Question: xy2i in SNps...
0
gravatar for Mayte Suarez-Farinas
14.6 years ago by
Mayte Suarez-Farinas300 wrote:
Hi, I know it have been a lot of questions about the xy2i function in the mailing list, but I could not find my answer, so I am writting to ask your help. I am working with SNPs chips, speciffically, the 10K. I made the CDF packages and read the CEL files with ReadAffy function. While trying to read the sequence information in the CDF files, and crosschecking with the affy object, I got the following result: index<-indexProbes(my.snp,which='both') i<-index[['SNP_A-1513509A']] cbind(i2xy(i),i) x y i [1,] 257 307 202264 ***** [2,] 403 433 285318 ***** [3,] 528 237 156475 [4,] 586 453 298661 [5,] 73 393 258668 [6,] 594 359 236817 [7,] 435 473 311670 [8,] 254 349 229897 [9,] 529 399 263072 [10,] 358 529 348441 [11,] 257 308 202922 ****** [12,] 403 434 285976 ****** [13,] 528 238 157133 [14,] 586 454 299319 [15,] 73 394 259326 [16,] 594 360 237475 [17,] 435 474 312328 [18,] 254 350 230555 [19,] 529 400 263730 [20,] 358 530 349099 But in the CDF file, the information for SNP_A-1513509A is: (I include only 4 probes ) Cell1=257 308 CTTTGTAAAACGCTGATAGAAGAAT SNP_A-1513509A 202921 Cell2=257 307 CTTTGTAAAACGGTGATAGAAGAAT SNP_A-1513509A 202263 Cell3=403 434 TTGTAAAACGGTCATAGAAGAATCC SNP_A-1513509A 285975 Cell4=403 433 TTGTAAAACGGTGATAGAAGAATCC SNP_A-1513509A 285317 The result is the same if I use the fucntion indices2xy(i,abatch=my.snp,xy.offset=0) and the following if I considered xy.offset=1. But none of them coincide with the CDF. x y i [1,] 258 308 202264 [2,] 404 434 285318 [3,] 529 238 156475 [4,] 587 454 298661 [5,] 74 394 258668 [6,] 595 360 236817 [7,] 436 474 311670 [8,] 255 350 229897 [9,] 530 400 263072 [10,] 359 530 348441 [11,] 258 309 202922 [12,] 404 435 285976 [13,] 529 239 157133 [14,] 587 455 299319 [15,] 74 395 259326 [16,] 595 361 237475 [17,] 436 475 312328 [18,] 255 351 230555 [19,] 530 401 263730 [20,] 359 531 349099 So, I don't know if the SNPs handle the index and position in a diferent manner or something else. Any help will be welcome! Thanks in advance!!! Mayte ------------------------ Mayte Suarez-Farinas The Rockefeller University 1230 York Avenue, Box 212 New York, NY 10021 phone: 1-212-327-8186 fax: 1-212-327-7422
cdf • 520 views
ADD COMMENTlink written 14.6 years ago by Mayte Suarez-Farinas300
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 283 users visited in the last hour