Question: got an error with wavClusteR package; NSBS(i, x, exact = exact, upperBoundIsStrict = !allow.append)....
gravatar for gajyodaro
4.5 years ago by
Korea, Republic Of
gajyodaro10 wrote:


I tried to use the latest version of wavClusteR(2.1.0) to analyze an illumina sequencing data set.
However, I have a problem with using this package.

It worked well with example file and some files(small size of files).

I followed the R script exactly.

When I run some large files, I got an error at 'getAllSub(Bam, minCov=10)' like this:

> library(wavClusteR)
> filename <- system.file( "extdata", "example.bam", package = "wavClusteR" )
> BAM <- readSortedBam(filename = filename)
GRanges object with 1468971 ranges and 2 metadata columns:
            seqnames         ranges strand   |                            qseq          MD
               <Rle>      <IRanges>  <Rle>   |                  <DNAStringSet> <character>
        [1]     chr1 [22559, 22572]      -   |                  GGTCCAGCACGAGG          14
        [2]     chr1 [25049, 25069]      -   |           AGGCCAGGAGCGCATCGACGG      15A2T2
        [3]     chr1 [25049, 25071]      -   |         AGGCCAGGAGCGCATCGCCGGGA    15A1A0T4
        [4]     chr1 [25049, 25063]      -   |                 AGGCCAGGAGCGCAT          15
        [5]     chr1 [25049, 25063]      -   |                 AGGCCAGGAGCGCAT          15
        ...      ...            ...    ... ...                             ...         ...
  [1468967]     chrM [16384, 16414]      -   | CAGATAGGGGTCCCTTGACCACCATCCTCCC        30G0
  [1468968]     chrM [16433, 16461]      +   |   CAGGAGTGCTACTCTCCTCGCTCCGGGCC        2A26
  [1468969]     chrM [16443, 16471]      -   |   ACTCTCCTCGCTCCGGGCCCATAACGCGC    25A1T0T0
  [1468970]     chrM [16443, 16471]      -   |   ACTCTCCTCGCTCCGGGCCCATAACACTT          29
  [1468971]     chrM [16444, 16465]      -   |          CTCTCCTCGCTCCGGGCCTGTA      18C0A2
  seqinfo: 25 sequences from an unspecified genome; no seqlengths

> countTable <- getAllSub( BAM, minCov = 10 )
Loading required package: doMC
Considering substitutions, n = 117586, processing in 118 chunks
   chunk #: 1
   chunk #: 2
   chunk #: 117
   chunk #: 118
GRanges object with 1728352 ranges and 2 metadata columns:
            seqnames               ranges strand   | substitutions  coverage
               <Rle>            <IRanges>  <Rle>   |   <character> <numeric>
        [1]     chrM         [2230, 2230]      +   |            AC       Inf
        [2]     chrM         [2231, 2231]      +   |            AG       Inf
        [3]     chrM         [2232, 2232]      +   |            AT       Inf
        [4]     chrM         [2355, 2355]      +   |            AG       Inf
        [5]     chrM         [2356, 2356]      +   |            AC       Inf
        ...      ...                  ...    ... ...           ...       ...
  [1728348]     chr1 [49479464, 49479464]      +   |            TG       Inf
  [1728349]     chr1 [49479468, 49479468]      +   |            TG       Inf
  [1728350]     chrM [   13340,    13340]      -   |            AG       Inf
  [1728351]     chrM [   13350,    13350]      -   |            AG       Inf
  [1728352]     chrM [   13356,    13356]      -   |            AG       Inf
  seqinfo: 25 sequences from an unspecified genome; no seqlengths
   considering the + strand
Computing local coverage at substitutions...
Error in NSBS(i, x, exact = exact, upperBoundIsStrict = !allow.append) :
  subscript contains NAs or out-of-bounds indices

Here is the output of seesionInfo.

R version 3.1.2 (2014-10-31)
Platform: x86_64-w64-mingw32/x64 (64-bit)

[1] LC_COLLATE=English_United States.1252  LC_CTYPE=English_United States.1252    LC_MONETARY=English_United States.1252 LC_NUMERIC=C                         
[5] LC_TIME=English_United States.1252   

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] doSNOW_1.0.12        snow_0.3-13          iterators_1.0.7      foreach_1.4.2        wavClusteR_2.1.0     Rsamtools_1.18.2     Biostrings_2.34.1  
 [8] XVector_0.6.0        GenomicRanges_1.18.4 GenomeInfoDb_1.2.4   IRanges_2.0.1        S4Vectors_0.4.0      BiocGenerics_0.12.1

loaded via a namespace (and not attached):
 [1] acepack_1.3-3.3         ade4_1.6-2              AnnotationDbi_1.28.1    base64enc_0.1-2         BatchJobs_1.5           BBmisc_1.9            
 [7] Biobase_2.26.0          BiocParallel_1.0.3      biomaRt_2.22.0          bitops_1.0-6            brew_1.0-6              checkmate_1.5.1       
[13] cluster_2.0.1           codetools_0.2-10        colorspace_1.2-4        compiler_3.1.2          DBI_0.3.1               digest_0.6.8          
[19] fail_1.2                foreign_0.8-62          Formula_1.2-0           GenomicAlignments_1.2.1 GenomicFeatures_1.18.3  ggplot2_1.0.0         
[25] grid_3.1.2              gtable_0.1.2            Hmisc_3.14-6            ifultools_2.0-1         lattice_0.20-29         latticeExtra_0.6-26   
[31] MASS_7.3-37             mclust_4.4              munsell_0.4.2           nnet_7.3-8              plyr_1.8.1              proto_0.3-10          
[37] RColorBrewer_1.1-2      Rcpp_0.11.4             RCurl_1.95-4.5          reshape2_1.4.1          rpart_4.1-8             RSQLite_1.0.0         
[43] rtracklayer_1.26.2      scales_0.2.4            sendmailR_1.2-1         seqinr_3.1-3            splines_3.1.2           splus2R_1.2-0         
[49] stringr_0.6.2           survival_2.37-7         tools_3.1.2             wmtsa_2.0-0             XML_3.98-1.1            zlibbioc_1.12.0       


I tried with wavClusteR(version 2.0.0) too but I had same error.

Please give me an advice to figure it out.

Thank you.


- Hee -

ADD COMMENTlink modified 4.5 years ago by federico.comoglio100 • written 4.5 years ago by gajyodaro10
Answer: got an error with wavClusteR package; NSBS(i, x, exact = exact, upperBoundIsStri
gravatar for federico.comoglio
4.5 years ago by
federico.comoglio100 wrote:

Hi Hee,

thank you for pointing out this bug. This issue has been fixed very recently and I would suggest you download wavClusteR version 1.99.3 from my GitHub repository:

See for more information. The same version will be shortly replace v 2.1.0 in BioC devel.

Please let me know should you this issue persists.




ADD COMMENTlink modified 4.5 years ago • written 4.5 years ago by federico.comoglio100
Answer: got an error with wavClusteR package; NSBS(i, x, exact = exact, upperBoundIsStri
gravatar for gajyodaro
4.5 years ago by
Korea, Republic Of
gajyodaro10 wrote:

Hello, Federico.

I really appreciate your help.

It works well now.


your sincerely


ADD COMMENTlink written 4.5 years ago by gajyodaro10
Answer: got an error with wavClusteR package; NSBS(i, x, exact = exact, upperBoundIsStri
gravatar for federico.comoglio
4.5 years ago by
federico.comoglio100 wrote:

You're welcome, Hee. Please let me know should you need further support. 

Best wishes,


ADD COMMENTlink written 4.5 years ago by federico.comoglio100
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 285 users visited in the last hour