write a for loop for searching TF with TFBSTools
1
0
Entering edit mode
HELEN • 0
@ba287559
Last seen 9 weeks ago
Greece

Hello, I have a fasta file with 750 sequences with 40 nucleotides and i want to search to each sequence what transcription factors there are. I don't want todo it manually because it will take a lot of time. So I should make a for loop or a list but i don't know how to do it. Thank you for your help.

 library(JASPAR2020)
library(TFBSTools)
library(Biostrings)
library(S4Vectors)
library(ShortRead)
library(BSgenome.Mmusculus.UCSC.mm10)
fastafile1<- readDNAStringSet("ADAR.Mi_00. (new).20.fa")
readDNAStringSet("ADAR.Mi_00. (new).20.fa")
seqnames <- names(fastafile1)
sequence <-paste(fastafile1)
data(MA0004.1)
data(MA0006.1)
pwmList <- PWMatrixList(MA0004.1=toPWM(MA0004.1), MA0006.1=toPWM(MA0006.1),
                        use.names=TRUE)
readLines("ADAR.Mi_00. (new).20.fa")
subject <- DNAString("AGATCCCTTTAGCTCCTTGGATACTTTCTCTAGCTCCTCCA")

SiteSetList <- DNAStringSet(pwmList, subject, seqname="seq1",
                         min.score="60%", strand="*")
head(writeGFF3(SiteSetList))
TFBSTools R forloop • 118 views
ADD COMMENT
0
Entering edit mode
@d42f6ea7
Last seen 9 weeks ago
New York, NY, USA

Online Class Help Now

ADD COMMENT

Login before adding your answer.

Traffic: 254 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6