DEXSeq warnings for millions of reads
1
0
Entering edit mode
Assa Yeroslaviz ★ 1.5k
@assa-yeroslaviz-1597
Last seen 4 weeks ago
Munich, Germany

Hi,

I was wondering why dexseq gives me so many warnings. I understand I can ignore them, as it has something to do with the order of the reads in the bam file.

I'm counting a paired-end bam file, whaich was mapped with hisat2

the workflows was as followed:

> hisat2 -p 15 --un-gz $outhisat2/$base.unpaired.hisat2.gz -x ~/genomes/Homo_sapiens/HISAT2/grch38/genome -1 $base\_1.fastq.gz -2 $base\_2.fastq.gz | samtools view -Sbhu -F 4 - | samtools sort -@10 - $outhisat2/$base.sorted
> samtools index $file
> python ~/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py -f bam -p yes -r pos -s no Homo_sapiens.GRCh38.81.txt $file $NEW_FILE.dexseq.txt 2> $NEW_FILE.warnings

I can see from looking at the file, that it is not sorted as i expected it to be (a snippet of the bam file is below). 

I am running the script and get millions of warnings. Is there a reason why the sorting didn't went as planned?

Do I need to re-run the sorting without the -F4 option in samtools to make sure that I get a correctly sorted file?

Would it be wiser to run the dexseq_count script in a single-end mode to prevent the accumulation of so many warnings?

>samtools view 704G6AAXX_8.sorted.bam | head
SOLEXA7_1:8:15:18443:12235/2    401     1       10541   1       50M     12      50738   0       CCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCG      DBCBDDDCDCDC@DCCCCCCDDCCCCCCCCCCCCCCCCCCCCCCCCCCCC      AS:i:-5 ZS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1MD:Z:19C30       YT:Z:UP NH:i:5
SOLEXA7_1:8:57:6309:11195/1     369     1       10543   1       50M     9       138243671       0       GAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGGG      CCDCDCBCDCCCCCCCCCCDCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC      AS:i:-5 ZS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0NM:i:1   MD:Z:17C32      YT:Z:UP NH:i:3
SOLEXA7_1:8:68:8624:5173/1      345     1       10561   1       50M     =       10561   0       AACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACG      D7B@BBBDBBD@BADBDCDDCCDCDCDCCCCCCCCCCCCCCCCCCCCCCC      AS:i:0  ZS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0MD:Z:50  YT:Z:UP NH:i:2
SOLEXA7_1:8:107:4334:2565/2     433     1       10561   1       1S49M   7       128617866       0       GAACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAAC      #####A;>B=BBBDBD>@BDDC@DBBBBCCCCCCCCCCCCCCCCCCCCCC      AS:i:-1 ZS:i:-1 XN:i:0  XM:i:0  XO:i:0  XG:i:0NM:i:0   MD:Z:49 YT:Z:UP NH:i:3
SOLEXA7_1:8:73:6319:19644/1     113     1       10562   255     50M     7       45773648        0       ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGC      BC@CCCCCAC@C?<CBCCCC@CCCBCC@C@CACCCCCCCBCCCCCBCCBC      AS:i:0  ZS:i:-1 XN:i:0  XM:i:0  XO:i:0  XG:i:0NM:i:0   MD:Z:50 YT:Z:UP NH:i:1
SOLEXA7_1:8:57:13291:19688/1    113     1       10563   255     50M     9       138243618       0       CGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCA      CCCCCCBCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC      AS:i:0  ZS:i:-2 XN:i:0  XM:i:0  XO:i:0  XG:i:0NM:i:0   MD:Z:50 YT:Z:UP NH:i:1
SOLEXA7_1:8:65:4865:16987/2     177     1       10565   255     50M     3       198180758       0       CAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAAC      CCCCDCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC      AS:i:0  ZS:i:-4 XN:i:0  XM:i:0  XO:i:0  XG:i:0NM:i:0   MD:Z:50 YT:Z:UP NH:i:3
SOLEXA7_1:8:99:3043:3519/1      369     1       11154   0       46M4S   4       118595917       0       AGCCGGGCTCGGCCGCCCCTTGCTTGCAGCCGGGCACTACAGGACCGGCT      #####?3B1BB5>AAB>@DDDCACBDCDCCCCCCCDCCDCCCCCCDCCCC      AS:i:-13        ZS:i:-13        XN:i:0  XM:i:2XO:i:0   XG:i:0  NM:i:2  MD:Z:7A3A34     YT:Z:UP NH:i:5
SOLEXA7_1:8:29:15490:9805/1     329     1       11474   1       50M     =       11474   0       AACACCCGGAGCATATGCTGTTTGGTCTCAGTAGACTCCTAAATATGGGA      CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC      AS:i:0  ZS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0MD:Z:50  YT:Z:UP NH:i:4
SOLEXA7_1:8:24:17498:6074/2     163     1       11641   1       50M     =       11768   177     GTTTACTTTTGGATTTTTGCCAGTCTAACAGGTGAAGCCCTGGAGATTCT      CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCDCCCCCCCCCCDC@CCCC      AS:i:0  ZS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0MD:Z:50  YS:i:0  YT:Z:CP NH:i:5
DEXSeq warnings dexseq_count • 1.0k views
ADD COMMENT
0
Entering edit mode

Hi Assa, 

Can you include the warning that you are getting?
Alejandro

ADD REPLY
0
Entering edit mode

Hi Alejandro,

here is one row of my warnings file:

/home/yeroslaviz/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py:166: UserWarning: Read SOLEXA7_1:8:43:7845:9335/2 claims to have an aligned mate that could not be found in the same chromosome.
  warnings.warn( "Read "+ i + " claims to have an aligned mate that could not be found in the same chromosome." )
/home/yeroslaviz/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py:166: UserWarning: Read SOLEXA7_1:8:7:7054:17868/1 claims to have an aligned mate that could not be found in the same chromosome.
  warnings.warn( "Read "+ i + " claims to have an aligned mate that could not be found in the same chromosome." )
/home/yeroslaviz/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py:166: UserWarning: Read SOLEXA7_1:8:7:7054:17868/2 claims to have an aligned mate that could not be found in the same chromosome.
  warnings.warn( "Read "+ i + " claims to have an aligned mate that could not be found in the same chromosome." )

I have ran the same command with the option '-p yes' and with '-p no'. in the paired-end mode I get ~109.5 million warnings, in the single-end mode I get only 540 warnings. 

Even worse is, when I check the output of the PE mode, I get no reads attached to any exon. the 338906 exon found are ambigious and the rest of the list consists of '0'.

Here is also the last few lines of the count output file to show the differences in the results of the two counting modes

-p yes 
_ambiguous      0
_ambiguous_readpair_position    338906
_empty  0
_lowaqual       0
_notaligned     0

-p no 
_ambiguous      1250451
_ambiguous_readpair_position    0
_empty  19932434
_lowaqual       2464580
_notaligned     0

=> 43019516 reads were attached to an exon.

 

ADD REPLY
1
Entering edit mode
@darya-vanichkina-6050
Last seen 4.8 years ago
Australia/Centenary Institute Universit…

Can you please do a grep of your bam file for the offending reads, and post the output here? (it may be a sorting issue, but it may also be a mapping and assigning an incorrect flag issue - which is possible given that the error happens for both pairs of reads with the ID below):

 

samtools view 704G6AAXX_8.sorted.bam | grep "SOLEXA7_1:8:7:7054:17868" 
ADD COMMENT

Login before adding your answer.

Traffic: 237 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6