miRNA expression analysis : annotation
2
0
Entering edit mode
aswathym • 0
@aswathym-7607
Last seen 4.1 years ago
United States

Hii,

                I have few questions

1) I am doing miRNA expression analysis. the experiment was done using mouse model. I am finding difficulty to do annotation. The chip used is miRNA_4.0.(affymetrix). I extracted the expression dataset. what should be done next to annotate. 

2) I got 

>featureData: none

 

Is this can be a problem

Thank you

miRNA annotation affymetrixchip • 2.0k views
ADD COMMENT
0
Entering edit mode
@james-w-macdonald-5106
Last seen 13 hours ago
United States

We don't supply annotations for this array, because the Affy annotation file contains pretty much everything you need. The columns of that file are

"Probe Set ID"
"Probe Set Name"
"Accession"
"Transcript ID(Array Design)"
"Sequence Type"
"Species Scientific Name"
"Alignments"
"Sequence Length"
"Sequence"
"Genome Context"
"Clustered miRNAs within 10kb"
"Target Genes"
"GeneChip Array"
"Annotation Date"
"Sequence Source"

And the first few rows

"Probe Set ID","Probe Set Name","Accession","Transcript ID(Array Design)","Sequence Type","Species Scientific Name","Alignments","Sequence Length","Sequence"
"20500000","MIMAT0000001_st","MIMAT0000001","cel-let-7-5p","miRNA","Caenorhabditis elegans","X:14744165-14744186 (-)","22","UGAGGUAGUAGGUUGUAUAGUU"
"20500001","MIMAT0015091_st","MIMAT0015091","cel-let-7-3p","miRNA","Caenorhabditis elegans","X:14744123-14744147 (-)","25","UGAACUAUGCAAUUUUCUACCUUAC"
"20500002","MIMAT0000002_st","MIMAT0000002","cel-lin-4-5p","miRNA","Caenorhabditis elegans","II:5902246-5902266 (+)","21","UCCCUGAGACCUCAAGUGUGA"
"20500003","MIMAT0015092_st","MIMAT0015092","cel-lin-4-3p","miRNA","Caenorhabditis elegans","II:5902285-5902305 (+)","21","ACACCUGGGCUCUCCGGGUAC"
"20500004","MIMAT0020301_st","MIMAT0020301","cel-miR-1-5p","miRNA","Caenorhabditis elegans","I:6172718-6172739 (-)","22","CAUACUUCCUUACAUGCCCAUA"

You can read that in using 

annot <- read.csv("miRNA-4_0-st-v1.annotations.20140513.csv", comment.char = "#")

Remember to ensure that your data and the annotation file are in the same order!

 

ADD COMMENT
0
Entering edit mode
aswathym • 0
@aswathym-7607
Last seen 4.1 years ago
United States

> eset
ExpressionSet (storageMode: lockedEnvironment)
assayData: 36353 features, 4 samples 
  element names: exprs 
protocolData
  rowNames: C1_(miRNA-4_0).CEL C2_(miRNA-4_0).CEL G1_5_(miRNA-4_0).CEL
    G1_8_(miRNA-4_0).CEL
  varLabels: exprs dates
  varMetadata: labelDescription channel
phenoData
  rowNames: C1_(miRNA-4_0).CEL C2_(miRNA-4_0).CEL G1_5_(miRNA-4_0).CEL
    G1_8_(miRNA-4_0).CEL
  varLabels: index
  varMetadata: labelDescription channel
featureData: none
experimentData: use 'experimentData(object)'
Annotation: pd.mirna.4.0 

 

even i loaded the cdf file for the experiment.

What is the probable mistake has happened. Is there any problem with cdf file installation.

 

ADD COMMENT
0
Entering edit mode

Why do you think there is a problem?

ADD REPLY
0
Entering edit mode

Here the annotaion file seleted is : pd.mirna.4.0 

I dont know whether it is the correct file. I installed the particluar cdf file. whether it should be the annotation file.

And how the miRNA annotation done ??  we can use getsymbol its for gene right

I dont know exactly what should be done because its the first time I am doing this. 

Thank you in advance

ADD REPLY
1
Entering edit mode

You are analyzing miRNA data, not mRNA data. There are no gene symbols here, only mirBase names. In addition, as I have already told you, there is no annotation file from bioconductor that you can use. Look at my original post - there is a link there that you can use to get the annotation data from Affy, and some code you can use to read it in.

Presumably you are going to be making comparisons, and presumably you will be using the limma package, in which case you can add the annotation data to your MArrayLM object.

I understand that this is your first time, and everybody has to start somewhere. However, what you are doing is the equivalent of jumping off the high board into the deep end of the pool without even taking a single swimming lesson. Unless you think you can learn to swim on the way down, this is not the optimal way to begin.

If you are doing this analysis as practice, in order to learn, then you need to start reading. There are literally reams of information on the bioconductor site (for example here) that you can read, in order to figure out how to proceed, and to learn what you are doing.

If you are doing this analysis 'for real', then I highly recommend finding a local statistician with experience who can either do the analysis for you, or give you some mentoring.

ADD REPLY

Login before adding your answer.

Traffic: 258 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6