 CB427330 gb|Unidentified transcripts on BTA3 position 37333665-37334687 unmapped Unknown ATCTCTCTGTTGTCCTTTCTTCTTCCTCATAACCCATTTCAGTTTCACTAAGGACAGCGA A_73_103011 A_73_103011 FALSE CB439744 CB439744 gb|Unidentified transcripts on BTA29 position 29030660-29031722 unmapped Unknown AGCTCACTCTGCATATGGTCCAGGCCAGTTCCAACTAACATTCAAGGTTTTTATGTACGT A_73_103012 A_73_103012 FALSE XM_588612 XM_588612 LOC539661 ref|XM_588612 unmapped Bos taurus similar to Homo sapiens mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative) (MGAT4C) GTTACCAAAACACAAAAGGAATGGCTGATTATTAGGAGTATTAGCATTTGGACTTCTTAG A_73_103013 A_73_103013 FALSE XM_870742 XM_870742 LOC618412 ref|XM_870742 unmapped Bos taurus similar to Homo sapiens dual specificity phosphatase 15 (DUSP15), transcript variant 1 ACTGTTGCCGCCTCAATGGGGGAAACTGCCTTGTACACTGCTTTGCAGGCATCTCCCGAA A_73_103014 A_73_103014 FALSE XM_867649 XM_867649 LOC615759 ref|XM_867649 unmapped PREDICTED: Bos taurus similar to Superfast myosin regulatory light chain 2 (MyLC-2) (MYLC2) (Myosin regulatory light chain 5) (LOC615759) TGGGAAGAGGAGCGAGAGGCACCCCACCCCACGGGGCTGTGGCCAGTTGAATAAATGTGA A_73_103015 A_73_103015 FALSE NM_001037487 NM_001037487 LSM3 ref|NM_001037487 unmapped Bos taurus similar to Homo sapiens LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM3) CAACCCTTCCAATAAATGCGATCATCAAGATACAGAGCTTTTTCAGGAATTGATTTGCTC A_73_103016 A_73_103016 FALSE XM_582491 XM_582491 LOC506096 ref|XM_582491 unmapped PREDICTED: Bos taurus similar to Heat shock 70 kDa protein 4L (Osmotic stress protein 94) (Heat shock 70-related protein APG-1), transcript variant 1 (LOC506096) CGAGTATGTAAAAACAACCCTTTCTGCATCTCAACTGTCTAGTACATCCTGACATTTTCA A_73_103017 A_73_103017 FALSE EE935083 EE935083 gb|Unidentified transcripts unmapped Unknown CTCTCTGAATTCACTCTGTCAGGCTCACCCCTTCCCCTGGGAGGTTAGAAGGAACCAGGA A_73_103018 A_73_103018 FALSE NM_001035332 NM_001035332 MRPS9 ref|NM_001035332 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein S9 (MRPS9), nuclear gene encoding mitochondrial protein TCCTCCGCGTGCTGTCGATTTTCCAGACAGCTACACAGTTTTCACAATTGAGGGATGAGA A_73_103019 A_73_103019 FALSE XM_868703 XM_868703 LOC616632 ref|XM_868703 unmapped PREDICTED: Bos taurus similar to CG12935-PA (LOC616632) TGGGTGCCTACCGTAGCTTGTGAAGAAGCAACCTCAGGTCACTAAGGTTCAGAATAAAAA A_73_103020 A_73_103020 FALSE AW464703 AW464703 gb|Bos taurus similar to Homo sapiens cytokine induced protein 29 kDa (CIP29) unmapped Unknown ATGTACCCTGGGTACATCTGTGAACTCCAGCAGCAGTTTGACTTATTGCAGTTCCAACTT A_73_103021 A_73_103021 FALSE CB169144 CB169144 gb|Bos taurus similar to Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 1 (KCNAB1), transcript variant 2 unmapped Unknown CCCAGAAGGGCAAATGTTTGCTGTTTAATTAGCACTGGGATTTTACAGCATAATGCTTGG A_73_103022 A_73_103022 FALSE XM_592903 XM_592903 LOC514978 ref|XM_592903 unmapped PREDICTED: Bos taurus similar to Lipopolysaccharide-binding protein precursor (LBP) (LOC514978) ACTGAGACCACAGACCACCCAGCTCCTACATGGACTACAAATCTATCCAATAAATGATTT A_73_103023 A_73_103023 FALSE XM_588345 XM_588345 LOC511081 ref|XM_588345 unmapped Bos taurus similar to Homo sapiens COMM domain containing 2 (COMMD2) ACTGGATGTACAGCTTGCAAGCAGAAGCCTCAGGCAACAGATTAAACCATCAGTGACTAT A_73_103024 A_73_103024 FALSE XM_864546 XM_864546 LOC613597 ref|XM_864546 unmapped Bos taurus similar to Homo sapiens F-box protein 40 (FBXO40) TTTAAAGCTTACACCCAACTGGTGAACACTGAGTACTGCCCGTTCCCTAATTATAGCTCT A_73_103025 A_73_103025 FALSE BI683411 BI683411 gb|Bos taurus similar to Homo sapiens coiled-coil domain containing 21 (CCDC21) unmapped Unknown ATCTGGGGCCAAGGGCTGATTAGAGATTTTGTTTGCCCTGCCCCGCACTGGCTTTGCCTT A_73_103026 A_73_103026 FALSE CB170716 CB170716 gb|Bos taurus similar to Homo sapiens aminoacylase 1 (ACY1) unmapped Unknown CACCCTGGACCACTGCCAAGGAGCCCTCTTCCCTCCTGCCCTACAATAAAGTCTCTGTGG A_73_103027 A_73_103027 FALSE NM_001034674 NM_001034674 MGC127119 ref|NM_001034674 unmapped Bos taurus similar to Homo sapiens ribosomal protein L14 (RPL14) AAGTTCTTTTTGACATGTTGGCAAATTATTTAATCTGTGGATTAAAGTCTTCTTGCCGGG A_73_103028 A_73_103028 FALSE BM258333 BM258333 gb|Bos taurus similar to Homo sapiens bromodomain adjacent to zinc finger domain, 2A (BAZ2A) unmapped Unknown TTCTACCCCTAGCCTATTTCTAAAGTCGCCTTTTCTGTCATATAAACCTCAGAACTTTTA A_73_103029 A_73_103029 FALSE XM_588963 XM_588963 LOC511596 ref|XM_588963 unmapped Bos taurus similar to Homo sapiens Norrie disease (pseudoglioma) (NDP) CATGAGGCACCACTATGTTGATTCTATCAGTCACCCGCTATACAAGTGTAGCTCCAAGAT A_73_103030 A_73_103030 FALSE XM_875815 XM_875815 LOC539350 ref|XM_875815 unmapped Bos taurus similar to Homo sapiens transmembrane emp24 protein transport domain containing 7 (TMED7) GGGCATTTTCATTTACTTTTGGAAAGAAAAATTTGTCTAAATGACACATGCTGGTTCTGC A_73_103031 A_73_103031 FALSE XM_615249 XM_615249 LOC535222 ref|XM_615249 unmapped Bos taurus similar to Homo sapiens EGF- containing fibulin-like extracellular matrix protein 2 (EFEMP2) ATCCTAGCAGCTCTCTGAGTCTCAGTGTTCCAATCCATAAAATGAGGCCACTGGATTGTT A_73_103032 A_73_103032 FALSE NM_174203 NM_174203 TRHR ref|NM_174203 unmapped Bos taurus thyrotropin-releasing hormone receptor (TRHR) ACTGACACTTACTTGTCTGCCACAAAGGTGTCTTTTGATGACACCTGCTTGGCTTCTGAA A_73_103033 A_73_103033 FALSE BF601046 BF601046 gb|Bos taurus similar to Homo sapiens GSG1-like (GSG1L) unmapped Unknown CGCTCAACTCCTACACCAAGAACGGTCATTGAGTTCCGGCACAAGCGCAAGGTCTTTGAG A_73_103034 A_73_103034 FALSE XM_585724 XM_585724 LOC508879 ref|XM_585724 unmapped Bos taurus similar to Homo sapiens aldehyde dehydrogenase 3 family, member B2 (ALDH3B2), transcript variant 1 AACAACATCCGCTACCCACCCTATTCTGACTTCGAACAGAAGCTGATCACCTGGGCCTTG A_73_103035 A_73_103035 FALSE XM_871005 XM_871005 LOC618679 ref|XM_871005 unmapped Bos taurus similar to Homo sapiens caudal type homeobox transcription factor 2 (CDX2) GCTGGGCAGCCAAGTGAAAACCAGGACGAAAGACAAATACCGGGTCGTGTACACGGACCA A_73_103036 A_73_103036 FALSE XM_583023 XM_583023 LOC506561 ref|XM_583023 unmapped Bos taurus similar to Homo sapiens achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) (AAAS) CCGCTGGGGGTGGAGGCTCTATTCACGATCTACCTCTGTTTACTGAGACATCCCCAACCT A_73_103037 A_73_103037 FALSE XM_581462 XM_581462 LOC505209 ref|XM_581462 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 6, subfamily K, member 2 (OR6K2) AAAGGAAGCCATAAAAAATCTTTGGTTGAAACTGGTTTCCCGAAGGTCATCAATAAACAA A_73_103038 A_73_103038 FALSE XM_870751 XM_870751 LOC618422 ref|XM_870751 unmapped Bos taurus similar to Homo sapiens huntingtin- associated protein 1 (neuroan 1) (HAP1), transcript variant 1 GGCATCTGCTGGCTCTGTCACCCACTACACATACACTGTACCTCTGGAGGCACTTCCTGA A_73_103039 A_73_103039 FALSE AW484572 AW484572 gb|Unidentified transcripts on BTA19 position 45265064-45266229 unmapped Unknown CGAGAGAATGAGTGTGGAGTGGTATGGGGTCTGTTTTGCTCTTCCCCAAGTTTGTATTTT A_73_103040 A_73_103040 FALSE XM_611714 XM_611714 LOC532591 ref|XM_611714 unmapped PREDICTED: Bos taurus similar to radixin (LOC532591) AAGGCGTAGGCTTCTGAGAACCCACTTTTTTCTGCATGACTAGCTTGTAAGGAGGGATAA A_73_103041 A_73_103041 FALSE XM_868175 XM_868175 LOC616210 ref|XM_868175 unmapped Bos taurus similar to Homo sapiens testis enhanced gene transcript (BAX inhibitor 1) (TEGT) CCAGATAAGGACCTTCTTGAGGCAGGAGAGAGCAAAATCTCCACTAACTGCATCTTTGTT A_73_103042 A_73_103042 FALSE XM_615401 XM_615401 LOC535342 ref|XM_615401 unmapped Bos taurus similar to Homo sapiens STE20-like kinase (yeast) (SLK) AGCATGCTGTGGTTGGGTTTGGCTTTTTAAGTACGTCATTCTGTTCTCTTCATCTTTAGC A_73_103043 A_73_103043 FALSE XM_864407 XM_864407 LOC613523 ref|XM_864407 unmapped PREDICTED: Bos taurus similar to ELL associated factor 2 (LOC613523) TACCACACTCCTGTCTTCAATTGTGAAATGTCAAAACTTGATTTGTAATAAATGTCCTGG A_73_103044 A_73_103044 FALSE NM_174688 NM_174688 MAPA ref|NM_174688 unmapped Bos taurus MAPA protein (MAPA) CTAGAAGGGGAGGAGAGACCCCAATGCGGATGGGGATGGGAGAGTCAATTTGTGAACTCT A_73_103045 A_73_103045 FALSE NM_001035110 NM_001035110 MGC127083 ref|NM_001035110 unmapped Bos taurus similar to Homo sapiens family with sequence similarity 96, member A (FAM96A), transcript variant 1 TTGCTATTTTTCTGATGCCCATTCTGATGCTTTTCATGTCAAAATATTTACTGTGCCCAA A_73_103046 A_73_103046 FALSE XM_865373 XM_865373 LOC614049 ref|XM_865373 unmapped Bos taurus similar to Homo sapiens neuronal PAS domain protein 2 (NPAS2) GACCAGCCTCTGCGCCACGTGCGCATGTGCTCATTGGCCTTCACTCTCCAGACCCTCTTT A_73_103047 A_73_103047 FALSE BF599888 BF599888 gb|Bos taurus similar to Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 (SERPINA3) unmapped Unknown CCTTCCTGATGATCATCGTCCCTATGGACACCCCAGAACATCTTTTTCATAAGCAAAGTT A_73_103048 A_73_103048 FALSE NM_174389 NM_174389 MMP13 ref|NM_174389 unmapped Bos taurus matrix metalloproteinase 13 (collagenase 3) (MMP13) TGGAAAGCATTTGAGATAACACTTCCAGACATTTGGGGGGTGAGTTATGGGAGAAGGAGA A_73_103049 A_73_103049 FALSE NM_001015538 NM_001015538 C2orf24 ref|NM_001015538 unmapped Bos taurus chromosome 2 open reading frame 24 (C2orf24) GAACTAAGGTTTCAATAAACAGTTTTAGTTGCATGGCCTGGACTCTTCCTTCTGCAGCAG A_73_103050 A_73_103050 FALSE XM_590406 XM_590406 LOC512824 ref|XM_590406 unmapped Bos taurus similar to Homo sapiens fuse- binding protein-interacting repressor (SIAHBP1), transcript variant 2 TCCTTGTTTGCTCTGGGTTTTATAGAGTGATTCAATGGTATCTCGGCCCGGCCGCCCAGC A_73_103051 A_73_103051 FALSE XM_591219 XM_591219 LOC513526 ref|XM_591219 unmapped Bos taurus similar to Homo sapiens chromosome 16 open reading frame 33 (C16orf33) ATCCCAGGGCTGTGGGCCTGGCCCTGTATACAGAATAAACCCTGTTTTCTTTGAATAAAA A_73_103052 A_73_103052 FALSE XM_598254 XM_598254 LOC520024 ref|XM_598254 unmapped Bos taurus similar to Homo sapiens protocadherin gamma subfamily C, 3 (PCDHGC3), transcript variant 1 GCACTCCTGTCCTGGCTACCAACATAAGTGTGAATGTATTTGTCACTGATCGCAATGACA A_73_103053 A_73_103053 FALSE XM_869601 XM_869601 LOC617356 ref|XM_869601 unmapped PREDICTED: Bos taurus similar to Glutathione S-transferase A1 (GTH1) (HA subunit 1) (GST-epsilon) (GSTA1-1) (GST class-alpha) (LOC617356) ACTAAGACCATCCTTAAGAAGAAGGAAAAGAAGATCCCGGACAAGCCCCTTCAGGATGAA A_73_103054 A_73_103054 FALSE XM_584267 XM_584267 LOC507621 ref|XM_584267 unmapped Bos taurus similar to Homo sapiens solute carrier family 5 (sodium/glucose cotransporter), member 12 (SLC5A12), transcript variant 2 ACATGGCTTTAGAGAAGATTACCCATTTCTAAGGCAACACACACACATGATACACAGATA A_73_103055 A_73_103055 FALSE CB454370 CB454370 gb|Bos taurus similar to Homo sapiens junctophilin 4 (JPH4) unmapped Unknown TTCATGGAATTTGGGATTGACGTTAAACTACAACAGTGCCGCCAACACCAAGTCTTGCAG A_73_103056 A_73_103056 FALSE XM_596638 XM_596638 LOC518447 ref|XM_596638 unmapped PREDICTED: Bos taurus similar to IQ motif containing F1 (LOC518447) TCGAGATCTTGCTGGGCTCAGGGCCTTGCATTGTGACGGAGTGTATTCCCCTTCCAATAA A_73_103057 A_73_103057 FALSE XM_868912 XM_868912 LOC616799 ref|XM_868912 unmapped Bos taurus similar to Homo sapiens GINS complex subunit 4 (Sld5 homolog) (GINS4) CTTCATTTTCTCCAGAGCATTCTCACCCTTCTCAGCCATTCATTGAAAAACGTTCAGTGA A_73_103058 A_73_103058 FALSE XM_612348 XM_612348 LOC540617 ref|XM_612348 unmapped PREDICTED: Bos taurus similar to formin binding protein 1-like isoform 2 (LOC540617), partial mRNA. GATTTGCTTCCGTAGGAGGCAGGTTCCTTCATGTGGAATAGTGCAACCTGTATATGGATT A_73_103059 A_73_103059 FALSE XM_585351 XM_585351 LOC508559 ref|XM_585351 unmapped Bos taurus similar to Homo sapiens embryonal Fyn-associated substrate (EFS), transcript variant 1 CTGAAACCTAGAGCCACCAGGAGCCCCTTTTTTGTCCTGTGTCTTGGCTTTGGAACATCG A_73_103060 A_73_103060 FALSE XM_604915 XM_604915 LOC526542 ref|XM_604915 unmapped PREDICTED: Bos taurus similar to Repetin (LOC526542) CAGAGGGACTGAGACCCACAGTCAGACAAGCCAAGTGGTGACAGGAGGACACATGTCCTT A_73_103061 A_73_103061 FALSE XM_588152 XM_588152 LOC510920 ref|XM_588152 unmapped Bos taurus similar to Homo sapiens cell cycle related kinase (CCRK), transcript variant 2 TTGCAAATAAGAGACATTCCTGGAATTCACTTGTTAATTCAGTAAATACCAAAACAGCCC A_73_103062 A_73_103062 FALSE XM_615222 XM_615222 LOC541235 ref|XM_615222 unmapped Bos taurus similar to Homo sapiens protein phosphatase 1 (formerly 2C)-like (PPM1L) CTTTGTCCTCCTAAGCCCAGTTTTTCTGCTCTGCAGCAGCCCAGAAACAGATTTGAAAAT A_73_103063 A_73_103063 FALSE XM_603618 XM_603618 LOC525269 ref|XM_603618 unmapped PREDICTED: Bos taurus similar to glutamate receptor, ionotropic, N-methyl-D-aspartate 3A (LOC525269) ACCCAAAAGAATCAACTTGTCCATGGAAATACAGCTAGCAAGTGGCAGTCAGGACCAGAA A_73_103064 A_73_103064 FALSE NM_001033625 NM_001033625 SLC27A1 ref|NM_001033625 unmapped Bos taurus similar to Homo sapiens solute carrier family 27 (fatty acid transporter), member 1 (SLC27A1) GCATGGGCCTTTTCAAGCACTGAGGTTTTGTTTCCTCGTTGAGTTTAAGAAATAAACCTG A_73_103065 A_73_103065 FALSE XM_589564 XM_589564 LOC512117 ref|XM_589564 unmapped Bos taurus similar to Homo sapiens chromosome condensation protein G (HCAP-G) ATAGGTGATTTTTTCCCCCCAAAGTGTTTGCATATGAGAGCCCAAGTCGCCTAGTTGATG A_73_103066 A_73_103066 FALSE XM_613788 XM_613788 LOC534129 ref|XM_613788 unmapped Bos taurus similar to Homo sapiens cAMP responsive element binding protein 5 (CREB5), transcript variant 2 ATGGGAATATGAACACCATGGGCCACATGATGGAAATGATGGGCTCCCGGCAGGACCAGA A_73_103067 A_73_103067 FALSE NM_001040471 NM_001040471 GPI ref|NM_001040471 unmapped Bos taurus similar to Homo sapiens glucose phosphate isomerase (GPI) GTTTCAGTGCAACTGATTTTTCTCATCTATGTTTATTGTTCATGTACCAGGAAGAAAAAT A_73_103068 A_73_103068 FALSE XM_606956 XM_606956 LOC528530 ref|XM_606956 unmapped Bos taurus similar to Homo sapiens colony stimulating factor 2 receptor, beta, low-affinity (granulocyte- macrophage) (CSF2RB) TGGACCTATGCGCATTAAGAGAGAAGTCCAAGATGTGAATTCCAAAATGGTTGGAAAAAA A_73_103069 A_73_103069 FALSE XM_869383 XM_869383 LOC617179 ref|XM_869383 unmapped Bos taurus similar to Homo sapiens TSPY-like 2 (TSPYL2) TCCCCCCAGAAGTCCCGCCTCGTTCCCTCTGGACCCTGGTAATCCTAATAAAAGTGTGAG A_73_103070 A_73_103070 FALSE AW483566 AW483566 gb|Unidentified transcripts on BTA1 position 31857905-31858881 unmapped Unknown CAAATCATTAGGAATGCTCTCACTTGTGCAATAATGATATCCAAGATGATGTGATTTGTC A_73_103071 A_73_103071 FALSE AV607500 AV607500 gb|Unidentified transcripts on BTA19 position 35909138-35908491 unmapped Unknown TATTTATCATACCTACTGTTTTAATAATCTGCTTTCTTTAAATGCAATAAATCCCAAATG A_73_103072 A_73_103072 FALSE CB460912 CB460912 gb|Unidentified transcripts on BTA13 position 56601597-56602411 unmapped Unknown TTCTTCTGGAAGCACTGCGCTGATTTCATTTTGGGTGAACACTCCCTCCTCTCTTCAATT A_73_103073 A_73_103073 FALSE XM_581847 XM_581847 LOC538659 ref|XM_581847 unmapped Bos taurus similar to Homo sapiens testis- specific serine kinase 3 (TSSK3) TGCACGTCATGCTCTGTGCCAGCCTGCCTTTTGACGACACAGACATCCCCAAGATGCTGT A_73_103074 A_73_103074 FALSE XM_585755 XM_585755 LOC508907 ref|XM_585755 unmapped Bos taurus similar to Homo sapiens prolyl-tRNA synthetase (mitochondrial)(putative) (PARS2) TTGAGGTTTGGTGCCAGAATACCGGAGAGGTGGTCTTCCTCACCAGAGAAGGAGTCCTGG A_73_103075 A_73_103075 FALSE XM_601947 XM_601947 LOC523645 ref|XM_601947 unmapped Bos taurus similar to Homo sapiens ADAM metallopeptidase domain 22 (ADAM22), transcript variant 4 TAGGCATAATTGCTGGCACCATTTTAGTGCTGGCCCTCATATTAGGAATTACTGCATGGG A_73_103076 A_73_103076 FALSE XM_617732 XM_617732 LOC537562 ref|XM_617732 unmapped PREDICTED: Bos taurus similar to YTH domain containing 2 (LOC537562) TAAGATATTTTGGGAGCTGTCCAGTGATATATATACAGGGAAGACCATTTGAAGTAAAAG A_73_103077 A_73_103077 FALSE XM_601985 XM_601985 LOC523683 ref|XM_601985 unmapped Bos taurus similar to Homo sapiens cut-like 1, CCAAT displacement protein (Drosophila) (CUTL1), transcript variant 3 TGCCACCTTCTGCGCCAAGAAGTTCGCCGACCACCTGCACAAGTTCCACGAGAATGACAA A_73_103078 A_73_103078 FALSE XM_610484 XM_610484 LOC531979 ref|XM_610484 unmapped Bos taurus similar to Homo sapiens WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 (WFIKKN2) GAACAAAAGAAGCCAACCTACATTTGCAGGTTATTCCTGATGGCCAGTCTCCTCTGACTT A_73_103079 A_73_103079 FALSE XM_586554 XM_586554 LOC539345 ref|XM_586554 unmapped Bos taurus similar to Homo sapiens aarF domain containing kinase 2 (ADCK2) TGGGCCTGGTGTCAGAGAAACTGTTTCAGGGAAAACATTCTCTGGAGGAGGATGAATAAA A_73_103080 A_73_103080 FALSE XM_613215 XM_613215 LOC540801 ref|XM_613215 unmapped Bos taurus similar to Homo sapiens A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9), transcript variant 1 TTCGCTACTGGTGATGAAGACAGATAATATCACTTGTAGAGACCTATTTTTGTATAATGG A_73_103081 A_73_103081 FALSE NW_935007 NW_935007 gb|Putative orthologue of human miRNA hsa-mir-105-1 on chr X, (-) strand. Mature length 20 nt, stem-loop length 81 nt. Source: NW_935007.1:6487-6567 unmapped Unknown TCAAATGCTCAGACTCCTGTTATCCTACTATACGTATCACATAGC A_73_103082 A_73_103082 FALSE XM_617217 XM_617217 LOC537062 ref|XM_617217 unmapped Bos taurus similar to Homo sapiens solute carrier family 27 (fatty acid transporter), member 6 (SLC27A6), transcript variant 1 TTTAGGAATTTGGGGAAGATATATAAATGGGATCAAGTTGATGCTAAAATCCAACAGAGC A_73_103083 A_73_103083 FALSE NM_001040486 NM_001040486 SLC38A3 ref|NM_001040486 unmapped Bos taurus similar to Homo sapiens solute carrier family 38, member 3 (SLC38A3) CCCTGTCTGGATCTTTTATTACTAGTAAAACCTGCTGCGAATAAAGGTGGGTAGCAAGCG A_73_103084 A_73_103084 FALSE BI975573 BI975573 gb|Bos taurus similar to Homo sapiens KIAA1522 (KIAA1522) unmapped Unknown CCTGAAGCCGGAGTGAGACACATGGAAAAACTCTGTGTGGATTTCATTCGAAGGTGTTAA A_73_103085 A_73_103085 FALSE XM_875781 XM_875781 LOC514561 ref|XM_875781 unmapped Bos taurus similar to Homo sapiens zinc finger, UBR1 type 1 (ZUBR1) AATGCCTTGGCTTCTCTTTCCGTTGTTTGGGCACTGAAGAGCTGAAGCCCAGAGACACGT A_73_103086 A_73_103086 FALSE CB465753 CB465753 gb|Unidentified transcripts on BTA16 position 28124499-28123848 unmapped Unknown CCAAAGCTGTGACCCAAGTCTAATAAAACCTGATATGGATCATATAGAATTATATCCCTT A_73_103087 A_73_103087 FALSE XM_872794 XM_872794 LOC505757 ref|XM_872794 unmapped PREDICTED: Bos taurus similar to gamma isoform of regulatory subunit B56, protein phosphatase 2A isoform c, transcript variant 4 (LOC505757) TTTCTCCAACCCCGTCTGTAGGCAATCACGTCCTTCCGCCTCAGCTCGAGACTAGGAGTT A_73_103088 A_73_103088 FALSE NM_001015637 NM_001015637 DNAJA1 ref|NM_001015637 unmapped Bos taurus DnaJ (Hsp40) homolog, subfamily A, member 1 (DNAJA1) CTAGCTCTGCAAAAGAATGTGATTTGTGACAAATGTGAAGGCCGAGGTGGTAAAAAAGGA A_73_103089 A_73_103089 FALSE NM_175831 NM_175831 COX7C ref|NM_175831 unmapped Bos taurus cytochrome c oxidase subunit VIIc (COX7C) AGACAGATAGGAAGAGGAGCATATTAAGAGGTGCAGTCTCTTAAAAGGATCAATCCCTTG A_73_103090 A_73_103090 FALSE CB454866 CB454866 gb|Unidentified transcripts on BTA25 position 4624685-4623900 unmapped Unknown GACTAAGTTTAGAAAATGAACCTAGATCTTGCCTTGTATCTGTCTGAATATGTGTATGTC A_73_103091 A_73_103091 FALSE XM_615784 XM_615784 LOC535674 ref|XM_615784 unmapped Bos taurus similar to Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2) TCCAGATCCACTGAACGTCCTGATACAAACCTCATGAGGTCGATGCCTTCATTAATGACT A_73_103092 A_73_103092 FALSE XM_584166 XM_584166 LOC507536 ref|XM_584166 unmapped Bos taurus similar to Homo sapiens coiled-coil domain containing 44 (CCDC44) TAAATTTATTTGTGATGCCTCTTCACTGCATCAAGTGAGGAAGAAACTGGACTCCCTGGG A_73_103093 A_73_103093 FALSE XM_589274 XM_589274 LOC539768 ref|XM_589274 unmapped PREDICTED: Bos taurus similar to phosphodiesterase 8B isoform 1 (LOC539768) GAGGTGCCTCTGTGTAAACACTCAATTATGCCATAATGATCTTGGCTAAAAGGCAGTGCT A_73_103094 A_73_103094 FALSE XM_601937 XM_601937 LOC523635 ref|XM_601937 unmapped Bos taurus similar to Homo sapiens chromosome 16 open reading frame 70 (C16orf70) AGACCTTGTGTGGAGAGCCAAGCATGCTAAGAACATCTTGACAGGAATCACCAAAATACA A_73_103095 A_73_103095 FALSE NM_001038119 NM_001038119 MGC134032 ref|NM_001038119 unmapped Bos taurus similar to Homo sapiens guanosine monophosphate reductase 2 (GMPR2), transcript variant 1 TCTGGTAGAGGTAGGCTTTTAGAATCATGTTTTGTTAATCGGATTCATTAAATAGACCTC A_73_103096 A_73_103096 FALSE AW315980 AW315980 gb|Unidentified transcripts unmapped Unknown TTCTTTAAGGTGGTATTTCATACAGTTCATTAATGATCCTTGGAATCTGGACTATTCTGC A_73_103097 A_73_103097 FALSE XM_615731 XM_615731 LOC535623 ref|XM_615731 unmapped PREDICTED: Bos taurus similar to rhomboid, veinlet-like 4 (LOC535623) CAGTCGCTGTGGTGGATTTTTGTGGCCATGTACACCGTCTTCGTGCTGTTCGCTGTCTTC A_73_103098 A_73_103098 FALSE XM_598505 XM_598505 LOC520269 ref|XM_598505 unmapped PREDICTED: Bos taurus similar to zinc finger protein 536 (LOC520269) GCCAAATGAATCAATGGTCAGGAAGTGTCTGCAGACAAATATCCATTGCAGGTTTGATGA A_73_103099 A_73_103099 FALSE AV610560 AV610560 gb|Unidentified transcripts unmapped Unknown GAGTATTCTTTCCTTGCAGTCATCAAGAGGCCAGAGTTGGTTGAAGTTGACTTGTTACCA A_73_103100 A_73_103100 FALSE XM_615531 XM_615531 LOC535441 ref|XM_615531 unmapped Bos taurus similar to PREDICTED: Homo sapiens zinc and ring finger 3 (ZNRF3) GTTACTCTTCTGTTTTGTAAAGTGTGTGTGCTTGGGGTTCTGAGGTGTGTGGGATTGACT A_73_103101 A_73_103101 FALSE XM_616508 XM_616508 LOC536380 ref|XM_616508 unmapped Bos taurus similar to Homo sapiens activin A receptor, type IC (ACVR1C) CTAACTGCTCTTCGGATTAAGAAGACTATATCTCAACTTTGTGTCAAAGAAGACTGCAAA A_73_103102 A_73_103102 FALSE XM_597494 XM_597494 LOC519278 ref|XM_597494 unmapped PREDICTED: Bos taurus similar to aryl hydrocarbon receptor 2 (LOC519278), partial mRNA. GAAGAGCTACTTCACAGGCTGTAGTGCCAGGGCCTGTCTACCTCCAGACATCCCCAGGGG A_73_103103 A_73_103103 FALSE XM_616093 XM_616093 LOC535975 ref|XM_616093 unmapped PREDICTED: Bos taurus similar to uronyl-2-sulfotransferase (LOC535975) GAAGATATTTATAAGAGGTGATGCCAGCACTGTGTTGCCTCCAGTGGCTTAATCTCCCTT A_73_103104 A_73_103104 FALSE XM_581970 XM_581970 LOC505650 ref|XM_581970 unmapped Bos taurus similar to Homo sapiens hypothetical protein LOC144233 (LOC144233) CCCAGGCTGAGCATGGCAGTCACAGATACAGTATTAGCCAAGATACATTGACTAGCATTT A_73_103105 A_73_103105 FALSE BE667247 BE667247 gb|Bos taurus similar to Homo sapiens retinitis pigmentosa 2 (X-linked recessive) (RP2) unmapped Unknown AAGTAATCAGAAGATTTTGATAGGTTGATCTTGTGAGAAGGGACTGAACCTGCCATCTGC A_73_103106 A_73_103106 FALSE XM_864423 XM_864423 LOC538310 ref|XM_864423 unmapped Bos taurus similar to Homo sapiens EP400 N-terminal like (EP400NL) AAACGTGGTCTGACAGCATCTGCCTCTGTTTGGTTCTTTATTCCTATTTGAAAACACAGT A_73_103107 A_73_103107 FALSE XM_875338 XM_875338 LOC539257 ref|XM_875338 unmapped PREDICTED: Bos taurus similar to calpain, small subunit 1, transcript variant 3 (LOC539257) CTTGGATCTCTGGGGTAGAGGCGGCTCCCCTCGGGTTATTTTCCAGTACCTGTGTGGAAA A_73_103108 A_73_103108 FALSE XM_593202 XM_593202 LOC515220 ref|XM_593202 unmapped Bos taurus similar to Homo sapiens male- specific lethal 3-like 1 (Drosophila) (MSL3L1), transcript variant 2 AAGCATTGCCTGAATGTTTGAGATTTTATAGCTACACTTGGTTGTGTGATATTATGGTTC A_73_103109 A_73_103109 FALSE XM_870713 XM_870713 LOC618379 ref|XM_870713 unmapped PREDICTED: Bos taurus similar to Dynein light chain 4, axonemal (LOC618379) TGTCACGGCCTGTGAGAAATTCTCCAACAACAACGAGGTATTGCCATCAGTGCAGCCCCT A_73_103110 A_73_103110 FALSE XM_590682 XM_590682 LOC513059 ref|XM_590682 unmapped Bos taurus similar to Homo sapiens chromosome 17 open reading frame 41 (C17orf41) GCTGACTTCCCTTAATATTCTACATTAACGATGCCTTCTACGGAGTCTCATGTGGCTCTC A_73_103111 A_73_103111 FALSE NM_001040537 NM_001040537 GTF2H5 ref|NM_001040537 unmapped Bos taurus general transcription factor IIH, polypeptide 5 (GTF2H5) TACTATCCATGGGGTCGCAAAGAGTTGGGCATGACTGAGCGACTTCACTTTCACTTTAAA A_73_103112 A_73_103112 FALSE XM_602687 XM_602687 LOC524365 ref|XM_602687 unmapped Bos taurus similar to Homo sapiens transient receptor potential cation channel, subfamily V, member 5 (TRPV5) ACACGTGAATCTCGGACTGGACCTTGGGGAGGGGGATGGAGACGATCGGGTTTATCAGTT A_73_103113 A_73_103113 FALSE XM_866003 XM_866003 LOC614478 ref|XM_866003 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 152 (C9orf152) TTGAGCCACCCTGAAACTCCCTCCAACCTGGGGATTCCTTTTGATTCCTTTTGTGAATAA A_73_103114 A_73_103114 FALSE XM_867959 XM_867959 LOC616006 ref|XM_867959 unmapped PREDICTED: Bos taurus similar to aldo-keto reductase family 1, member C3 (LOC616006) TATTATTCATTATCCAGTGCCTCTGGTGGTAGGTGATTTGTATGAAAATGGAAAACCGAT A_73_103115 A_73_103115 FALSE CB425752 CB425752 gb|Bos taurus similar to Homo sapiens heparan sulfate 2-O-sulfotransferase 1 (HS2ST1) unmapped Unknown AAATTGTGAGTCCCATCTGTGATTTACAAACAGTATTTTGATATTGCAGGTGATTTGCTC A_73_103116 A_73_103116 FALSE XM_612781 XM_612781 LOC533388 ref|XM_612781 unmapped Bos taurus similar to Homo sapiens ubiquitin specific peptidase 54 (USP54) AGTCGCCGCTGTAAACCCTCAGAGTCAGCTGAACTATTTTAGGGCCAAACATACTGTTTT A_73_103117 A_73_103117 FALSE XM_614853 XM_614853 LOC541166 ref|XM_614853 unmapped PREDICTED: Bos taurus similar to ets variant gene 5 (ets-related molecule), transcript variant 1 (LOC541166) AATTTTAGGAGAAGGTGATTAACACTTTTGACAGTATTTTGTTTTGCTTTGATTCGGGGG A_73_103118 A_73_103118 FALSE XM_592168 XM_592168 LOC514334 ref|XM_592168 unmapped PREDICTED: Bos taurus similar to zona pellucida binding protein 2 isoform 2 (LOC514334) GTTACATGTCAGACCTGCATTTCCGTCCAAATCTACGGAGCTAAATCATGCCAGTAAATT A_73_103119 A_73_103119 FALSE XM_602426 XM_602426 LOC524106 ref|XM_602426 unmapped Bos taurus similar to Homo sapiens zinc finger protein 354A (ZNF354A) TAATTGTTACATGCATCTGGGTGATGAGGGGAGATGTGCACTTGATTTCCCATTGAAATA A_73_103120 A_73_103120 FALSE XM_587646 XM_587646 LOC510507 ref|XM_587646 unmapped Bos taurus similar to Homo sapiens cytochrome P450, family 7, subfamily A, polypeptide 1 (CYP7A1) AAACACTAGAGAATGCTGGTCAAAAAGTTAGCTTTGAAGACAGTCCTATTCATTTGAATC A_73_103121 A_73_103121 FALSE XM_589664 XM_589664 LOC539815 ref|XM_589664 unmapped Bos taurus similar to Homo sapiens UDP- Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 (B3GALT2) GGGATGGGGGAAAAACTACAAATGTTTGATGAACACTTGATTCTAGGATGAACAATGTAT A_73_103122 A_73_103122 FALSE XM_612378 XM_612378 LOC540628 ref|XM_612378 unmapped Bos taurus similar to Homo sapiens orthodenticle homolog 1 (Drosophila) (OTX1) GCTGCCGCCGCATCCTCTGCTTGGAAACTCAACTTCAACTCGCCTGACTGTCTGGACTAT A_73_103123 A_73_103123 FALSE NM_174806 NM_174806 GOT2 ref|NM_174806 unmapped Bos taurus glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) (GOT2) CAATACCCTCGCTTTTCTTGGCAAAGAATAGCAGAGAGTAGGTAAACCGCTTTATTTTGG A_73_103124 A_73_103124 FALSE XM_602486 XM_602486 LOC524166 ref|XM_602486 unmapped PREDICTED: Bos taurus similar to IBR domain containing 2 (LOC524166) TTGGGTGATCAACTTTGCCTCCAGCCAGTAGTGGTGGTCTGCAGGATTGTTTAATATGAA A_73_103125 A_73_103125 FALSE BI774535 BI774535 gb|Bos taurus similar to Homo sapiens fibrillin 2 (congenital contractural arachnodactyly) (FBN2) unmapped Unknown GTGAGGCTGCCTTTAAAATAATCAGATGTGTACCAAGTTGGACGACTGGCAGAAAACCAA A_73_103126 A_73_103126 FALSE NM_001037486 NM_001037486 MDP-1 ref|NM_001037486 unmapped Bos taurus similar to Homo sapiens magnesium- dependent phosphatase 1 (MDP-1) GTCCAGTCATTTGAGGCACAGAACTGAAAGGAAATCAGGAGGGCATTTTCAGGTCCATTT A_73_103127 A_73_103127 FALSE XM_616552 XM_616552 LOC536421 ref|XM_616552 unmapped Bos taurus similar to Homo sapiens cylindromatosis (turban tumor syndrome) (CYLD), transcript variant 1 GTAGCTAATTGTTGCCTTGAGGAGGATATACTTTGGTTTTATTGAGTCTATTTTCAATCC A_73_103128 A_73_103128 FALSE CB420030 CB420030 gb|Unidentified transcripts on BTA10 position 8816658-8815353 unmapped Unknown CACTCCAGTAAGTTTATGGGTTTTCTCATTTTCAGCTACATGGCTTTTAATCATGTAAAG A_73_103129 A_73_103129 FALSE NM_001034547 NM_001034547 MGC127546 ref|NM_001034547 unmapped Bos taurus similar to Homo sapiens transmembrane protein 85 (TMEM85) ATAAATGAAGACTTCACATAAAATTACCACTCAGCCACACAGGGTAGCTTACCTATGCTT A_73_103130 A_73_103130 FALSE XM_590464 XM_590464 LOC512868 ref|XM_590464 unmapped Bos taurus similar to Homo sapiens SET and MYND domain containing 4 (SMYD4) AAAGGTTCCGCTGTACTTAGTAAAAGAGGCCCACTTCCTTAAAAAGAATATGGGTAGAAT A_73_103131 A_73_103131 FALSE XM_872457 XM_872457 LOC508171 ref|XM_872457 unmapped Bos taurus similar to Homo sapiens KIAA1018 (KIAA1018) TAATAAACCTGGCACCTTAAGGATTCATCATCGTACAGTGTCTGTATCACCAACCTCAGT A_73_103132 A_73_103132 FALSE XM_591858 XM_591858 LOC540154 ref|XM_591858 unmapped Bos taurus similar to Homo sapiens tripartite motif-containing 59 (TRIM59) TCCTGAAATGAAGATCTCTTCAAAAAGGATTCCCTGTGCCTGGCCTGATAAAGAGGAAAA A_73_103133 A_73_103133 FALSE XM_607659 XM_607659 LOC529218 ref|XM_607659 unmapped Bos taurus similar to Homo sapiens forkhead box F2 (FOXF2) CGGCATCTCCTCCTTCCACCCCTCTGCCAGCGGCCCCTACTACCACCACCACCACCATCA A_73_103134 A_73_103134 FALSE BG693723 BG693723 gb|Bos taurus similar to Homo sapiens solute carrier family 16, member 14 (monocarboxylic acid transporter 14) (SLC16A14) unmapped Unknown TTGTTTCATCGCCATTATTTCCTGCTCTAATGTCTAGTGGGAGGGGTTGTGTAATGAAAA A_73_103135 A_73_103135 FALSE XM_866349 XM_866349 LOC614753 ref|XM_866349 unmapped Bos taurus similar to Homo sapiens lipoma HMGIC fusion partner (LHFP) AGGAGAGACATTCTCCAGTCATTAGATCTTGTTTTCTTTCGTCCATTATTGTACTATGCT A_73_103136 A_73_103136 FALSE BE477664 BE477664 gb|Bos taurus similar to Homo sapiens adaptor-related protein complex 1, gamma 2 subunit (AP1G2), transcript variant 2 unmapped Unknown AGACAAGAGGGTGGGCTACCTGGGGGCCATGCTTCTACTGGATGAGAGGCAGGATGCCCA A_73_103137 A_73_103137 FALSE CB430728 CB430728 gb|Unidentified transcripts on BTA19 position 28077465-28078450 unmapped Unknown TGAGTTCACGTGTCACAAAAGACTAAGATTTAGCTTTACCTTTCTGAAGTTTACCTCATA A_73_103138 A_73_103138 FALSE XM_879491 XM_879491 LOC505354 ref|XM_879491 unmapped Bos taurus similar to Homo sapiens zinc finger, DHHC-type containing 12 (ZDHHC12) GGACCCATGGTGGAGGCTCAGGCACAAAGAGACACCTGGGCTTCGGACATCTCCATCCCA A_73_103139 A_73_103139 FALSE CB465299 CB465299 gb|Bos taurus similar to Homo sapiens hepatic leukemia factor (HLF) unmapped Unknown CCATGGTTTTGGTTGCTGTTTATGCTGTTAAGTCCAAAACTTTGTCTGTTATTCTTAATG A_73_103140 A_73_103140 FALSE AW431791 AW431791 gb|Unidentified transcripts on BTA4 position 54218710-54219344 unmapped Unknown ATCACACACCAGGAACTGTAGGTCCGTTCGTCGTCAACAATCCAGCTTTAATTCCTACAA A_73_103141 A_73_103141 FALSE XM_868486 XM_868486 LOC507792 ref|XM_868486 unmapped Bos taurus similar to Homo sapiens GTF2I repeat domain containing 1 (GTF2IRD1), transcript variant 2 TCGAATATGTATCGATGCCTTTTAGTTTTTCCAATGATTTTTACACTATATTCCTGCCGC A_73_103142 A_73_103142 FALSE NC_006853 gb|Bos taurus mitochondrial 12S rRNA unmapped Unknown GTAACCTATGAAATGGGAAGAAATGGGCTACATTCTCTACACCAAGAGAATCAAGCACGA A_73_103143 A_73_103143 FALSE NW_929325 NW_929325 gb|Putative orthologue of human miRNA hsa-mir-328 on chr 16, (-) strand. Mature length 22 nt, stem-loop length 75 nt. Source: NW_929325.1:c334445-334371 unmapped Unknown CTGGCCCTCTCTGCCCTTCCGTTATCCTACTATACGTATCACATA A_73_103144 A_73_103144 FALSE XM_580873 XM_580873 LOC504711 ref|XM_580873 unmapped Bos taurus similar to Homo sapiens UDP-N -acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5) (GALNT5) TCAGAAGACCCTGAAAGTTGCACCTTGTGACCCAGCAAAGCCAGATCAAAAGTGGAAATT A_73_103145 A_73_103145 FALSE NM_001037470 NM_001037470 MGC129096 ref|NM_001037470 unmapped Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family G (with RhoGef domain) member 3 (PLEKHG3) GGTTGTCTTGCTGGCCCTGTGGTTGTTGCTAATGTACACATTTCATTATTTGCCAATGGT A_73_103146 A_73_103146 FALSE XM_869686 XM_869686 LOC617429 ref|XM_869686 unmapped PREDICTED: Bos taurus similar to poly(A)binding protein nuclear-like 1 (LOC617429) AGGTGCAGAGAAAGCAGTTGATGGGTGTCTCACTCTGAGACACACGCTAACAGCCAACGG A_73_103147 A_73_103147 FALSE XM_865630 XM_865630 LOC504480 ref|XM_865630 unmapped Bos taurus similar to Homo sapiens serum/glucocorticoid regulated kinase family, member 3 (SGK3), transcript variant 1 ATCTTCCTAATTGGTTGATAAGTAACAAGACTATTGCACTGTCTGTTTACCTAATTGGGA A_73_103148 A_73_103148 FALSE XM_599729 XM_599729 LOC521465 ref|XM_599729 unmapped Bos taurus similar to Homo sapiens protease, serine 27 (PRSS27) AGGTGTCTACATCCGGCTCACCTCCCACCACGACTGGATCCACCGGATCATCCCAGAGCT A_73_103149 A_73_103149 FALSE XM_876235 XM_876235 LOC504509 ref|XM_876235 unmapped PREDICTED: Bos taurus similar to zeta-chain (TCR) associated protein kinase 70kDa, transcript variant 3 (LOC504509) ATGAAGAAAAGTAACATCAATAGTGCTGTTCTGTGGCTTCCCAAGGTGCACTGTTTGCTG A_73_103150 A_73_103150 FALSE XM_870860 XM_870860 LOC618527 ref|XM_870860 unmapped Bos taurus similar to Homo sapiens kringle containing transmembrane protein 2 (KREMEN2), transcript variant 4 AGTTCTGGACTACTGCCCAAAGTGAAATGTAAGAGGTCAACAAAAGTGGTCAAAAGACCA A_73_103151 A_73_103151 FALSE XM_592159 XM_592159 LOC514326 ref|XM_592159 unmapped Bos taurus similar to Homo sapiens hypothetical protein MGC34821 (MGC34821) TCTCGGATGCTTAGCCACCACCTGTTGTTAAGGCTCTTGCCACAAGGGAAGGCGAGGGTA A_73_103152 A_73_103152 FALSE XM_585529 XM_585529 LOC508710 ref|XM_585529 unmapped Bos taurus similar to Homo sapiens membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) (MPP3) ACCCCCATCAAATCTATGTCTAAACCACAATAAATCAGTCCTGACCGTCAAAATCTAAGT A_73_103153 A_73_103153 FALSE XM_584243 XM_584243 LOC539016 ref|XM_584243 unmapped PREDICTED: Bos taurus similar to transcription factor EC isoform a (LOC539016), partial mRNA. AACACTGATTGGTTAGAAACAGCAGAATTTACAGGAAGGACAAACACGGTGTTGAAGAAT A_73_103154 A_73_103154 FALSE XM_582609 XM_582609 LOC506194 ref|XM_582609 unmapped Bos taurus similar to Homo sapiens transforming, acidic coiled-coil containing protein 3 (TACC3) TTTTAAACTAGGTTGCTTTAGGAAAAAACTAAATAAAGTTTCTCTTAAATCTAATAAAAA A_73_103155 A_73_103155 FALSE XM_594398 XM_594398 LOC516247 ref|XM_594398 unmapped Bos taurus similar to Homo sapiens plakophilin 3 (PKP3) GGCCGTAGGCGAAGCCTTCCTGAAGAAGGAGAGTGCGATGTGACCCAGCCTCCTAGGGAA A_73_103156 A_73_103156 FALSE EE892553 EE892553 gb|Unidentified transcripts unmapped Unknown CTGCTTGGTCTTCTTGGAATAAGTAATAGAATATGAAAGGAAAGTGGCCAAATCTTGATT A_73_103157 A_73_103157 FALSE XM_589192 XM_589192 LOC511788 ref|XM_589192 unmapped PREDICTED: Bos taurus similar to Serine /threonine-protein kinase 10 (Lymphocyte-oriented kinase) (LOC511788), partial mRNA. AGATTCAGGTGGTTTGCCGCCAGATGCTGGAAGCCCTCACCTTCCTGCATGGCAAGAAGA A_73_103158 A_73_103158 FALSE NM_001012670 NM_001012670 HSPCA ref|NM_001012670 unmapped Bos taurus heat shock 90kD protein 1, alpha (HSPCA) AAGGTAACTTGGAGCAAGTTTTGTGAATGGAAATGTAGTGCTCAAGTCACATTCTGCTTC A_73_103159 A_73_103159 FALSE XM_589808 XM_589808 LOC512314 ref|XM_589808 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 52, subfamily L, member 1 (OR52L1) ACCTGCACTCAATCCTCTGGTCTATGGGGTGAAGACTCAGCAGATCCGCCAGCGAGTACT A_73_103160 A_73_103160 FALSE XM_868076 XM_868076 LOC616109 ref|XM_868076 unmapped Bos taurus similar to Homo sapiens ubiquinol- cytochrome c reductase complex (7.2 kD) (UCRC), transcript variant 1 GGCGTCCCCTGACAGACTCTTTAACTTCTGCTATGTTTGAAGTATGTTTAGTCAGAGTCA A_73_103161 A_73_103161 FALSE NM_001038221 NM_001038221 MGC133978 ref|NM_001038221 unmapped Bos taurus similar to Rho-associated protein kinase 1 (Rho-associated, coiled-coil containing protein kinase 1) (p160 ROCK-1) (p160ROCK) (MGC133978) AACCTTCCTATGAGGCTGTGAGCATCAAATACAAAGTATCTTCTAAACAAGTTAGTTTTG A_73_103162 A_73_103162 FALSE XM_603383 XM_603383 LOC525040 ref|XM_603383 unmapped Bos taurus similar to Homo sapiens interleukin 17 receptor A (IL17RA) GGTTCCGTCAAGGAAAACATGAAGATGGCACCAAAGACACAGAGATCCTGCCCGCCGCCA A_73_103163 A_73_103163 FALSE NM_001008670 NM_001008670 CRABP2 ref|NM_001008670 unmapped Bos taurus cellular retinoic acid binding protein 2 (CRABP2) TTTTCTGCAAGGGGACCCGAGGGCCTAAGTAGGAAAGACGGGCCCTCTGTCTTCCATTCT A_73_103164 A_73_103164 FALSE XM_614503 XM_614503 LOC541086 ref|XM_614503 unmapped Bos taurus similar to Homo sapiens mannosidase, alpha, class 2C, member 1 (MAN2C1) TGCATGCAGCGTCTGGATTGCAGCCCCCATGACAGAGACCCGGGATACTGGTAACCATAA A_73_103165 A_73_103165 FALSE XM_600205 XM_600205 LOC521932 ref|XM_600205 unmapped Bos taurus similar to Homo sapiens centrosomal protein 63kDa (CEP63), transcript variant 1 CTCTTGCTGACTTAAGTGTAATAGCTGTAGACTAATTAAAGATTTTACGATGCATGTTGG A_73_103166 A_73_103166 FALSE XM_599517 XM_599517 LOC521257 ref|XM_599517 unmapped Bos taurus similar to Homo sapiens histamine receptor H2 (HRH2) GTCATGTGCATTACGTACTACCGCATCTTCAGGATCGCCCGGGAACAGGCCAGGAGGATT A_73_103167 A_73_103167 FALSE NM_176650 NM_176650 ARHGDIA ref|NM_176650 unmapped Bos taurus Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA) GCCAGGCCTGCGGGGACAGCTCCAGGGGCTTGGGAAAAGCCAAATTGCCAAAATTCAAAA A_73_103168 A_73_103168 FALSE XM_585950 XM_585950 LOC509061 ref|XM_585950 unmapped Bos taurus similar to Homo sapiens chromosome 19 open reading frame 46 (C19orf46) CTATGTCAATGGTACCCCTCCAATGTGAGAATGCAGTCTAGTCATATGTAATAAATAGTC A_73_103169 A_73_103169 FALSE BI539277 BI539277 gb|Bos taurus similar to Homo sapiens chromosome 10 open reading frame 78 (C10orf78), transcript variant 2 unmapped Unknown TGCCTTGTTTTCACCCATTTATCACATGTTTATCTGGATGGTATAGCAGGTATTTAAACT A_73_103170 A_73_103170 FALSE CB434392 CB434392 gb|Unidentified transcripts unmapped Unknown ATATGTTGTCCAAAATGAAATTTACTGAAATGTTCAATCTGTGAGACTGCATACTCCTGG A_73_103171 A_73_103171 FALSE XM_580595 XM_580595 LOC504462 ref|XM_580595 unmapped Bos taurus similar to Homo sapiens gap junction protein, beta 4 (connexin 30.3) (GJB4) GTTTCTGGGTCCTGAGCCCCGGGGGAGGCAGGTTGATAGCTGATGGGGACTTTAGTATAT A_73_103172 A_73_103172 FALSE XM_600652 XM_600652 LOC522372 ref|XM_600652 unmapped Bos taurus similar to Homo sapiens SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 1 ACCAAGTTCAGGAAGTGGAATTGTCCTCCTGTAAACAGTGGCCAGATGTACTTCCCTTTT A_73_103173 A_73_103173 FALSE XM_613995 XM_613995 LOC534282 ref|XM_613995 unmapped Bos taurus similar to Homo sapiens hypothetical protein FLJ31951 (FLJ31951) TGTGGGATGTGACTTTATTTTATTTTTAGTAGCAGATTTGGATGTAGACTGACATAGCTG A_73_103174 A_73_103174 FALSE XM_870249 XM_870249 LOC617916 ref|XM_870249 unmapped Bos taurus similar to Homo sapiens transferrin receptor 2 (TFR2) GGCCCGGCATACCCGTTCCTGCACACAAAGGATGACACCTATGAGAACCTGCACAGAGTA A_73_103175 A_73_103175 FALSE NM_001034405 NM_001034405 MBD4 ref|NM_001034405 unmapped Bos taurus similar to Homo sapiens methyl-CpG binding domain protein 4 (MBD4) GGAAAACAGCAGGCAAATACGACGTACATTTTATCAGCCCACAGGGACAGAAGTTCAGAT A_73_103176 A_73_103176 FALSE XM_867062 XM_867062 LOC515018 ref|XM_867062 unmapped Bos taurus similar to Homo sapiens immunoglobulin superfamily containing leucine-rich repeat (ISLR), transcript variant 1 TTCCCCCACAACCTTGGGAGAGACTAGCCAGCCTGGGGGCGGCAGAGAAATAAATAGCAT A_73_103177 A_73_103177 FALSE XM_866100 XM_866100 LOC614557 ref|XM_866100 unmapped PREDICTED: Bos taurus similar to RWD domain containing protein 3 (LOC614557) TCTGCTAAAACGTTTTATAAGAATGGGACAGATGAATCATTAAAATGTTTCTGCGTGCAC A_73_103178 A_73_103178 FALSE XM_613870 XM_613870 LOC540957 ref|XM_613870 unmapped Bos taurus similar to Homo sapiens von Hippel- Lindau tumor suppressor (VHL), transcript variant 1 TTCTCTATGTTGAACAAAGATGTTGTGGTGTCTCAAAAGCTCTTTGGGCTTGTCAGGAGT A_73_103179 A_73_103179 FALSE EE909721 EE909721 gb|Unidentified transcripts on BTA17 position 41437485-41436759 unmapped Unknown TGCCTCTTTTAATGCTTCTAGCTTCAACTTCTCTTTTCCAAACATTATAATGGAAACCCC A_73_103180 A_73_103180 FALSE XM_864628 XM_864628 LOC613640 ref|XM_864628 unmapped PREDICTED: Bos taurus similar to Adapter- related protein complex 4 epsilon 1 subunit (Epsilon subunit of AP-4) (AP-4 adapter complex epsilon subunit) (LOC613640) TACATCAGAGCAAAGAAGAATATATTATCGTCAATTTGGTTGGAAAAATAGCTGAGCTGG A_73_103181 A_73_103181 FALSE XM_865780 XM_865780 LOC534252 ref|XM_865780 unmapped Bos taurus similar to Homo sapiens TBC1 domain family, member 15 (TBC1D15) CGAGTCTCAAAATAATGCTCTTTTGTATATGAATGAAGCTGTTGTTTTTACCATGCAGTG A_73_103182 A_73_103182 FALSE XM_610552 XM_610552 LOC532044 ref|XM_610552 unmapped Bos taurus similar to Homo sapiens mitochondrial ribosomal protein S22 (MRPS22), nuclear gene encoding mitochondrial protein TGTGTTACCAAATGGGTCAGTTGGTAATTTAAACAGAGCCCAGCTTAATGTGGTCAGGGG A_73_103183 A_73_103183 FALSE XM_600126 XM_600126 LOC521855 ref|XM_600126 unmapped Bos taurus similar to Homo sapiens hypothetical protein BC002770 (LOC92154) GGCCGGGGGGCCATGGAGGGGCGAGGGCTACAGTGTCTGGGTTAATCAGAGGCTCCACAG A_73_103184 A_73_103184 FALSE XM_587722 XM_587722 LOC510568 ref|XM_587722 unmapped Bos taurus similar to Homo sapiens exportin 1 (CRM1 homolog, yeast) (XPO1) CAAAACTCTGGCTTTTGAGATGACTTATACTAATTTACATTGTTTACCAAGCTGTAGTGC A_73_103185 A_73_103185 FALSE XM_600249 XM_600249 LOC521976 ref|XM_600249 unmapped PREDICTED: Bos taurus similar to dpy-19-like 3 (LOC521976) TGCCCAGCTACACAGCATACTTCACTAGAGTGTTCCAGAACAAAACATTCCACGTTTACA A_73_103186 A_73_103186 FALSE NM_001034365 NM_001034365 RBMS2 ref|NM_001034365 unmapped Bos taurus similar to Homo sapiens RNA binding motif, single stranded interacting protein 2 (RBMS2) ACATGGTGCCTGGAACTTCTTCCCTTCTTTGTGAAAAACCATTTTTGATGTGTTGGACTT A_73_103187 A_73_103187 FALSE XM_608111 XM_608111 LOC529657 ref|XM_608111 unmapped PREDICTED: Bos taurus similar to FOXD4-like 2 (LOC529657) GAGAGGGGACCTCGCCGGCCTTTCGAATAGTACCTACACCTGTCCCGGAGCTGACTCAGT A_73_103188 A_73_103188 FALSE XM_609737 XM_609737 LOC531250 ref|XM_609737 unmapped Bos taurus similar to Homo sapiens zinc finger protein, subfamily 1A, 5 (ZNFN1A5) GTGGGTGCAAATGTAAAAACAAGTATGATTTTGCCTGTCATTTTGCAAGAGGGCAACATA A_73_103189 A_73_103189 FALSE XM_869364 XM_869364 LOC616187 ref|XM_869364 unmapped Bos taurus similar to Homo sapiens ring finger protein 5 (RNF5) TCTCAAGTGCTTCCCTCCCCTCACTACCTCCTTTATGATAAATTCAATAAACATGGTAAG A_73_103190 A_73_103190 FALSE XM_870816 XM_870816 LOC618483 ref|XM_870816 unmapped Bos taurus similar to Homo sapiens hypothetical gene supported by AK092637 (LOC440087) ATCATCATGCCATTACTGAGGTCACCAACACAGTGAAACATCAAACAAGTGTCAATCAGC A_73_103191 A_73_103191 FALSE XM_615523 XM_615523 LOC541292 ref|XM_615523 unmapped Bos taurus similar to Homo sapiens serologically defined colon cancer antigen 1 (SDCCAG1) GGAATAGTGAAGTGGCTCAACTGGTTAGACTGTTGACTCGGTAGTCTGCTGTACATAACA A_73_103192 A_73_103192 FALSE NM_181338 NM_181338 UGALT2 ref|NM_181338 unmapped Bos taurus UDP-galactose translocator 2 (UGALT2) TCCACTCCAAGAATATTTAAGTTATTTTCTCCAACAGTGACATCTCTTGGGAAAACGGAC A_73_103193 A_73_103193 FALSE XM_583692 XM_583692 LOC507133 ref|XM_583692 unmapped PREDICTED: Bos taurus similar to Collagen alpha 1(VII) chain precursor (Long-chain collagen) (LC collagen) (LOC507133) AGCTGTTACAGGGTTGAGATCAAGGTCACAGGGCACGCCTCAAGCAGGGCCCCTGGAGGT A_73_103194 A_73_103194 FALSE XM_588870 XM_588870 LOC539703 ref|XM_588870 unmapped Bos taurus similar to Homo sapiens pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 4 CTCACAAAAATACAGTATAACATGTACTATGATTGAGGAATATGCTGCATACTTTGGAGC A_73_103195 A_73_103195 FALSE XM_616597 XM_616597 LOC536465 ref|XM_616597 unmapped PREDICTED: Bos taurus similar to CLIP- associating protein 2 (LOC536465), partial mRNA. GATCTTAGATCCCAAGTGGTTAGAGAAGCTTGCATTACTGTAGCCAATTGTCCTCGAATT A_73_103196 A_73_103196 FALSE XM_598513 XM_598513 LOC520275 ref|XM_598513 unmapped Bos taurus similar to Homo sapiens caspase recruitment domain family, member 4 (CARD4) ACTCGACCTGGACAACAACAACCTCAACGACTTCGGCGTGCGTGAACTGCAGCCATGCTT A_73_103197 A_73_103197 FALSE XM_590061 XM_590061 LOC512525 ref|XM_590061 unmapped Bos taurus similar to Homo sapiens EF-hand domain family, member A1 (EFHA1) TCCTACCTGTCCCTTATGTCTCACAGACTTCTTGTATATTTTATTTCAAATGAGCTGTAA A_73_103198 A_73_103198 FALSE AW447083 AW447083 gb|Bos taurus similar to Homo sapiens chromosome 14 open reading frame 44 (C14orf44) unmapped Unknown GTAAAGGCATTGGACTGAAATTGGAAAAATGATCTGTTTCATATTGAAGGAATCTAGACC A_73_103199 A_73_103199 FALSE XM_587261 XM_587261 LOC539454 ref|XM_587261 unmapped Bos taurus similar to Homo sapiens glial cells missing homolog 2 (Drosophila) (GCM2) CAGAGGCCTGGGAAGTGTGTTCCTCCAGACTGGGGTCTGCAGCCAACTATTCAGATCGAA A_73_103200 A_73_103200 FALSE XM_586141 XM_586141 LOC509227 ref|XM_586141 unmapped Bos taurus similar to Homo sapiens fyn-related kinase (FRK) TTTCTTTTAAGCAGTTGGTTTATCAAGTTTTGTGCCTCATTAGATAAGTGTAGAGAGTCC A_73_103201 A_73_103201 FALSE XM_608437 XM_608437 LOC529975 ref|XM_608437 unmapped PREDICTED: Bos taurus similar to Reticulon 4 receptor precursor (Nogo receptor) (NgR) (Nogo-66 receptor) (LOC529975) GAGAAGCCCAAACCCATGGCCACGAGGATTCCTTTCAGATCCTCCCCAGGGGCCAAGGTG A_73_103202 A_73_103202 FALSE CB441250 CB441250 gb|Unidentified transcripts on BTA18 position 48877786-48879394 unmapped Unknown CCAGTACCATACCTGTTTGTATTATGTTCCATGCATTCACCAGCGTTCAGTAAAGATTCC A_73_103203 A_73_103203 FALSE XM_878210 XM_878210 LOC520924 ref|XM_878210 unmapped Bos taurus similar to Homo sapiens nucleoporin 205kDa (NUP205) CTTTCTTTATATATGGACTTCTTTTCTGTAAACTTCTTTGCCTGGTGCCGTGCTCACTAG A_73_103204 A_73_103204 FALSE XM_867728 XM_867728 LOC615821 ref|XM_867728 unmapped Bos taurus similar to Homo sapiens hypothetical protein dJ122O8.2 (DJ122O8.2) ACACACCCGGTATTTTGAAAATGTTTTTGGATGTGTCAGCAGTATTTTGTAAGAAGCAAA A_73_103205 A_73_103205 FALSE CB421728 CB421728 gb|Unidentified transcripts unmapped Unknown AACTATTGCTTTTGGGTAACTCACCATTTCATTAAAGATTTTTAACTTTAAAAACAAAAA A_73_103206 A_73_103206 FALSE XM_610350 XM_610350 LOC531847 ref|XM_610350 unmapped Bos taurus similar to Homo sapiens neuroligin 4, Y-linked (NLGN4Y) ACAGACTATTCAGTTACATACCTAGAGTTCTGTGCAAAGAGATGTTTTGCCAGCCTGAAC A_73_103207 A_73_103207 FALSE NM_174786 NM_174786 GUCA1B ref|NM_174786 unmapped Bos taurus guanylate cyclase activator 1B (GUCA1B) GGGGTAGGGGTTCCATAGATGAAATTAGAAATGAAAAGGCCACACAGTGTGAAACTGACT A_73_103208 A_73_103208 FALSE XM_870935 XM_870935 LOC618601 ref|XM_870935 unmapped Bos taurus similar to Homo sapiens unc-51-like kinase 2 (C. elegans) (ULK2) GTATGTGTGAAACCCTGCAGTCTGAACAGCAGAAAACAAACTGTAAATGCAGGAATAATG A_73_103209 A_73_103209 FALSE XM_590571 XM_590571 LOC539968 ref|XM_590571 unmapped Bos taurus similar to Homo sapiens leucine rich repeat neuronal 6C (LRRN6C) AATGCCCAACTCTGTTAACTTCTGTTACTATAAATAAAGGCATGTGCCTAGTTTTGATAC A_73_103210 A_73_103210 FALSE NM_175777 NM_175777 GNB1 ref|NM_175777 unmapped Bos taurus GNB1 protein (GNB1) AATTTTAAAGTCAATGTACTGCAAGGAAGCTGGATGCAAGATAGATCCTATATTCAACTG A_73_103211 A_73_103211 FALSE XM_607327 XM_607327 LOC528891 ref|XM_607327 unmapped PREDICTED: Bos taurus similar to Factor in the germline alpha (Transcription factor FIGa) (FIGalpha) (LOC528891) TAGAGAGCTATCGAGAATTATACAACGTGCCGGCTGTGCTATGGGCTTGAAGAATGAGAA A_73_103212 A_73_103212 FALSE CB459504 CB459504 gb|Unidentified transcripts on BTA24 position 7005983-7008493 unmapped Unknown TGTGTTCCATTTGTACTGAGAACACCACAGAGTGAATTATCCAAAGTCCATTGATTTTAA A_73_103213 A_73_103213 FALSE XM_865192 XM_865192 LOC613947 ref|XM_865192 unmapped Bos taurus similar to Homo sapiens ectodysplasin A receptor (EDAR) GGCTACAGCATCCCCGAGCTTCTCACCAAGCTGGTGCAGATTGAGCGGCTGGACGCTGTA A_73_103214 A_73_103214 FALSE XM_583573 XM_583573 LOC507029 ref|XM_583573 unmapped Bos taurus similar to Homo sapiens olfactory receptor, family 52, subfamily E, member 4 (OR52E4) CCTTAACCCAGTCATCTATGGAGTCAGGACAAAGCAAATCCGAGAGCGGGTTGTAAAAAT A_73_103215 A_73_103215 FALSE XM_867506 XM_867506 LOC615644 ref|XM_867506 unmapped Bos taurus similar to Homo sapiens pseudouridylate synthase 7 homolog (S. cerevisiae) (PUS7) CTGGTGTTCTGTGTTTATCCACCTTTTCTGTGCTTAGGCCACACCACGCCTTCCTTTTTT A_73_103216 A_73_103216 FALSE XM_868713 XM_868713 LOC616640 ref|XM_868713 unmapped PREDICTED: Bos taurus similar to Tetratricopeptide repeat protein 7A (TPR repeat protein 7) (LOC616640) ATGAAGTTTGCATTTGGAGAATTTCACCTCTGGTACCAGGTGGCCCTGTCCATGGTGGCC A_73_103217 A_73_103217 FALSE XM_866033 XM_866033 LOC614500 ref|XM_866033 unmapped PREDICTED: Bos taurus similar to putative membrane protein Re9 (LOC614500) ACCAATCTCTGGCCACAAATGGATGGATGATGACAAAAATGATATTCTGTTTGTTACCAC A_73_103218 A_73_103218 FALSE XM_615317 XM_615317 LOC541256 ref|XM_615317 unmapped PREDICTED: Bos taurus similar to SRY-box 7 (LOC541256) AGCCTCATTTCCGTGCTGGCTGATGCCACGGCCACGTACTACAACAGCTACAGTGTGTCA A_73_103219 A_73_103219 FALSE NM_001034621 NM_001034621 MGC128514 ref|NM_001034621 unmapped Bos taurus similar to Homo sapiens transcription factor 4 (TCF4) CCATCCAACGAGAAAATTGCAAGTAGTGTGACAGAGCTGATTGATTTTGTTGCTTTCTTG A_73_103220 A_73_103220 FALSE XM_864456 XM_864456 LOC540170 ref|XM_864456 unmapped Bos taurus similar to Homo sapiens pumilio homolog 2 (Drosophila) (PUM2) ATAACAGCATGAAGTTTGGGGTGCCAGGCATAGTTTTTCATGTTTGATGTTGAGTTATTC A_73_103221 A_73_103221 FALSE XM_869448 XM_869448 LOC504476 ref|XM_869448 unmapped Bos taurus similar to Homo sapiens actin-like 6B (ACTL6B) CTTTTGTTCCCCTCCCCACTTGTCCTCTTGATTGTGAAGTTTCCGGGTTAAATGGAGTAA A_73_103222 A_73_103222 FALSE XM_865292 XM_865292 LOC535219 ref|XM_865292 unmapped Bos taurus similar to Homo sapiens cullin 2 (CUL2) AAATCCGGCTGGGTACCATGCTTTTTCTCCCCTTCACGTTTGCAGTTGATGTGTTTGTTT A_73_103223 A_73_103223 FALSE XM_877416 XM_877416 LOC540410 ref|XM_877416 unmapped Bos taurus similar to Homo sapiens G protein- coupled receptor 162 (GPR162), transcript variant A-2 TCCCATCCCAGTCACCAGATACCTGCCTCACCTGCCATCCTCCCTAGCAAAATGTATTAA A_73_103224 A_73_103224 FALSE XM_615084 XM_615084 LOC535092 ref|XM_615084 unmapped Bos taurus similar to Homo sapiens myosin VIIA (MYO7A) AGAAAAGCATTTAATCCTGGTGCTGGTGCCCTCCGTAGACAGGCCAGTCCCCCTGAGCAT A_73_103225 A_73_103225 FALSE XM_869904 XM_869904 LOC617609 ref|XM_869904 unmapped Bos taurus similar to Homo sapiens protein-O-mannosyltransferase 1 (POMT1) CTCCGCCAGCCTTGCCACCCTGGTGTACGCCCTGCTGTTCATCTGGTACCTGCCTTTTTT A_73_103226 A_73_103226 FALSE XM_883240 XM_883240 LOC510442 ref|XM_883240 unmapped Bos taurus similar to Homo sapiens DOT1-like, histone H3 methyltransferase (S. cerevisiae) (DOT1L) CTCGCTGGGGCCCAGCTCCAGCCTGTACTGTCCATAGTTTTAGATAAAGTATTTATCATT A_73_103227 A_73_103227 FALSE NM_174458 NM_174458 SCN5A ref|NM_174458 unmapped Bos taurus sodium channel, voltage-gated, type V, alpha polypeptide (long (electrocardiographic) QT syndrome 3) (SCN5A) GGGTCTGGTCCGGCAACGCTCTGGGGCTCTGACCACCACCTCCATCCCAGCTGCTGAGGC A_73_103228 A_73_103228 FALSE BM287508 BM287508 gb|Unidentified transcripts on BTA11 position 65387188-65388011 unmapped Unknown GCTCCAAAACCTCCGAGATAAAGTTAAGACCAAAAGTTGCTTGTTTCCTCACACCTGATT A_73_103229 A_73_103229 FALSE AW326461 AW326461 gb|Bos taurus similar to Homo sapiens aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) (AKR7A2) unmapped Unknown GCCTGACAGCCTCCGGTCCCAGCTGGAGACGTCACTGCAGCGGCTGCAGTGCCCCCGGGT A_73_103230 A_73_103230 FALSE XM_593623 XM_593623 LOC515582 ref|XM_593623 unmapped Bos taurus similar to Homo sapiens E3 ubiquitin protein ligase, HECT domain containing, 1 (EDD1) AAACCAATTTTGGGAGGCGAAAACCAAAATTGACCTTTCCGGAGGGTTTAAAAAGTTTGG A_73_103231 A_73_103231 FALSE XM_584307 XM_584307 LOC507654 ref|XM_584307 unmapped Bos taurus similar to Homo sapiens ADAMTS-like 4 (ADAMTSL4) TTGCGTGCTGTATGTTAAGAGGAGAAACTTAGCAAAATACTTAGAAGTGTCCCCTGAGCC A_73_103232 A_73_103232 FALSE NM_001014884 NM_001014884 SUI1 ref|NM_001014884 unmapped Bos taurus similar to Eukaryotic translation initiation factor 1 (eIF1) (Protein translation factor SUI1 homolog) (Sui1iso1) (SUI1) TTGCAGCTTACTGGCAACAGCTGCCCAATGCCGTGTGAAGTAAACTGGTTTTTTGGTTTT A_73_103233 A_73_103233 FALSE BM105035 BM105035 gb|Unidentified transcripts on BTA19 position 18574394-18573535 unmapped Unknown ACAGTGCCTAGCACAATGCTTGGCACATGGGTGCTGAATAAATACTCTATTGATCCGCAA A_73_103234 A_73_103234 FALSE XM_582427 XM_582427 LOC506037 ref|XM_582427 unmapped Bos taurus similar to Homo sapiens unc-5 homolog A (C. elegans) (UNC5A) ACTTACACTTGGCCTTATGTACACAGCCTTGCCCGGCCGCCAGGGCACGTAGGGATTTTA A_73_103235 A_73_103235 FALSE XM_581880 XM_581880 LOC505573 ref|XM_581880 unmapped Bos taurus similar to Homo sapiens ClpX caseinolytic peptidase X homolog (E. coli) (CLPX) ACATCACATTGATTTATACAGACTGACATTACATGGACTTTAATGACACAATGTTCCGAG A_73_103236 A_73_103236 FALSE BM255969 BM255969 gb|Bos taurus similar to PREDICTED: Homo sapiens zinc finger protein 516 (ZNF516) unmapped Unknown TGGAAATTGAAATCAAGAACTCCAAGATGTTTTTATTGATTTCAATTTCCAATAAAAACA A_73_103237 A_73_103237 FALSE XM_597527 XM_597527 LOC519311 ref|XM_597527 unmapped Bos taurus similar to Homo sapiens protein tyrosine phosphatase domain containing 1 (PTPDC1), transcript variant 1 AGATGCTCTCGGTTTGTGCTCAGAAATGCTTGTTCCTGTTTGGAGCAATTATTTATTTTA A_73_103238 A_73_103238 FALSE XM_593561 XM_593561 LOC515527 ref|XM_593561 unmapped Bos taurus similar to PREDICTED: Homo sapiens similar to fasting-inducible integral membrane protein TM6P1 isoform 1 (LOC284417) GCCACCCAGGAAGCGAGAGGCCAAGGCCAGCCAGCCATCCCTGATCAAGGATATTTATTA A_73_103239 A_73_103239 FALSE NM_001015516 NM_001015516 CCDC98 ref|NM_001015516 unmapped Bos taurus coiled-coil domain containing 98 (CCDC98) GGTGAAAAAGCCCATTAGGTGGGACTCAAATGATACATATAAATAAATATGGATGATGTC A_73_103240 A_73_103240 FALSE EE914885 EE914885 gb|Unidentified transcripts on BTA26 position 7104726-7105860 unmapped Unknown ATTAGGAGGTGAAACAAAGTTATTTCAACATCAACTCTAGATGTGGGTCCTCTTGATCTA A_73_103241 A_73_103241 FALSE AW479491 AW479491 gb|Bos taurus similar to Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1) unmapped Unknown CATGTAAACTGCCATTTCCTTGGTAGTAAAATGGGGATAATAATTATGCCACCTTAAGGT A_73_103242 A_73_103242 FALSE XM_587157 XM_587157 LOC510065 ref|XM_587157 unmapped Bos taurus similar to Homo sapiens acyl- Coenzyme A oxidase 3, pristanoyl (ACOX3) TTGCACCGTGGACCACCCGAATGGCATAGTTAAAGATTTTGAAGGAAAATAAAATCAGTT A_73_103243 A_73_103243 FALSE XM_608632 XM_608632 LOC530167 ref|XM_608632 unmapped PREDICTED: Bos taurus similar to Rho guanine nucleotide exchange factor (GEF) 19 (LOC530167) CCGCATTACTCTAGGAAAAGATCCTGGCAAAACATTGGCCTTTCTCTCGGGCACATCCCT A_73_103244 A_73_103244 FALSE XM_583634 XM_583634 LOC507080 ref|XM_583634 unmapped Bos taurus similar to Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class L (PIGL) CAGTGTCTGTGAACTCCCTAACACAGACCTGCGATTATTATAAATAAACGTAAAGGTCTC A_73_103245 A_73_103245 FALSE XM_614733 XM_614733 LOC534832 ref|XM_614733 unmapped Bos taurus similar to Homo sapiens kinesin family member 13A (KIF13A) ATTCTTCTGCTGGAGAACTTTCAAGTAGGAGGAACCTACCAAATACAGCGGACAGTAGGA A_73_103246 A_73_103246 FALSE NM_174716 NM_174716 ANXA2 ref|NM_174716 unmapped Bos taurus annexin A2 (ANXA2) AGGATTTGGAAGTGGAATCTATGATGTGAAACACTTTGCCTCTCGAGTACTGTGTCATAA A_73_103247 A_73_103247 FALSE XM_585092 XM_585092 LOC508330 ref|XM_585092 unmapped Bos taurus similar to Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) (MLL) GGCATACAGTGCATCTCAGTAGCTCTAGTTAAAGAGTAACACTTCTCCTTCGGGAATTTA A_73_103248 A_73_103248 FALSE NM_001035272 NM_001035272 SFRS6 ref|NM_001035272 unmapped Bos taurus similar to Homo sapiens splicing factor, arginine/serine-rich 6 (SFRS6) TTTCTCCCACTTTGTTAACCTATTTTGTGCTTTATTGCCTCAATAAAATGTTCACTGAGG A_73_103249 A_73_103249 FALSE XM_592265 XM_592265 LOC514420 ref|XM_592265 unmapped Bos taurus similar to Homo sapiens GCN5 general control of amino-acid synthesis 5-like 2 (yeast) (GCN5L2) TGCACTGTTCTGTTTGTCCCCTAGGGGTAGGGGGCATGGGGACCATTCATTTCCTGGCAT A_73_103250 A_73_103250 FALSE CB436170 CB436170 gb|Unidentified transcripts on BTA17 position 32207079-32209510 unmapped Unknown TGGAAGGCATACAATGATTTGCAATATGACGGAAATGCTCCCCGTGACTTCCTCTTCTCT A_73_103251 A_73_103251 FALSE AU231684 AU231684 gb|Bos taurus similar to Homo sapiens heparan sulfate proteoglycan 2 (perlecan) (HSPG2) unmapped Unknown ACGCCTGGCCCCTGTGTCCTAGAAGGGGCCCTCCTGTGGTCTTTGTCTTGATCTTTCTTA A_73_103252 A_73_103252 FALSE XM_591336 XM_591336 LOC513626 ref|XM_591336 unmapped Bos taurus similar to Homo sapiens Fanconi anemia, complementation group M (FANCM) TGATCAGACTGCTCAGGTTGGGTTATCAGAGAACGATACAAAATGCACTTCAATAATCAT A_73_103253 A_73_103253 FALSE CB445636 CB445636 gb|Bos taurus similar to PREDICTED: Homo sapiens similar to hypothetical protein, MGC:7199 (LOC389850) unmapped Unknown TCTTCCTGTGTGATGGTACCGTGCGTAGAGTCAAATCCTTGTGATGTTTTGTATGGCGTA A_73_103254 A_73_103254 FALSE XM_583527 XM_583527 LOC538901 ref|XM_583527 unmapped Bos taurus similar to Homo sapiens KTI12 homolog, chromatin associated (S. cerevisiae) (KTI12) GTCACAGATGGATCCACTGGTTTCTGTCCTTGGGAAGCTTTGGTTCTAGTGGAATTGAAA A_73_103255 A_73_103255 FALSE XM_593741 XM_593741 LOC515676 ref|XM_593741 unmapped PREDICTED: Bos taurus similar to CG33196-PB (LOC515676) TGTTGAATTCTGGCAATTGTTTGATGATTCATGGCGTGACTGCTTCTAAAATTATCTTGT A_73_103256 A_73_103256 FALSE NM_173973 NM_173973 ZP2 ref|NM_173973 unmapped Bos taurus zona pellucida glycoprotein 2 (sperm receptor) (ZP2) TGCGCAAGAAAAGAATCACAGTGCTAAACCACTAATTGGATTTTCAATAAAATGTGGAAG A_73_103257 A_73_103257 FALSE XM_586422 XM_586422 LOC509460 ref|XM_586422 unmapped Bos taurus similar to Homo sapiens THUMP domain containing 2 (THUMPD2) GGCTCACCATCAAGTGTATCTCACTCATCACAAATTTGATACTGTCTTCATTGTCAGGTT A_73_103258 A_73_103258 FALSE XM_602602 XM_602602 LOC524280 ref|XM_602602 unmapped PREDICTED: Bos taurus similar to neurobeachin- like 1 (LOC524280) GCTTTGATTTCAAGTGGCCTCACTCTCAAGTTCGAGAGATTCACCTACGACGGTACAATT A_73_103259 A_73_103259 FALSE XM_583424 XM_583424 LOC538878 ref|XM_583424 unmapped Bos taurus similar to Homo sapiens zinc finger protein 70 (ZNF70) GGCCTTCCGCCACCGCTCGGCGCTCATCGAGCACTACAAGACGCACACGCGCGAGCGGCC A_73_103260 A_73_103260 FALSE XM_594206 XM_594206 LOC516070 ref|XM_594206 unmapped Bos taurus similar to PREDICTED: Homo sapiens discs, large (Drosophila) homolog-associated protein 3 (DLGAP3) CCCAGCTGCTGGGGAGGGGAGATGGGGGCTTCCCCTCACCACACCTGTGGCTGTTCCCAC A_73_103261 A_73_103261 FALSE XM_873041 XM_873041 LOC539976 ref|XM_873041 unmapped Bos taurus similar to Homo sapiens leucine proline-enriched proteoglycan (leprecan) 1 (LEPRE1) AAGCCCAGAACCACTCTTGGGGGCCCACACAGGCAGCCACGTGACAGCAATACAGTATTT A_73_103262 A_73_103262 FALSE AV665830 AV665830 gb|Unidentified transcripts unmapped Unknown ATATGAATAATAAAGACCGTTGACTAAAATAACATGAAAAGCTCCCACACACAAGTGTGC A_73_103263 A_73_103263 FALSE XM_867634 XM_867634 LOC615745 ref|XM_867634 unmapped PREDICTED: Bos taurus similar to glucan (1,4-alpha-), branching enzyme 1 (LOC615745) GGGATAGTCGGTTATTTGCCTACGCCAGGTATATTAAAAGTGGCAGGGTGTCAAGTAATG A_73_103264 A_73_103264 FALSE NM_174394 NM_174394 MYO10 ref|NM_174394 unmapped Bos taurus myosin X (MYO10) TTGCCTTATCCCTATGGATAGCCATGCGGAATCATTGTTTCTTGGCTCAAGAAAGTCTGA A_73_103265 A_73_103265 FALSE XM_610891 XM_610891 LOC532376 ref|XM_610891 unmapped Bos taurus similar to Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) (MAFB) TGCATTGGAAACGAGCTTCGGTTTTTACAGATTCAACTGTGTTGAAATCAAATTTGCCAC A_73_103266 A_73_103266 FALSE NM_001014881 NM_001014881 SUMF2 ref|NM_001014881 unmapped Bos taurus sulfatase modifying factor 2 (SUMF2) CATGGTGTCACTGGGTATTGTGGGGTCAGTAAAAATCACCTGTGTGATTCTCAGACTGTT A_73_103267 A_73_103267 FALSE CB447649 CB447649 gb|Bos taurus similar to Homo sapiens mitochondrial ribosomal protein L35 (MRPL35), nuclear gene encoding mitochondrial protein, transcript variant 1 unmapped Unknown TCTCAGCTCTCCCATCAGAATCATCTGGAAAGCACTTTGAAACAGCAGAGCATTTTGCCT A_73_103268 A_73_103268 FALSE EE910093 EE910093 gb|Unidentified transcripts on BTA24 position 20786436-20785707 unmapped Unknown CTAGTGAAATACACGTGGGCTTGACTTCTGTTCATTAACTGGACCAATTTTTTCCCTAAC A_73_103269 A_73_103269 FALSE XM_866186 XM_866186 LOC535487 ref|XM_866186 unmapped Bos taurus similar to Homo sapiens inositol polyphosphate-4-phosphatase, type I, 107kDa (INPP4A), transcript variant a TTCATAGAAAATTATGTTTGGTCATCTATTCTAAGATGATGAGTCATCTGCACAGAGCAG A_73_103270 A_73_103270 FALSE XM_584965 XM_584965 LOC508218 ref|XM_584965 unmapped Bos taurus similar to Homo sapiens chromosome 9 open reading frame 86 (C9orf86) CTTTTCTGGGCGGCGGGGCGCCTAGCGGCCCCCTCCGGGGCGGCGGCGACTACGAAGCGC A_73_103271 A_73_103271 FALSE XM_581176 XM_581176 LOC504970 ref|XM_581176 unmapped Bos taurus similar to Homo sapiens similar to RIKEN cDNA A730055C05 gene (LOC388335) ATAAACATGGGTGTAACAAGCTGACTTCCTAGGAATTTATTTCAGTTACTACTAGAGATG A_73_103272 A_73_103272 FALSE XM_865204 XM_865204 LOC514201 ref|XM_865204 unmapped Bos taurus similar to Homo sapiens sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II) (SMPD3) TCTTTGTATCTCTTCTCAAGCTTCGTCCAGGGTTCATTATTTCTGTCTGCTGCCACGTTG A_73_103273 A_73_103273 FALSE NM_001040579 NM_001040579 JPH2 ref|NM_001040579 unmapped Bos taurus similar to Homo sapiens junctophilin 2 (JPH2), transcript variant 1 GGCTTGCTTGGCAGGAGCCGGTCTTTGCATGTAGCCCCTTTCCAATGTGCTGTGTACCAT A_73_103274 A_73_103274 FALSE NM_001035032 NM_001035032 TXNDC4 ref|NM_001035032 unmapped Bos taurus similar to Homo sapiens thioredoxin domain containing 4 (endoplasmic reticulum) (TXNDC4) TTTTTTCATTGTAAAATTGTTAAGGAGGACCCTGCGTCCTCTAGATTCCCTGATTTCCTA A_73_103275 A_73_103275 FALSE XM_602084 XM_602084 LOC523780 ref|XM_602084 unmapped PREDICTED: Bos taurus similar to Heparan sulfate 2-O-sulfotransferase 1 (2-O-sulfotransferase) (2OST) (LOC523780), partial mRNA. CCACAACTTGGATTGTTGATGGGTATATAAGACACTTTGCGTTAGGGTACAGACAGTGAC A_73_103276 A_73_103276 FALSE XM_580689 XM_580689 LOC504548 ref|XM_580689 unmapped PREDICTED: Bos taurus similar to Ubiquitin- like protein FAT10 (Diubiquitin) (LOC504548) TCTCATATGACTCAATAATCATTGAGTCAAACTGACACTCTGCCTGTAGACAATAGTGAA A_73_103277 A_73_103277 FALSE XM_597528 XM_597528 LOC519312 ref|XM_597528 unmapped PREDICTED: Bos taurus similar to trinucleotide repeat containing 6A isoform 2 (LOC519312) CAACCAGCATTCCAGTGACAGTGCAAATGGCAACGGTAAGAAGTTTACAAACGGATGGAA A_73_103278 A_73_103278 FALSE NM_174532 NM_174532 DNAJB6 ref|NM_174532 unmapped Bos taurus DnaJ (Hsp40) homolog, subfamily B, member 6 (DNAJB6) TGGTTTAATGTGCATTGAGGATGTTTTCCAGTTGTGCATGAATGCTGGCAACTTAGTAAG A_73_103279 A_73_103279 FALSE XM_593003 XM_593003 BOP1 ref|XM_593003 unmapped Bos taurus similar to Homo sapiens block of proliferation 1 (BOP1) ACCCAGCCTTGGGTCTTCTCCTCCGGGGCTGATGGCACTCTCCGCCTCTTCACTTAGACA A_73_103280 A_73_103280 FALSE NM_001024493 NM_001024493 TRPV2 ref|NM_001024493 unmapped Bos taurus transient receptor potential cation channel, subfamily V, member 2 (TRPV2) TTTTCTTGTGGCTAACTCTCCTGGAAACGTTAGTTGAGTAAAGGTATTGGGCCCTTGCCC A_73_103281 A_73_103281 FALSE BG223795 BG223795 gb|Bos taurus similar to Homo sapiens sarcolipin (SLN) unmapped Unknown TCCAACCCACACTCAGCAACCAAACTCTAAATCAACCTGCCAGAAGAAAGAAATGTTAAA A_73_103282 A_73_103282 FALSE EE907689 EE907689 gb|Unidentified transcripts on BTA19 position 37506932-37506024 unmapped Unknown AACATGTCAGGCAGTTCTGACAGAGTGGCGCCTAAAAAGTGTGATGTGGAACCAGAAATT A_73_103283 A_73_103283 FALSE XM_589381 XM_589381 LOC511952 ref|XM_589381 unmapped Bos taurus similar to Homo sapiens tripartite motif-containing 16 (TRIM16) TTTCCTTGTGGTTTCCAGATCTTTTACCCCTCTGATCACTTTCTCTTCCTTTCAACAGAT A_73_103284 A_73_103284 FALSE NM_001038027 NM_001038027 ENPEP ref|NM_001038027 unmapped Bos taurus similar to Homo sapiens glutamyl aminopeptidase (aminopeptidase A) (ENPEP) AACAAAACAGGGACACCATAAGAAACTGGTTTCTTGATTTGAATGGTTAATGTGTCCAAA A_73_103285 A_73_103285 FALSE BI534914 BI534914 gb|Bos taurus similar to Homo sapiens G patch domain containing 4 (GPATC4), transcript variant 2 unmapped Unknown GAGAGCATCAGAAAAAGCAAGAAGAAGAAAAGACAGCATCAAGAAGAAAGAGTCACAGAT A_73_103286 A_73_103286 FALSE XM_592503 XM_592503 LOC514623 ref|XM_592503 unmapped Bos taurus similar to Homo sapiens KIAA0133 (KIAA0133) GTGTGCAAAATCCTTTGGGGTTTATAAAATATGTATTGCCTTTTACACTGATTTTTTCAC A_73_103287 A_73_103287 FALSE XM_583856 XM_583856 LOC507274 ref|XM_583856 unmapped Bos taurus similar to Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kDa) (XRCC5) TTGCAGAATGAGTGCACACAGTTATAAGGGATAGTTTAGACCCCATACTTGTTTATAAAG A_73_103288 A_73_103288 FALSE BM087726 BM087726 gb|Bos taurus similar to Homo sapiens zinc finger protein 687 (ZNF687) unmapped Unknown CAGTGGGGGAAATGGGAGGGAGAAAACCAGACCATTAAAACTGCTCGTGGTTTAATCCCC A_73_103289 A_73_103289 FALSE BM105758 BM105758 gb|Bos taurus similar to Homo sapiens hypothetical protein MGC39715 (MGC39715) unmapped Unknown CTGATGGACTGCAGAACAGCTGTAGATCTGATCTACATGCAGGCAATACAGGACATTGAA A_73_103290 A_73_103290 FALSE NM_001034384 NM_001034384 NOL7 ref|NM_001034384 unmapped Bos taurus similar to Homo sapiens nucleolar protein 7, 27kDa (NOL7) TGCCAAGAGGTTTACAAAACGCTGGATGGTCAGAAAGATGAAAACTCCTAAGACGTAAAT A_73_103291 A_73_103291 FALSE XM_618555 XM_618555 LOC538352 ref|XM_618555 unmapped Bos taurus similar to Homo sapiens Sp4 transcription factor (SP4) CAGGCACAAAGAGGTTGAGCTTGTTATTCATGTCGGTCCCCTTCATCTCACTTCAGTTTT A_73_103292 A_73_103292 FALSE AF451179 AF451179 gb|Bos taurus similar to Homo sapiens pleckstrin homology domain containing, family Q member 1 (PLEKHQ1) unmapped Unknown GAGGAGGATGGCATTCCATGTCTTCTGCTTATGAAGCGCCTTTCTTGAAGTTTGGCAATA A_73_103293 A_73_103293 FALSE XM_871496 XM_871496 LOC619174 ref|XM_871496 unmapped PREDICTED: Bos taurus similar to Insulin-like growth factor 1 receptor precursor (Insulin-like growth factor I receptor) (CD221 antigen) (LOC619174), partial mRNA. ACAACTACGCCCTGGTCATCTTCGAGATGACCAACCTCAAGGACATCGGGCTCTACAACC A_73_103294 A_73_103294 FALSE CB532669 CB532669 gb|Bos taurus similar to Homo sapiens DC2 protein (DC2) unmapped Unknown ACATCGTTTCAGATATATATGGAAGACTGTTTCAGGAACAATAAGATGTATGAAAGGAGC A_73_103295 A_73_103295 FALSE NM_001035333 NM_001035333 NEDD1 ref|NM_001035333 unmapped Bos taurus similar to Homo sapiens neural precursor cell expressed, developmentally down-regulated 1 (NEDD1) TCCCAAAGATTTAAAATATACCTTGTATATAGCACTCCTGCTCAATTTTAACTTTTGAGA A_73_103296 A_73_103296 FALSE XM_596938 XM_596938 LOC518738 ref|XM_596938 unmapped Bos taurus similar to Homo sapiens G patch domain containing 1 (GPATC1) TGTTAGTGTCAGAGAAAGAAATTCAGACTGTACAGTTTAATTAAAATGGCATTTTCATAA A_73_103297 A_73_103297 FALSE XM_590748 XM_590748 LOC513110 ref|XM_590748 unmapped Bos taurus similar to Homo sapiens amino acid transporter (FLJ10815) CATTCAAGCCAAACTCTCTGAGATGGAGGAAGTCAAGCCAGCCAGCTGGTGGGCGATGGT A_73_103298 A_73_103298 FALSE NM_001035284 NM_001035284 MGC127578 ref|NM_001035284 unmapped Bos taurus similar to Homo sapiens mannose phosphate isomerase (MPI) TTCCAGAGTGCAGAGGGAAAAGCGTAGCCCCTGTGGCCTGATGCCGCTCTGTTAAAGCAA A_73_103299 A_73_103299 FALSE NM_001034782 NM_001034782 DJ383J4.3 ref|NM_001034782 unmapped Bos taurus similar to Homo sapiens centromere protein L (CENPL) TCTGTTTTCCTCACAGTGCCTTTGGAGTTACCCAGATGAAAGCCAAGAAGGATCTAGAAG A_73_103300 A_73_103300 FALSE NM_001035108 NM_001035108 MGC127325 ref|NM_001035108 unmapped Bos taurus similar to Homo sapiens CNDP dipeptidase 2 (metallopeptidase M20 family) (CNDP2) TCAAGACCTTACCCATTACAATGTTCCATCTCTGTATTAAAATCCTTCAAAACCCTGAAA A_73_103301 A_73_103301 FALSE XM_614012 XM_614012 LOC534293 ref|XM_614012 unmapped Bos taurus similar to Homo sapiens MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein (MCM3AP) GACCTGGAAAAAGGTCTGATGCTCCAAGATTTGGGTTCAGCTAAGCTCATTTCAGATATA A_73_103302 A_73_103302 FALSE XM_615789 XM_615789 LOC535679 ref|XM_615789 unmapped PREDICTED: Bos taurus similar to neurexin 3 isoform alpha precursor (LOC535679) ATGTCAAAATTCAAACTTGGTACTTATGGACAGGACCTCTGCTGCAGTGCAGGATGGGAA A_73_103303 A_73_103303 FALSE NM_001015576 NM_001015576 LOC511674 ref|NM_001015576 unmapped Bos taurus chemokine (C-X-C motif) ligand 13-like (LOC511674) ACACTCAAAGACCCCCAGACTTAAATTCATAAAATTTTCAGGAAAAGCATTTAAAGGGTG A_73_103304 A_73_103304 FALSE XM_595012 XM_595012 LOC516853 ref|XM_595012 unmapped PREDICTED: Bos taurus similar to IGF-II mRNA- binding protein 1 (LOC516853) GATCCTGGCCCATAATAACTTTGTGGGGCGACTCATTGGCAAGGAAGGGCGCAACCTGAA A_73_103305 A_73_103305 FALSE CB172001 CB172001 gb|Bos taurus similar to Homo sapiens fibronectin type III domain containing 3A (FNDC3A) unmapped Unknown TAGTGTACTTGCCATTTGAGCCTCACTGTAAAATGAGTGCAGAGGAGAAACAATTTTTAA A_73_103306 A_73_103306 FALSE XM_612736 XM_612736 LOC533355 ref|XM_612736 unmapped Bos taurus similar to Homo sapiens sodium channel, nonvoltage-gated 1, beta (Liddle syndrome) (SCNN1B) CAAAGCACCAATATCACCTTGAGCAGGAAGGGGATTGCCAAGCTCAATATCTACTTCCAA A_73_103307 A_73_103307 FALSE XM_583246 XM_583246 LOC506753 ref|XM_583246 unmapped Bos taurus similar to Homo sapiens leucine rich repeat containing 1 (LRRC1) AATGAAAAACGCCCGTCCCTGTCTGGTGTTTAGGAAAATCATGCTGTTGGTGTTGCCTTT A_73_103308 A_73_103308 FALSE XM_612318 XM_612318 LOC533048 ref|XM_612318 unmapped Bos taurus similar to Homo sapiens natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) (NPR1) GCTGGCTTTGGTGGGGAGCCTCTCCCTTCTCAGCATCCTGATCGTCTCCTTCTTCATATA A_73_103309 A_73_103309 FALSE XM_864255 XM_864255 LOC506131 ref|XM_864255 unmapped Bos taurus similar to Homo sapiens CTP synthase (CTPS) GGGAGCTGCATGCCAGTTATATCCTGGCTGGACTCGGTGTATACTCTAACTTAAGAAATA A_73_103310 A_73_103310 FALSE EE890871 EE890871 gb|Unidentified transcripts unmapped Unknown ATTTTATCATACTCCCCAAATGGTCAGGGTTTACAAAAGGTTAAGAGCCCACTGATCTTT A_73_103311 A_73_103311 FALSE NM_173957 NM_173957 RGN ref|NM_173957 unmapped Bos taurus regucalcin (senescence marker protein-30) (RGN) CTCTGCATTCCATACTTACTATACCTAAAGCTTCAAAACACTAATAAATAGTAGTCTGGC A_73_103312 A_73_103312 FALSE NM_174818 NM_174818 NDUFS8 ref|NM_174818 unmapped Bos taurus NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) (NDUFS8) GACTACCTTTACCGATGACCGGCCGACCCGCGGCCCCTCCTGCCCAATAAAAAGCTCTGA A_73_103313 A_73_103313 FALSE XM_867370 XM_867370 LOC615529 ref|XM_867370 unmapped Bos taurus similar to Homo sapiens chromosome 11 open reading frame 71 (C11orf71) TTAAAACCAATACCTTCCTCGGCCCTTCAATTAGCGTGTAAACAAGGCCTCTCTCTAAAA A_73_103314 A_73_103314 FALSE XM_868426 XM_868426 LOC616411 ref|XM_868426 unmapped PREDICTED: Bos taurus hypothetical protein LOC616411 (LOC616411) TTCCCACCTGCCTGAGCAGCCGGGACTGCTCTCCCTTGAAGACTCCTCCAGAAAGAAAAT A_73_103315 A_73_103315 FALSE XM_583309 XM_583309 LOC506812 ref|XM_583309 unmapped Bos taurus similar to Homo sapiens carnitine palmitoyltransferase 1A (liver) (CPT1A), nuclear gene encoding mitochondrial protein, transcript variant 1 GTCTGAATTTGTTATGTTGGACTGGCCATTGCATGTAAATATAAGGTGCCCTTTTGGATG A_73_103316 A_73_103316 FALSE XM_611941 XM_611941 HMGCS2 ref|XM_611941 unmapped Bos taurus similar to Homo sapiens 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial) (HMGCS2) CATTTCCATGCTGGTATGTCTTTGTTTCTTAGGGTTTTCTGTGAATTTCTAAATTCCATG A_73_103317 A_73_103317 FALSE NM_001031756 NM_001031756 RPL6 ref|NM_001031756 unmapped Bos taurus similar to Homo sapiens ribosomal protein L6 (RPL6), transcript variant 2 GCTACCTCCGCTCCGTGTTTGCTCTCACAAATGGAATTTATCCTCACAAAGTAGTGTTCT A_73_103318 A_73_103318 FALSE CB166985 CB166985 gb|Unidentified transcripts on BTA3 position 40934319-40933341 unmapped Unknown CTGAGTGGAAGATGGACTTGTTTCCACTTTAGGGATGAGGTAACTGAAGCATGAGAGGTT A_73_103319 A_73_103319 FALSE XM_584503 XM_584503 LOC539052 ref|XM_584503 unmapped Bos taurus similar to Homo sapiens eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa (EIF3S1) TGAGCGTGAGGATATTAAAAATACAGTGTGGAGAAGACTGCTGATCTCAGCGAAGATACG A_73_103320 A_73_103320 FALSE NM_001038550 NM_001038550 MGC134379 ref|NM_001038550 unmapped Bos taurus similar to Homo sapiens serine active site containing 1 (SERAC1) GTTCTGGCCTTGAAGAAGTCTTTGACATTAGATACTCAAGTGATAGAAAGAGAAAAAATG A_73_103321 A_73_103321 FALSE XM_598956 XM_598956 LOC520706 ref|XM_598956 unmapped PREDICTED: Bos taurus similar to preferentially expressed antigen in melanoma-like 3 (LOC520706) TTACCAGGAGCAGAATTTTTATCACAGCTTGAACCGACAGAAACTTGCCGAAGTTCAGGC A_73_103322 A_73_103322 FALSE BE682151 BE682151 gb|Unidentified transcripts on BTA19 position 42622954-42621774 unmapped Unknown GCATGTGTGTTGTGTCCAGCCTGTGGTTGTCTTAATAAATGTGATTTTTCTCCCCCATTC A_73_103323 A_73_103323 FALSE XM_865076 XM_865076 LOC507524 ref|XM_865076 unmapped PREDICTED: Bos taurus similar to Leo1, Paf1/RNA polymerase II complex component, homolog, transcript variant 2 (LOC507524) GATGACGATAAAGCGAATAAAAAGCACAAGAAGTATGTGATCAGTGATGAGGAGGAGCTC A_73_103324 A_73_103324 FALSE XM_585787 XM_585787 LOC508931 ref|XM_585787 unmapped Bos taurus similar to Homo sapiens zinc finger protein 624 (ZNF624) CAGAAGACCCACACTGGAGAAAAACCATATAAATGTAATGAATGTGAGATAGCTTTCACT A_73_103325 A_73_103325 FALSE XM_868598 XM_868598 LOC616553 ref|XM_868598 unmapped Bos taurus similar to Homo sapiens prefoldin subunit 1 (PFDN1) TTTTATGCATGGCCTGGAGTCCCTTTCAGATCTTATCCTTGTATGTTTTATCCTGGCTCT A_73_103326 A_73_103326 FALSE XM_583721 XM_583721 LOC507159 ref|XM_583721 unmapped Bos taurus similar to Homo sapiens butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1 (BBOX1) CTGTGAAGTCTCCAGAATGCCTTCAAATCACCTTGCACTAAACCAAATTCTCTCTTCAAA A_73_103327 A_73_103327 FALSE XM_866611 XM_866611 LOC540257 ref|XM_866611 unmapped Bos taurus similar to Homo sapiens protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta) (PPP3CB) TATGCATGTGCAGGACTATTCGAGTATTTTATAAACAGTAGCACACAATAAATTCCATGC A_73_103328 A_73_103328 FALSE NM_174010 NM_174010 CD36 ref|NM_174010 unmapped Bos taurus CD36 antigen (CD36) TTGGTAACTGCTTTGTTTAGATACTAAAATCAGGAATAATCTTGTCATGTCAGTTGCCAG A_73_103329 A_73_103329 FALSE XM_865640 XM_865640 LOC538820 ref|XM_865640 unmapped Bos taurus similar to Homo sapiens ubiquitin specific peptidase 52 (USP52) TGACAGCTGAGAAACCTGTCTTCCATCCACTCTCCTGTCCCAAGTTTTGTTTTCTTGCTA A_73_103330 A_73_103330 FALSE XM_864472 XM_864472 LOC613551 ref|XM_864472 unmapped Bos taurus similar to Homo sapiens transmembrane protein 93 (TMEM93), transcript variant 2 AATAATTTATATCTGAAGACGAAGAGCCTGTACAGTTCTTCAGATTAAATGAAGCGTGAG A_73_103331 A_73_103331 FALSE XM_580916 XM_580916 LOC538526 ref|XM_580916 unmapped Bos taurus similar to Homo sapiens glutamate- ammonia ligase (glutamine synthetase) domain containing 1 (GLULD1) TCGGTATTTTGTTGCCATGAAAAAATATGAGTTGGAAAATGAAGAAACAGATGCTGAGAG A_73_103332 A_73_103332 FALSE XM_585106 XM_585106 LOC539136 ref|XM_585106 unmapped PREDICTED: Bos taurus similar to MEGF10 protein (LOC539136) GAAGTTGAACCTACAGTGAGTGTTGTCCAAGGAATATTCAGCAATAATGGGCATCGCACC A_73_103333 A_73_103333 FALSE XM_874158 XM_874158 LOC506918 ref|XM_874158 unmapped PREDICTED: Bos taurus similar to FXYD domain containing ion transport regulator 4, transcript variant 2 (LOC506918) ACGGCTATGCCATTAGGAGTCGGATAGATATCATGAAAAAAGTAAAATGAGTGTGCTGCA A_73_103334 A_73_103334 FALSE XM_603383 XM_603383 LOC525040 ref|XM_603383 unmapped PREDICTED: Bos taurus similar to interleukin 17 receptor precursor (LOC525040) TACACGTGTGCATGTGTGAAAGCGAGCTTATTGATAAAAGAATGAATAAATTTTTTAACT A_73_103335 A_73_103335 FALSE XM_617258 XM_617258 LOC537102 ref|XM_617258 unmapped PREDICTED: Bos taurus similar to UDP- Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3 (LOC537102) TGGCCATCGACAAGTTCAATGACATCAAAGGGCCAGGGCCCATTGCCTGAAATGCCCTGT A_73_103336 A_73_103336 FALSE XM_585402 XM_585402 LOC508605 ref|XM_585402 unmapped Bos taurus similar to Homo sapiens HLA-B associated transcript 3 (BAT3), transcript variant 2 CGATGCCTACCTCAGTGGTATGCCTGCCAAGAGACGCAAGCTCCGGGCTGACATACAAAA A_73_103337 A_73_103337 FALSE NM_174381 NM_174381 LHCGR ref|NM_174381 unmapped Bos taurus luteinizing hormone/choriogonadotropin receptor (LHCGR) AGGCAAAAAAGACTCTCTACCTAGCTCAAAATGTGGTCCATGACCATGGCCCGTCTAAAA A_73_103338 A_73_103338 FALSE XM_615555 XM_615555 LOC535458 ref|XM_615555 unmapped Bos taurus similar to Homo sapiens UDP-N -acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) (GALNT3) TTTCCCCAAAAACCTTCTTTCTATCTATGGAAAATACAATAAACCCAATTTTTATCACTA A_73_103339 A_73_103339 FALSE XM_597088 XM_597088 LOC518886 ref|XM_597088 unmapped Bos taurus similar to Homo sapiens chromosome 6 open reading frame 170 (C6orf170) TTGAAGTGAATTCATTTTTGTAAGTTTGTTGTTGTGTAAGGTTGTTTTGGCTTTCCCTGG A_73_103340 A_73_103340 FALSE XM_865852 XM_865852 LOC614371 ref|XM_865852 unmapped PREDICTED: Bos taurus similar to X antigen family, member 5 (LOC614371) GAGATGGCCCTGATGTCGAGGGGAAGGGAGTGCCAAATCTAGAGCCCATAAAAATGCCGG A_73_103341 A_73_103341 FALSE XM_590940 XM_590940 LOC513277 ref|XM_590940 unmapped Bos taurus similar to Homo sapiens nuclear distribution gene C homolog (A. nidulans) (NUDC) GGGGGGTCTTGTCCTCCCCAGCTGGCCTGCTGTTACACATTAAAACCATTTACCCAATTC A_73_103342 A_73_103342 FALSE NM_001001172 NM_001001172 CHF2 ref|NM_001001172 unmapped Bos taurus cardiovascular basic helix-loop- helix factor 2 (CHF2) CTCTGTTGTACTGATGTGTTGTGACTAAATAAAAAAGAACAAACTCTTCTCCTGTATGTC A_73_103343 A_73_103343 FALSE CB460457 CB460457 gb|Bos taurus similar to Homo sapiens RWD domain containing 3 (RWDD3) unmapped Unknown GAGCCCTTGTGTTTATACAGAGGATTTGTTTGGAACTGTGCAATTTTCTGGCTAATTTTC A_73_103344 A_73_103344 FALSE BE681909 BE681909 gb|Region on BTA6 3' of LOC511424 without annotated genes unmapped Unknown TGAGTTGGCTACCACCTTGATGTAAAAATTTGTAAAGGGAATTTTTCACCATTTTGAGTG A_73_103345 A_73_103345 FALSE XM_871656 XM_871656 LOC613318 ref|XM_871656 unmapped Bos taurus similar to Homo sapiens cell division cycle associated 5 (CDCA5) CCAGATGATGTTCAGTTGATGTTGTTACTACAGACTTTTCTCTGTCCCTGAAAAACTAAG A_73_103346 A_73_103346 FALSE XM_867881 XM_867881 LOC506866 ref|XM_867881 unmapped PREDICTED: Bos taurus similar to ATM/ATR- Substrate Chk2-Interacting Zn2+-finger protein (LOC506866) TGCGCAGCTGCAGCGAGATCCTGCCCAACTGCCCTGCGCTCAACATGTACCTGGTCAAGA A_73_103347 A_73_103347 FALSE XM_594201 XM_594201 LOC516065 ref|XM_594201 unmapped Bos taurus similar to Homo sapiens ankyrin repeat domain 6 (ANKRD6) CAGCAAGACAAGGCCACGCTGGAGGAACACATTAAAAGTTTAGAGGAGGAACTTGCTAAA A_73_103348 A_73_103348 FALSE NM_174794 NM_174794 YWHAB ref|NM_174794 unmapped Bos taurus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide (YWHAB) GAAACAGTTCTAGTTTCCACCTTACACGGAATAATCAGGAAAAGTGTAAAAACTCAAAAG A_73_103349 A_73_103349 FALSE XM_605269 XM_605269 LOC526888 ref|XM_605269 unmapped Bos taurus similar to Homo sapiens epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 1 CGCAGAAGAAGACTTTTATCAGAAATTCGGGAAGATTCGATCTTCCGTGTGCGGTGTGTA A_73_103350 A_73_103350 FALSE BM967987 BM967987 gb|Unidentified transcripts on BTAX position 41441491-41440783 unmapped Unknown CTTTGTGACCCACGACCCTCTTAAAACACCAAATTAACCTTATTACCATTGGTCTGAGCT A_73_103351 A_73_103351 FALSE XM_585948 XM_585948 LOC509060 ref|XM_585948 unmapped Bos taurus similar to Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (SMARCC2), transcript variant 1 TTTTAAAAACGTGGAATTGTCAAAAAAGCACTTAAGCACCTCCTTCTTATGACGTGGTGG A_73_103352 A_73_103352 FALSE XM_590991 XM_590991 LOC513326 ref|XM_590991 unmapped Bos taurus similar to Homo sapiens ring finger protein 20 (RNF20) CCGTAGGACTTTATACTCCTGCACAAGCTTCAATTAAAGCAGGATTCAGTTTGCTTTTGT A_73_103353 A_73_103353 FALSE BE236747 BE236747 gb|Unidentified transcripts unmapped Unknown GTCCCATGGGGTGATTGGTGCTTTTGCCCCATGCTCGAGTGGGTGGGGAGCTGTTTTAAT A_73_103354 A_73_103354 FALSE XM_601401 XM_601401 LOC523106 ref|XM_601401 unmapped PREDICTED: Bos taurus similar to cold shock domain protein A (LOC523106) CATCGCTAGGAGTGTCCTAGGCTCTGTTGTGCGGTTTAAGGAGAAGAAAGGGTATGGCTT A_73_103355 A_73_103355 FALSE XM_865894 XM_865894 LOC513807 ref|XM_865894 unmapped Bos taurus similar to Homo sapiens MORC family CW-type zinc finger 3 (MORC3) ACGATGTTGATGTAGTTGATGAGATCTTAGGACAAGTTGTGGAACAAATGAGTGAAATCA A_73_103356 A_73_103356 FALSE XM_614219 XM_614219 LOC534449 ref|XM_614219 unmapped PREDICTED: Bos taurus similar to Potassium voltage-gated channel subfamily H member 2 (Voltage-gated potassium channel subunit Kv11.1) (Ether-a-go-go related gene potassium channel 1) (ERG1) (MERG) (Merg1) (Ether-a-go-go related protein 1) (Eag... CAGCGACAGGGAGATCATAGCCCCTAAGATAAAGGAGCGGACCCACAACGTCACCGAGAA A_73_103357 A_73_103357 FALSE XM_581627 XM_581627 LOC505351 ref|XM_581627 unmapped Bos taurus similar to Homo sapiens nucleobindin 1 (NUCB1) GGCTCCCTGTTCTGCTCTATATGCTGGTTCCATCCAAATACACTTTCTGGAACAAAAAGC A_73_103358 A_73_103358 FALSE XM_868744 XM_868744 LOC616665 ref|XM_868744 unmapped Bos taurus similar to Homo sapiens formin binding protein 1-like (FNBP1L), transcript variant 2 AACAGGTGGAAGAGGAGACAGAAGACATAGCAGTGACATAAATCATCTTGTAACACAGGG A_73_103359 A_73_103359 FALSE XM_866401 XM_866401 LOC614780 ref|XM_866401 unmapped PREDICTED: Bos taurus similar to Tumor necrosis factor receptor superfamily member 8 precursor (CD30L receptor) (Lymphocyte activation antigen CD30) (KI-1 antigen) (LOC614780), partial mRNA. GGAAAGCCGGCTCTGGTTTCAGGACCTGTGCTCTTCTGGGTGATTCTGATGCTGGTGGTA A_73_103360 A_73_103360 FALSE XM_587055 XM_587055 LOC509981 ref|XM_587055 unmapped Bos taurus similar to Homo sapiens nuclear import 7 homolog (S. cerevisiae) (NIP7) TGGAAGGGCCTAGTTTTGTTTCCTGTGTCTCTGTAAGCGCCACCGTCATGTTGAATTTTT A_73_103361 A_73_103361 FALSE XM_605772 XM_605772 LOC527381 ref|XM_605772 unmapped PREDICTED: Bos taurus similar to NK6 transcription factor related, locus 2 (LOC527381) CCTGGGCAACAGCATCCACAAGAAAAAGCACACCCGGCCCACCTTCACGGGCCACCAGAT A_73_103362 A_73_103362 FALSE NM_001034326 NM_001034326 MGC127410 ref|NM_001034326 unmapped Bos taurus similar to Homo sapiens nucleolar complex associated 2 homolog (S. cerevisiae) (NOC2L) GCCTCTGCAGGGTGAAAGGGCAGTAGATGGTGGACAGGCCTTTATTTTTACAACATAAAA A_73_103363 A_73_103363 FALSE XM_583733 XM_583733 LOC507167 ref|XM_583733 unmapped PREDICTED: Bos taurus similar to Carcinoembryonic antigen-related cell adhesion molecule 6 precursor (Normal cross-reacting antigen) (Nonspecific crossreacting antigen) (CD66c antigen) (LOC507167) AGCTCTAGTTACCTGACCTCCCCATCTATTCCCTGGGGGAAAGGAAGGGGAAGATTGTGA A_73_103364 A_73_103364 FALSE NM_174282 NM_174282 COPZ1 ref|NM_174282 unmapped Bos taurus coatomer protein complex, subunit zeta 1 (COPZ1) ACATGGAGTCAGGATGGTAGCCACCTTCATATACTGCTCTGTGCAAAGAGGAATAAAACA A_73_103365 A_73_103365 FALSE XM_585301 XM_585301 LOC508513 ref|XM_585301 unmapped Bos taurus similar to Homo sapiens ubiquitin protein ligase E3C (UBE3C) TTCTTCGGCTAATCTGAGCTTATTTATTTATTTGTATGTTCCAATGGCTAAATACTTACA A_73_103366 A_73_103366 FALSE XM_875883 XM_875883 LOC512781 ref|XM_875883 unmapped Bos taurus similar to Homo sapiens ADP- ribosylation factor-like 13B (ARL13B), transcript variant 2 TCAGTGAGCCAAAGACCTGACTGTTCTGATAATTAATTGGTTATCCATGGCTTTCATGGT A_73_103367 A_73_103367 FALSE BI681747 BI681747 gb|Unidentified transcripts on BTA11 position 41643184-41643883 unmapped Unknown GCTGTTCATCTCTTTTCAATATGTGACACTTGCCTTAAAACATAGCAGTCTTCAAAATGA A_73_103368 A_73_103368 FALSE XM_592844 XM_592844 LOC514925 ref|XM_592844 unmapped Bos taurus similar to Homo sapiens klotho beta (KLB)