Error with qa() in package ShortRead when checking for adapter contamination.
0
0
Entering edit mode
Diego Diez ▴ 760
@diego-diez-4520
Last seen 23 months ago
Japan

I am trying to get a report on some NGS data and estimate adapter contamination. This code works without problem:

library(ShortRead)
## ff is a vector of fastq files.
qa <- qa(ff, type = "fastq")

The following code, however, ends with an error message:

qa <- qa(ff, type = "fastq", Lpattern = "AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG")
Error in slot(object, ".srlist") : 
  cannot get a slot (".srlist") from an object of type "list"

I tried inputing the sequence as a AAString object without success:

qa <- qa(ff, type = "fastq", Lpattern = AAString("AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG"))

Am I doing something wrong? What would be the proper way to perform this analysis?

> sessionInfo()
R version 3.2.3 (2015-12-10)
Platform: x86_64-apple-darwin13.4.0 (64-bit)
Running under: OS X 10.11.3 (El Capitan)

locale:
[1] C/UTF-8/C/C/C/C

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets 
[8] methods   base     

other attached packages:
 [1] ShortRead_1.28.0           GenomicAlignments_1.6.3   
 [3] SummarizedExperiment_1.0.2 Biobase_2.30.0            
 [5] Rsamtools_1.22.0           GenomicRanges_1.22.4      
 [7] GenomeInfoDb_1.6.3         Biostrings_2.38.4         
 [9] XVector_0.10.0             IRanges_2.4.7             
[11] S4Vectors_0.8.11           BiocParallel_1.4.3        
[13] BiocGenerics_0.16.1       

loaded via a namespace (and not attached):
 [1] lattice_0.20-33      bitops_1.0-6         grid_3.2.3          
 [4] futile.options_1.0.0 zlibbioc_1.16.0      hwriter_1.3.2       
 [7] latticeExtra_0.6-28  futile.logger_1.4.1  RColorBrewer_1.1-2  
[10] lambda.r_1.1.7      
shortread • 932 views
ADD COMMENT

Login before adding your answer.

Traffic: 482 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6