Question: BLAST export library 'annotate'
gravatar for b.stielow
4.4 years ago by
b.stielow0 wrote:

Hi all,

i m trying to export the results of a simple BLASTn query (16S ribosomal RNA) against Genbanks nr database using library 'annotate' and the function 'blastsequences' (see:

Function works well, hitlist is retrieved correctly as dataframe or multiple alignment, but there is no way to write the results into Fasta format!(?) I found hints that this might be possible via 'Biostrings' (which is essential part of the function). Can anyone provide a solution for this? Help is much appreciated!

Best regards,



See example below:

" ,database = "nr", hitListSize="20", program = "blastn", as="data.frame")


ADD COMMENTlink modified 4.4 years ago • written 4.4 years ago by b.stielow0
Answer: BLAST export library 'annotate'
gravatar for branislav misovic
4.4 years ago by
branislav misovic120 wrote:

 Hi Benjamin

 when you search for function it is good to list functions in the packages you already use  or type "??fasta "  or  search website.  Biostrings developers made already writeXStringSet
(In your example i used only first 70 NN as i hoped response from website would be faster ... )

library(Biostrings) ;ls("package:Biostrings")

BLrez =blastSequences(x = "AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG" ,database = "nr", hitListSize="20", program = "blastn", as="data.frame")
BLfasta = DNAStringSet (BLrez$Hsp_hseq)
names (BLfasta) = as.character(BLrez$Hit_id)
writeXStringSet (BLfasta, file="rRNA.fasta.txt", format="fasta", width=80)

btw. great  R & sequencing tutorial (bit old)  is here .


ADD COMMENTlink written 4.4 years ago by branislav misovic120
Answer: BLAST export library 'annotate'
gravatar for b.stielow
4.4 years ago by
b.stielow0 wrote:

Dear Branko,

thanks so much for your help, very much appreciated, that worked perfectly! Actually i already came across 'writeXStringSet' but struggled with its use. Thanks again!

Best regards,


ADD COMMENTlink written 4.4 years ago by b.stielow0
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 164 users visited in the last hour