I have a set of data coming from a PacBio RSII circular consensus sequencing (CSS). In this dataset, the reads have a random orientation. For my further analysis, I require them to be reoriented to have the same orientation, but retain the phred quality information and ID, i.e., I need the final data to be in a ShortReadQ object. I cannot find a function that achieves a reverse complement on the sequence and the reverse on the quality. Is there one that I'm missing? for the reverse complement on the sequence I can conduct the following command: myReads at sread <- reverseComplement(myReads at sread) where "myReads" is the ShortReadQ object. there is also a reverse command, but this is not available for the FastqQuality, i.e., myReads at quality <- reverse(myReads at quality) does not work! I have tried to generate a for loop but run into the issue that the FastqQuality object is not subsettable I highly appreciate if someone could help me find a solution for this All the best Tomas -- output of sessionInfo(): R version 3.1.0 (2014-04-10) Platform: x86_64-apple-darwin10.8.0 (64-bit) locale: [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8 attached base packages: [1] parallel stats graphics grDevices utils datasets methods base other attached packages: [1] ShortRead_1.22.0 GenomicAlignments_1.0.0 BSgenome_1.32.0 Rsamtools_1.16.0 GenomicRanges_1.16.2 [6] GenomeInfoDb_1.0.2 Biostrings_2.32.0 XVector_0.4.0 IRanges_1.22.3 BiocParallel_0.6.0 [11] BiocGenerics_0.10.0 loaded via a namespace (and not attached): [1] BatchJobs_1.2 BBmisc_1.6 Biobase_2.24.0 bitops_1.0-6 brew_1.0-6 codetools_0.2-8 [7] DBI_0.2-7 digest_0.6.4 fail_1.2 foreach_1.4.2 grid_3.1.0 hwriter_1.3 [13] iterators_1.0.7 lattice_0.20-29 latticeExtra_0.6-26 plyr_1.8.1 RColorBrewer_1.0-5 Rcpp_0.11.1 [19] RSQLite_0.11.4 sendmailR_1.1-2 stats4_3.1.0 stringr_0.6.2 tools_3.1.0 zlibbioc_1.10.0 -- Sent via the guest posting facility at bioconductor.org.

On 05/02/2014 06:35 AM, Maintainer wrote: > > I have a set of data coming from a PacBio RSII circular consensus sequencing > (CSS). In this dataset, the reads have a random orientation. For my further > analysis, I require them to be reoriented to have the same orientation, but > retain the phred quality information and ID, i.e., I need the final data to > be in a ShortReadQ object. > > I cannot find a function that achieves a reverse complement on the sequence > and the reverse on the quality. Is there one that I'm missing? > > for the reverse complement on the sequence I can conduct the following > command: myReads at sread <- reverseComplement(myReads at sread) > > where "myReads" is the ShortReadQ object. > > there is also a reverse command, but this is not available for the > FastqQuality, i.e., > > myReads at quality <- reverse(myReads at quality) does not work! Hi Thomas -- For a reproducible example I ran library(ShortRead) example(readFastq) and then I have > rfq class: ShortReadQ length: 256 reads; width: 36 cycles You're correct that reverse, etc., aren't available for ShortReadQ objects (I'll add them), but only for the underling DNAStringSet and BStringSet objects. I think you can achieve what you want with updt = ShortReadQ(reverseComplement(sread(rfq)), FastqQuality(reverse(quality(quality(rfq)))), id(rfq)) > head(sread(updt), 3) A DNAStringSet instance of length 3 width seq [1] 36 ACAGGAGAAGGAAAGCGAGGGTATCCTACAAAGTCC [2] 36 GTCCGATGCTGTTCAACCACTAATAGGTAAGAAATC [3] 36 ACCCAAATTGATATTAATAACACTATAGACCACCGC > head(quality(updt), 3) class: FastqQuality quality: A BStringSet instance of length 3 width seq [1] 36 SALPMVHCV]]]]]]]]]]]]Y]Y]]]]]]]]]]]] [2] 36 KCCIPZP[]T]VPY]]]]]]]]]Y]]]]]]]]]]]] [3] 36 ALFEXUEJMT]V]]]]]T]]]]]T]V]]]]]Y]]]] and to update only some, with index 'idx' a logical or integer vector tmp = rfq[idx] rfq[idx] = ShortReadQ(reverseComplement(sread(tmp)), FastqQuality(reverse(quality(quality(tmp)))), id(tmp)) Nowadays it is almost NEVER necessary to access a slot directly with @; think of these as private. Hope that helps! Martin > > I have tried to generate a for loop but run into the issue that the > FastqQuality object is not subsettable > > I highly appreciate if someone could help me find a solution for this > > All the best > > Tomas > > > > > -- output of sessionInfo(): > > R version 3.1.0 (2014-04-10) Platform: x86_64-apple-darwin10.8.0 (64-bit) > > locale: [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8 > > attached base packages: [1] parallel stats graphics grDevices utils > datasets methods base > > other attached packages: [1] ShortRead_1.22.0 GenomicAlignments_1.0.0 > BSgenome_1.32.0 Rsamtools_1.16.0 GenomicRanges_1.16.2 [6] > GenomeInfoDb_1.0.2 Biostrings_2.32.0 XVector_0.4.0 > IRanges_1.22.3 BiocParallel_0.6.0 [11] BiocGenerics_0.10.0 > > loaded via a namespace (and not attached): [1] BatchJobs_1.2 BBmisc_1.6 > Biobase_2.24.0 bitops_1.0-6 brew_1.0-6 codetools_0.2-8 > [7] DBI_0.2-7 digest_0.6.4 fail_1.2 foreach_1.4.2 > grid_3.1.0 hwriter_1.3 [13] iterators_1.0.7 lattice_0.20-29 > latticeExtra_0.6-26 plyr_1.8.1 RColorBrewer_1.0-5 Rcpp_0.11.1 [19] > RSQLite_0.11.4 sendmailR_1.1-2 stats4_3.1.0 stringr_0.6.2 > tools_3.1.0 zlibbioc_1.10.0 > > -- Sent via the guest posting facility at bioconductor.org. > > ____________________________________________________________________ ____ > devteam-bioc mailing list To unsubscribe from this mailing list send a blank > email to devteam-bioc-leave at lists.fhcrc.org You can also unsubscribe or > change your personal options at > https://lists.fhcrc.org/mailman/listinfo/devteam-bioc > -- Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793