MEDIPS, GRanges, IRanges error processing BAM file
1
0
Entering edit mode
@jonathan-ellis-6094
Last seen 7.1 years ago
Dear Lukas and list, I'm trying to process a set of BAM files using the latest version of MEDIPS (1.10.0), but have run into problems creating MEDIPSset objects for some BAM file. The following is an example, but I'm getting the same error for 4 out of 20 BAM files. > mset <- MEDIPS.createSet("0139202.fq.sam.noDUP.bam.qf.bam", + BSgenome = "Hsapiens", sample_name = "0139202") Reading bam alignment 0139202.fq.sam.noDUP.bam.qf.bam Total number of imported short reads: 13813686 Creating GRange Object... Error in .Call2("solve_user_SEW0", start, end, width, PACKAGE = "IRanges") : solving row 11345799: range cannot be determined from the supplied arguments (too many NAs) The data are single-end reads that were aligned with bwa version 0.5.9-r16 (the alignments were done some time ago hence the older version of bwa), and the corresponding line from the BAM (11,345,799) is: 19441177 16 chr17 38161416 18 49M * 0 0 TAGAGTCCGGCGTTCAGGGGCAGGAAGCATCCAGCACGGGAGAAAGATG BBBBBBBBBBBBBBBBBd_IIX[ffgb[[YJb^d^[[ggee^^cc^^^_ X0:i:1 X1:i:3 XA:Z:chr1,+56337006,49M,3;chr12,-55896993,49M,3;chr4,-22778322,49M,3; MD:Z:8A7A32 XG:i:0 NM:i:2 XM:i:2 XO:i:0XT:A:U I'm unsure whether this is a problem with the MEDIPS package or something from GRanges/IRanges. As far as I understand the .Call2 function is part of IRanges, but I assume it's failing due to something passed by MEDIPS. Any advice or pointers would be greatly appreciated. > sessionInfo() R version 3.0.1 (2013-05-16) Platform: x86_64-unknown-linux-gnu (64-bit) locale: [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8 [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8 [7] LC_PAPER=C LC_NAME=C [9] LC_ADDRESS=C LC_TELEPHONE=C [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C attached base packages: [1] parallel stats graphics grDevices utils datasets methods [8] base other attached packages: [1] BSgenome.Hsapiens.UCSC.hg19_1.3.19 MEDIPS_1.10.0 [3] DNAcopy_1.34.0 BSgenome_1.28.0 [5] FDb.InfiniumMethylation.hg19_1.0.1 rtracklayer_1.20.4 [7] Biostrings_2.28.0 GenomicFeatures_1.12.3 [9] AnnotationDbi_1.22.6 Biobase_2.20.1 [11] GenomicRanges_1.12.4 IRanges_1.18.2 [13] BiocGenerics_0.6.0 BiocInstaller_1.10.3 loaded via a namespace (and not attached): [1] biomaRt_2.16.0 bitops_1.0-5 DBI_0.2-7 gtools_3.0.0 [5] RCurl_1.95-4.1 Rsamtools_1.12.3 RSQLite_0.11.4 stats4_3.0.1 [9] tools_3.0.1 XML_3.98-1.1 zlibbioc_1.6.0
Alignment BSgenome PROcess BSgenome IRanges MEDIPS Alignment BSgenome PROcess BSgenome • 2.4k views
ADD COMMENT
0
Entering edit mode
Lukas Chavez ▴ 570
@lukas-chavez-5781
Last seen 3.7 years ago
USA/La Jolla/UCSD
Hi Jonathan, I have not encountered this problem previously and do not have an immediate solution. You state that 16 out of 20 bam files can be processed without a problem by applying mset <- MEDIPS.createSet("0139202.fq.sam.noDUP.bam.qf.bam", BSgenome = "Hsapiens", sample_name = "0139202"). This surprises me a little bit, because you have to state the whole BSgenome name, for example BSgenome ="BSgenome.Hsapiens.UCSC.hg19". [It was pointed out few days ago that I can make the package much more flexible by allowing other data types- Hervé, thank you for the hint, we will definitely consider this]. However, this does not seem to be your problem as you encounter problems for only 4 out of 20 bam files. Therefore, I assume that there is something strange with these specific bam files. Do they contain non-mapped reads? MEDIPS 1.10.0 reports an error, if there are none mapped reads in the bam files, but the latest version of MEDIPS available in the development branch can deal with this. However, based on the example read you've sent this might not cause the error. The last regular status report you get is 'Creating GRange Object...'. This happens in the getGRange() function called by MEDIPS.createSet() after the bam files has been imported. The command that probably causes the error is regions_GRange = GRanges(seqnames=regions$chr, ranges=IRanges(start=regions$start, end=regions$stop), strand=regions$strand) but I do not understand why you have missing values. In order to understand this, you might want to try to import your bam file by yourself using library(Rsamtools) scanFlag = scanBamFlag(isUnmappedQuery = F) #this will ignore unmapped reads in the bam file and is implemented in the latest dev version (1.11.16). scanParam=ScanBamParam(flag=scanFlag, what = c("rname", "pos", "strand", "qwidth")) regions = scanBam(file="0139202.fq.sam.noDUP.bam.qf.bam", param=scanParam) regions = do.call(rbind,lapply(regions, as.data.frame, stringsAsFactors=F)) regions = data.frame(chr=as.character(as.vector(regions$rname)), start=as.numeric(as.vector(regions$pos)), stop=as.numeric(as.vector(regions$pos)+as.vector(regions$qwidth)-1), strand=as.character(as.vector(regions$strand)), stringsAsFactors=F) Afterwards, it will be necessary to investigate where your regions object has NA values. Another thing: do you have bam index files in the same directory where you store the bam file? MEDIPS will make use of these, if they are available (using slightly different code as stated above). In case there is a discrepancy between the index and bam files (having the same prefix file name), this might cause a problem as well. Finally, you can convert your bam files into bed files (by yourself) and try uploading simple txt based bed files into MEDIPS. I hope we will identify the root of your error. Lukas On Thu, Aug 15, 2013 at 9:28 PM, Jonathan Ellis <jonathan.ellis@qimr.edu.au>wrote: > Dear Lukas and list, > > I'm trying to process a set of BAM files using the latest version of > MEDIPS (1.10.0), but have run into problems creating MEDIPSset objects > for some BAM file. The following is an example, but I'm getting the > same error for 4 out of 20 BAM files. > > > mset <- MEDIPS.createSet("0139202.fq.sam.noDUP.bam.qf.bam", > + BSgenome = "Hsapiens", sample_name = "0139202") > Reading bam alignment 0139202.fq.sam.noDUP.bam.qf.bam > Total number of imported short reads: 13813686 > Creating GRange Object... > Error in .Call2("solve_user_SEW0", start, end, width, PACKAGE = "IRanges") > : > solving row 11345799: range cannot be determined from the supplied > arguments > (too many NAs) > > The data are single-end reads that were aligned with bwa version > 0.5.9-r16 (the alignments were done some time ago hence the older > version of bwa), and the corresponding line from the BAM (11,345,799) > is: > > 19441177 16 chr17 38161416 18 49M * 0 > 0 TAGAGTCCGGCGTTCAGGGGCAGGAAGCATCCAGCACGGGAGAAAGATG > BBBBBBBBBBBBBBBBBd_IIX[ffgb[[YJb^d^[[ggee^^cc^^^_ X0:i:1 X1:i:3 > XA:Z:chr1,+56337006,49M,3;chr12,-55896993,49M,3;chr4,-22778322,49M,3; > MD:Z:8A7A32 XG:i:0 NM:i:2 XM:i:2 XO:i:0XT:A:U > > I'm unsure whether this is a problem with the MEDIPS package or > something from GRanges/IRanges. As far as I understand the .Call2 > function is part of IRanges, but I assume it's failing due to something > passed by MEDIPS. Any advice or pointers would be greatly appreciated. > > > sessionInfo() > R version 3.0.1 (2013-05-16) > Platform: x86_64-unknown-linux-gnu (64-bit) > > locale: > [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C > [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8 > [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8 > [7] LC_PAPER=C LC_NAME=C > [9] LC_ADDRESS=C LC_TELEPHONE=C > [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C > > attached base packages: > [1] parallel stats graphics grDevices utils datasets methods > [8] base > > other attached packages: > [1] BSgenome.Hsapiens.UCSC.hg19_1.3.19 MEDIPS_1.10.0 > [3] DNAcopy_1.34.0 BSgenome_1.28.0 > [5] FDb.InfiniumMethylation.hg19_1.0.1 rtracklayer_1.20.4 > [7] Biostrings_2.28.0 GenomicFeatures_1.12.3 > [9] AnnotationDbi_1.22.6 Biobase_2.20.1 > [11] GenomicRanges_1.12.4 IRanges_1.18.2 > [13] BiocGenerics_0.6.0 BiocInstaller_1.10.3 > > loaded via a namespace (and not attached): > [1] biomaRt_2.16.0 bitops_1.0-5 DBI_0.2-7 gtools_3.0.0 > [5] RCurl_1.95-4.1 Rsamtools_1.12.3 RSQLite_0.11.4 stats4_3.0.1 > [9] tools_3.0.1 XML_3.98-1.1 zlibbioc_1.6.0 > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > [[alternative HTML version deleted]]
ADD COMMENT
0
Entering edit mode
Hi Lukas, Thanks for your reply. > Do they contain non-mapped reads? I hadn't realised, but yes they do. Each of the problematic BAMs contains a small number of unmapped reads (between 1 and 3). > MEDIPS 1.10.0 reports an error, if there are none mapped reads in the > bam files, Running MEDIPS 1.10.0, I do not see any errors or warnings about unmapped reads only the error I previously posted. I tried the code you suggested and ended up with a data frame that did not contain any NA values; however, if I try the code without the scanFlag parameter I get a data frame that does contain NA values. I've created a set of BAMs with unmapped reads filtered out, and I've run MEDIPS again. This time MEDIPS successfully runs on the data set. Thanks again, your reply has saved me a great deal of time, Jonathan On Fri, Aug 16, 2013 at 12:26:06PM -0700, Lukas Chavez wrote: > Hi Jonathan, > > I have not encountered this problem previously and do not have an > immediate solution. > > You state that 16 out of 20 bam files can be processed without a > problem by applying > mset <- MEDIPS.createSet("0139202.fq.sam.noDUP.bam.qf.bam", BSgenome = > "Hsapiens", sample_name = "0139202"). > This surprises me a little bit, because you have to state the whole > BSgenome name, for example BSgenome ="BSgenome.Hsapiens.UCSC.hg19". > [It was pointed out few days ago that I can make the package much more > flexible by allowing other data types- Herv?, thank you for the hint, > we will definitely consider this]. However, this does not seem to be > your problem as you encounter problems for only 4 out of 20 bam files. > > Therefore, I assume that there is something strange with these > specific bam files. Do they contain non-mapped reads? MEDIPS 1.10.0 > reports an error, if there are none mapped reads in the bam files, but > the latest version of MEDIPS available in the development branch can > deal with this. However, based on the example read you've sent this > might not cause the error. The last regular status report you get is > 'Creating GRange Object...'. This happens in the getGRange() function > called by MEDIPS.createSet() after the bam files has been imported. > The command that probably causes the error is > > regions_GRange = GRanges(seqnames=regions$chr, > ranges=IRanges(start=regions$start, end=regions$stop), > strand=regions$strand) > > but I do not understand why you have missing values. In order to > understand this, you might want to try to import your bam file by > yourself using > > library(Rsamtools) > scanFlag = scanBamFlag(isUnmappedQuery = F) #this will ignore unmapped > reads in the bam file and is implemented in the latest dev version > (1.11.16). > scanParam=ScanBamParam(flag=scanFlag, what = c("rname", "pos", "strand", > "qwidth")) > regions = scanBam(file="0139202.fq.sam.noDUP.bam.qf.bam", param=scanParam) > regions = do.call(rbind,lapply(regions, as.data.frame, stringsAsFactors=F)) > regions = data.frame(chr=as.character(as.vector(regions$rname)), > start=as.numeric(as.vector(regions$pos)), > stop=as.numeric(as.vector(regions$pos)+as.vector(regions$qwidth)-1), > strand=as.character(as.vector(regions$strand)), stringsAsFactors=F) > > Afterwards, it will be necessary to investigate where your regions > object has NA values. > > Another thing: do you have bam index files in the same directory where > you store the bam file? MEDIPS will make use of these, if they are > available (using slightly different code as stated above). In case > there is a discrepancy between the index and bam files (having the > same prefix file name), this might cause a problem as well. > > Finally, you can convert your bam files into bed files (by yourself) > and try uploading simple txt based bed files into MEDIPS. > > I hope we will identify the root of your error. > Lukas > > On Thu, Aug 15, 2013 at 9:28 PM, Jonathan Ellis > <jonathan.ellis at="" qimr.edu.au="">wrote: > > > Dear Lukas and list, > > > > I'm trying to process a set of BAM files using the latest version of > > MEDIPS (1.10.0), but have run into problems creating MEDIPSset > > objects for some BAM file. The following is an example, but I'm > > getting the same error for 4 out of 20 BAM files. > > > > > mset <- MEDIPS.createSet("0139202.fq.sam.noDUP.bam.qf.bam", > > + BSgenome = "Hsapiens", sample_name = "0139202") > > Reading bam alignment 0139202.fq.sam.noDUP.bam.qf.bam > > Total number of imported short reads: 13813686 > > Creating GRange Object... > > Error in .Call2("solve_user_SEW0", start, end, width, PACKAGE = "IRanges") > > : > > solving row 11345799: range cannot be determined from the supplied > > arguments > > (too many NAs) > > > > The data are single-end reads that were aligned with bwa version > > 0.5.9-r16 (the alignments were done some time ago hence the older > > version of bwa), and the corresponding line from the BAM (11,345,799) > > is: > > > > 19441177 16 chr17 38161416 18 49M * 0 > > 0 TAGAGTCCGGCGTTCAGGGGCAGGAAGCATCCAGCACGGGAGAAAGATG > > BBBBBBBBBBBBBBBBBd_IIX[ffgb[[YJb^d^[[ggee^^cc^^^_ X0:i:1 X1:i:3 > > XA:Z:chr1,+56337006,49M,3;chr12,-55896993,49M,3;chr4,-22778322,49M,3; > > MD:Z:8A7A32 XG:i:0 NM:i:2 XM:i:2 XO:i:0XT:A:U > > > > I'm unsure whether this is a problem with the MEDIPS package or > > something from GRanges/IRanges. As far as I understand the .Call2 > > function is part of IRanges, but I assume it's failing due to > > something passed by MEDIPS. Any advice or pointers would be greatly > > appreciated. > > > > > sessionInfo() > > R version 3.0.1 (2013-05-16) > > Platform: x86_64-unknown-linux-gnu (64-bit) > > > > locale: > > [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C > > [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8 > > [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8 > > [7] LC_PAPER=C LC_NAME=C > > [9] LC_ADDRESS=C LC_TELEPHONE=C > > [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C > > > > attached base packages: > > [1] parallel stats graphics grDevices utils datasets methods > > [8] base > > > > other attached packages: > > [1] BSgenome.Hsapiens.UCSC.hg19_1.3.19 MEDIPS_1.10.0 > > [3] DNAcopy_1.34.0 BSgenome_1.28.0 > > [5] FDb.InfiniumMethylation.hg19_1.0.1 rtracklayer_1.20.4 > > [7] Biostrings_2.28.0 GenomicFeatures_1.12.3 > > [9] AnnotationDbi_1.22.6 Biobase_2.20.1 > > [11] GenomicRanges_1.12.4 IRanges_1.18.2 > > [13] BiocGenerics_0.6.0 BiocInstaller_1.10.3 > > > > loaded via a namespace (and not attached): > > [1] biomaRt_2.16.0 bitops_1.0-5 DBI_0.2-7 gtools_3.0.0 > > [5] RCurl_1.95-4.1 Rsamtools_1.12.3 RSQLite_0.11.4 stats4_3.0.1 > > [9] tools_3.0.1 XML_3.98-1.1 zlibbioc_1.6.0 > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor at r-project.org > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > > http://news.gmane.org/gmane.science.biology.informatics.conductor > >
ADD REPLY
0
Entering edit mode
Hi Jonathan, I am glad to hear that you identified unmapped reads in you bam files causing the error. I have previously modified MEDIPS to simply neglect unmapped reads in a given bam file. This is implemented in the latest development version which I consider stable and ready to install, if necessary. All the best, Lukas On Mon, Aug 19, 2013 at 11:50 PM, Jonathan Ellis <jonathan.ellis@qimr.edu.au> wrote: > Hi Lukas, > > Thanks for your reply. > > > Do they contain non-mapped reads? > > I hadn't realised, but yes they do. Each of the problematic BAMs > contains a small number of unmapped reads (between 1 and 3). > > > MEDIPS 1.10.0 reports an error, if there are none mapped reads in the > > bam files, > > Running MEDIPS 1.10.0, I do not see any errors or warnings about > unmapped reads only the error I previously posted. > > I tried the code you suggested and ended up with a data frame that did > not contain any NA values; however, if I try the code without the > scanFlag parameter I get a data frame that does contain NA values. I've > created a set of BAMs with unmapped reads filtered out, and I've run > MEDIPS again. This time MEDIPS successfully runs on the data set. > > Thanks again, your reply has saved me a great deal of time, > > Jonathan > > > On Fri, Aug 16, 2013 at 12:26:06PM -0700, Lukas Chavez wrote: > > Hi Jonathan, > > > > I have not encountered this problem previously and do not have an > > immediate solution. > > > > You state that 16 out of 20 bam files can be processed without a > > problem by applying > > mset <- MEDIPS.createSet("0139202.fq.sam.noDUP.bam.qf.bam", BSgenome = > > "Hsapiens", sample_name = "0139202"). > > This surprises me a little bit, because you have to state the whole > > BSgenome name, for example BSgenome ="BSgenome.Hsapiens.UCSC.hg19". > > [It was pointed out few days ago that I can make the package much more > > flexible by allowing other data types- Hervé, thank you for the hint, > > we will definitely consider this]. However, this does not seem to be > > your problem as you encounter problems for only 4 out of 20 bam files. > > > > Therefore, I assume that there is something strange with these > > specific bam files. Do they contain non-mapped reads? MEDIPS 1.10.0 > > reports an error, if there are none mapped reads in the bam files, but > > the latest version of MEDIPS available in the development branch can > > deal with this. However, based on the example read you've sent this > > might not cause the error. The last regular status report you get is > > 'Creating GRange Object...'. This happens in the getGRange() function > > called by MEDIPS.createSet() after the bam files has been imported. > > The command that probably causes the error is > > > > regions_GRange = GRanges(seqnames=regions$chr, > > ranges=IRanges(start=regions$start, end=regions$stop), > > strand=regions$strand) > > > > but I do not understand why you have missing values. In order to > > understand this, you might want to try to import your bam file by > > yourself using > > > > library(Rsamtools) > > scanFlag = scanBamFlag(isUnmappedQuery = F) #this will ignore unmapped > > reads in the bam file and is implemented in the latest dev version > > (1.11.16). > > scanParam=ScanBamParam(flag=scanFlag, what = c("rname", "pos", "strand", > > "qwidth")) > > regions = scanBam(file="0139202.fq.sam.noDUP.bam.qf.bam", > param=scanParam) > > regions = do.call(rbind,lapply(regions, as.data.frame, > stringsAsFactors=F)) > > regions = data.frame(chr=as.character(as.vector(regions$rname)), > > start=as.numeric(as.vector(regions$pos)), > > stop=as.numeric(as.vector(regions$pos)+as.vector(regions$qwidth)-1), > > strand=as.character(as.vector(regions$strand)), stringsAsFactors=F) > > > > Afterwards, it will be necessary to investigate where your regions > > object has NA values. > > > > Another thing: do you have bam index files in the same directory where > > you store the bam file? MEDIPS will make use of these, if they are > > available (using slightly different code as stated above). In case > > there is a discrepancy between the index and bam files (having the > > same prefix file name), this might cause a problem as well. > > > > Finally, you can convert your bam files into bed files (by yourself) > > and try uploading simple txt based bed files into MEDIPS. > > > > I hope we will identify the root of your error. > > Lukas > > > > On Thu, Aug 15, 2013 at 9:28 PM, Jonathan Ellis > > <jonathan.ellis@qimr.edu.au>wrote: > > > > > Dear Lukas and list, > > > > > > I'm trying to process a set of BAM files using the latest version of > > > MEDIPS (1.10.0), but have run into problems creating MEDIPSset > > > objects for some BAM file. The following is an example, but I'm > > > getting the same error for 4 out of 20 BAM files. > > > > > > > mset <- MEDIPS.createSet("0139202.fq.sam.noDUP.bam.qf.bam", > > > + BSgenome = "Hsapiens", sample_name = "0139202") > > > Reading bam alignment 0139202.fq.sam.noDUP.bam.qf.bam > > > Total number of imported short reads: 13813686 > > > Creating GRange Object... > > > Error in .Call2("solve_user_SEW0", start, end, width, PACKAGE = > "IRanges") > > > : > > > solving row 11345799: range cannot be determined from the supplied > > > arguments > > > (too many NAs) > > > > > > The data are single-end reads that were aligned with bwa version > > > 0.5.9-r16 (the alignments were done some time ago hence the older > > > version of bwa), and the corresponding line from the BAM (11,345,799) > > > is: > > > > > > 19441177 16 chr17 38161416 18 49M * > 0 > > > 0 TAGAGTCCGGCGTTCAGGGGCAGGAAGCATCCAGCACGGGAGAAAGATG > > > BBBBBBBBBBBBBBBBBd_IIX[ffgb[[YJb^d^[[ggee^^cc^^^_ X0:i:1 X1:i:3 > > > XA:Z:chr1,+56337006,49M,3;chr12,-55896993,49M,3;chr4,-22778322,49M,3; > > > MD:Z:8A7A32 XG:i:0 NM:i:2 XM:i:2 XO:i:0XT:A:U > > > > > > I'm unsure whether this is a problem with the MEDIPS package or > > > something from GRanges/IRanges. As far as I understand the .Call2 > > > function is part of IRanges, but I assume it's failing due to > > > something passed by MEDIPS. Any advice or pointers would be greatly > > > appreciated. > > > > > > > sessionInfo() > > > R version 3.0.1 (2013-05-16) > > > Platform: x86_64-unknown-linux-gnu (64-bit) > > > > > > locale: > > > [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C > > > [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8 > > > [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8 > > > [7] LC_PAPER=C LC_NAME=C > > > [9] LC_ADDRESS=C LC_TELEPHONE=C > > > [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C > > > > > > attached base packages: > > > [1] parallel stats graphics grDevices utils datasets methods > > > [8] base > > > > > > other attached packages: > > > [1] BSgenome.Hsapiens.UCSC.hg19_1.3.19 MEDIPS_1.10.0 > > > [3] DNAcopy_1.34.0 BSgenome_1.28.0 > > > [5] FDb.InfiniumMethylation.hg19_1.0.1 rtracklayer_1.20.4 > > > [7] Biostrings_2.28.0 GenomicFeatures_1.12.3 > > > [9] AnnotationDbi_1.22.6 Biobase_2.20.1 > > > [11] GenomicRanges_1.12.4 IRanges_1.18.2 > > > [13] BiocGenerics_0.6.0 BiocInstaller_1.10.3 > > > > > > loaded via a namespace (and not attached): > > > [1] biomaRt_2.16.0 bitops_1.0-5 DBI_0.2-7 gtools_3.0.0 > > > [5] RCurl_1.95-4.1 Rsamtools_1.12.3 RSQLite_0.11.4 stats4_3.0.1 > > > [9] tools_3.0.1 XML_3.98-1.1 zlibbioc_1.6.0 > > > > > > _______________________________________________ > > > Bioconductor mailing list > > > Bioconductor@r-project.org > > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > > Search the archives: > > > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > > [[alternative HTML version deleted]]
ADD REPLY

Login before adding your answer.

Traffic: 326 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6