Question: chimera error after update to R 3.2
0
gravatar for kelly.rabionet
4.2 years ago by
Spain
kelly.rabionet10 wrote:

Hi,

first of all, a disclaimer: I know very little R .

So, now. I installed chimera on our R 3.1 and all worked fine.

Then we updated R and bioconductor to R 3.2 and bioconductor's version 3.1.  I followed the same steps to install chimera, and it is supposedly properly installed. The library loads with no errors, but now it crashes on my first script line:

> fusionevents <-importFusionData("star","../RVM_CChimeric.out.junction",org="hs",min.support=10)

The following chrs were removed from fusion acceptor:
 chrGL000191.1 chrGL000192.1 [...]

The following chrs were removed from fusion donor:
 chrGL000191.1 chrGL000192.1 [...]

Importing 8 fusions

.
Error in (function (classes, fdef, mtable)  :
  unable to find an inherited method for function ‘findOverlaps’ for signature ‘"GRanges", "NULL"’

Thanks for any help!

Kelly

SessionInfo() output

 

R version 3.2.0 (2015-04-16)
Platform: x86_64-redhat-linux-gnu (64-bit)
Running under: Scientific Linux release 6.5 (Carbon)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8   
 [6] LC_MESSAGES=en_US.UTF-8    LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C            
[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] BiocInstaller_1.18.3                    chimera_1.10.0                          Homo.sapiens_1.1.2                     
 [4] org.Hs.eg.db_3.1.2                      GO.db_3.1.2                             RSQLite_1.0.0                          
 [7] DBI_0.3.1                               OrganismDbi_1.10.0                      TxDb.Hsapiens.UCSC.hg19.knownGene_3.1.2
[10] GenomicFeatures_1.20.1                  BSgenome.Hsapiens.UCSC.hg19_1.4.0       BSgenome_1.36.0                        
[13] rtracklayer_1.28.4                      AnnotationDbi_1.30.1                    GenomicAlignments_1.4.1                
[16] Rsamtools_1.20.4                        Biostrings_2.36.1                       XVector_0.8.0                          
[19] GenomicRanges_1.20.5                    GenomeInfoDb_1.4.0                      IRanges_2.2.4                          
[22] S4Vectors_0.6.0                         Biobase_2.28.0                          BiocGenerics_0.14.0                    

loaded via a namespace (and not attached):
 [1] graph_1.46.0         zlibbioc_1.14.0      BiocParallel_1.2.3   tools_3.2.0          lambda.r_1.1.7       futile.logger_1.4.1  RBGL_1.44.0         
 [8] futile.options_1.0.0 bitops_1.0-6         biomaRt_2.24.0       RCurl_1.95-4.6       XML_3.98-1.2       

iranges chimera • 895 views
ADD COMMENTlink modified 3.7 years ago by raffaele calogero500 • written 4.2 years ago by kelly.rabionet10

HI Kelly,

could please share with me your data set to reproduce the error?

Cheers

Raffaele

P..s can you please  put it in a shared dropbox or send by email to  raffaele.calogero@unito.it

 

ADD REPLYlink written 4.2 years ago by raffaele calogero500
1

I figured out what the error was. In the previus version it would accept org="hs" , in this one it has to be org="hg19".

 

thanks, and sorry for taking up your time.

 

ADD REPLYlink modified 4.1 years ago • written 4.1 years ago by kelly.rabionet10

thanks for working this out, Kelly

 

Raffaele: are you able to fix the working example (http://bioconductor.jp/packages/3.0/bioc/vignettes/chimera/inst/doc/chimera.R) now, or do you have to wait until the next release of chimera?

all the best,

Inge

ADD REPLYlink modified 3.7 years ago • written 3.7 years ago by inge.seim0
Answer: chimera error after update to R 3.2
0
gravatar for raffaele calogero
3.7 years ago by
Italy/Turin/University of Torino
raffaele calogero500 wrote:

Hi Inge,

in my hand the example shown in vignette works:

tmp <- importFusionData("fusionmap", paste(find.package(package="chimera"),"/examples/mcf7.FMFusionReport", sep=""), org="hg19")

length(tmp)
[1] 13

> tmp[[1]]
An object of class "fSet"
Slot "fusionInfo":
$fusionTool
[1] "FusionMap"

$UniqueCuttingPositionCount
[1] "2"

$SeedCount
[1] "1"

$RescuedCount
[1] "1"

$SplicePattern
[1] "CT-AC"

$FusionGene
[1] "uc001sjr.3,uc001sjq.3->uc001bmp.4"

$frameShift
[1] "2->"


Slot "fusionLoc":
GRangesList object of length 2:
$gene1
GRanges object with 1 range and 5 metadata columns:
      seqnames               ranges strand |   KnownGene KnownTranscript KnownExonNumber KnownTranscriptStrand         FusionJunctionSequence
         <Rle>            <IRanges>  <Rle> | <character>     <character>     <character>           <character>                    <character>
  [1]     chr1 [26798973, 26799003]      - |       HMGN2      uc001bmp.4               1                     + TCCGGGGGTCGTTCTCGCCTCTTCTTCACA

$gene2
GRanges object with 1 range and 5 metadata columns:
      seqnames               ranges strand | KnownGene       KnownTranscript KnownExonNumber KnownTranscriptStrand
  [1]    chr12 [56527458, 56527488]      - |     ESYT1 uc001sjr.3,uc001sjq.3           12,12                    ++
              FusionJunctionSequence
  [1] ctgctccagtttctctgcatctgacaaaag

-------
seqinfo: 2 sequences from an unspecified genome; no seqlengths

Slot "fusionRNA":
  A DNAStringSet instance of length 0

Slot "fusionGA":
GAlignments object with 0 alignments and 0 metadata columns:
   seqnames strand       cigar    qwidth     start       end     width     njunc
      <Rle>  <Rle> <character> <integer> <integer> <integer> <integer> <integer>
  -------
  seqinfo: no sequences

 

 

> sessionInfo()
R version 3.2.2 (2015-08-14)
Platform: x86_64-apple-darwin13.4.0 (64-bit)
Running under: OS X 10.11.1 (El Capitan)

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] chimera_1.12.0                          Homo.sapiens_1.3.1                      org.Hs.eg.db_3.2.3                     
 [4] GO.db_3.2.2                             RSQLite_1.0.0                           DBI_0.3.1                              
 [7] OrganismDbi_1.12.0                      TxDb.Hsapiens.UCSC.hg19.knownGene_3.2.2 GenomicFeatures_1.22.5                 
[10] BSgenome.Hsapiens.UCSC.hg19_1.4.0       BSgenome_1.38.0                         rtracklayer_1.30.1                     
[13] AnnotationDbi_1.32.0                    GenomicAlignments_1.6.1                 SummarizedExperiment_1.0.1             
[16] Rsamtools_1.22.0                        Biostrings_2.38.2                       XVector_0.10.0                         
[19] GenomicRanges_1.22.1                    GenomeInfoDb_1.6.1                      IRanges_2.4.4                          
[22] S4Vectors_0.8.3                         Biobase_2.30.0                          BiocGenerics_0.16.1                    
[25] BiocInstaller_1.20.1                   

loaded via a namespace (and not attached):
 [1] graph_1.48.0         zlibbioc_1.16.0      BiocParallel_1.4.0   tools_3.2.2          lambda.r_1.1.7       futile.logger_1.4.1
 [7] RBGL_1.46.0          futile.options_1.0.0 bitops_1.0-6         biomaRt_2.26.1       RCurl_1.95-4.7       XML_3.98-1.3     

 

ADD COMMENTlink written 3.7 years ago by raffaele calogero500
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 168 users visited in the last hour