Search
Question: Error with qa() in package ShortRead when checking for adapter contamination.
0
gravatar for Diego Diez
21 months ago by
Diego Diez700
Japan
Diego Diez700 wrote:

I am trying to get a report on some NGS data and estimate adapter contamination. This code works without problem:

library(ShortRead)
## ff is a vector of fastq files.
qa <- qa(ff, type = "fastq")

The following code, however, ends with an error message:

qa <- qa(ff, type = "fastq", Lpattern = "AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG")
Error in slot(object, ".srlist") : 
  cannot get a slot (".srlist") from an object of type "list"

I tried inputing the sequence as a AAString object without success:

qa <- qa(ff, type = "fastq", Lpattern = AAString("AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG"))

Am I doing something wrong? What would be the proper way to perform this analysis?

> sessionInfo()
R version 3.2.3 (2015-12-10)
Platform: x86_64-apple-darwin13.4.0 (64-bit)
Running under: OS X 10.11.3 (El Capitan)

locale:
[1] C/UTF-8/C/C/C/C

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets 
[8] methods   base     

other attached packages:
 [1] ShortRead_1.28.0           GenomicAlignments_1.6.3   
 [3] SummarizedExperiment_1.0.2 Biobase_2.30.0            
 [5] Rsamtools_1.22.0           GenomicRanges_1.22.4      
 [7] GenomeInfoDb_1.6.3         Biostrings_2.38.4         
 [9] XVector_0.10.0             IRanges_2.4.7             
[11] S4Vectors_0.8.11           BiocParallel_1.4.3        
[13] BiocGenerics_0.16.1       

loaded via a namespace (and not attached):
 [1] lattice_0.20-33      bitops_1.0-6         grid_3.2.3          
 [4] futile.options_1.0.0 zlibbioc_1.16.0      hwriter_1.3.2       
 [7] latticeExtra_0.6-28  futile.logger_1.4.1  RColorBrewer_1.1-2  
[10] lambda.r_1.1.7      
ADD COMMENTlink written 21 months ago by Diego Diez700
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 176 users visited in the last hour