CRISPRseek package: offTargetAnalysis() error with mouse genome
2
0
Entering edit mode
nderian ▴ 10
@95b5814b
Last seen 5 weeks ago
Denmark

Hi,

While doing an OT analysis for a specific sequence, I got the following error message:

Error in FUN(X[[i]], ...) : object 'GN' not found

I looked for OTs in mouse genome as following:

seq<-DNAStringSet("GCCCGGAGGCGGGGTGGAGGGGG")
names(seq)<-"test"
offTargetAnalysis(seq,
                         gRNAoutputName=names(seq),
                         format="fasta",
                         BSgenomeName=BSgenome.Mmusculus.UCSC.mm10,
                         findgRNAs = FALSE,
                         gRNA.size = 20,
                         max.mismatch=5,
                         annotatePaired = FALSE,
                         outputDir=out,
                         enable.multicore = TRUE,
                         n.cores.max = 6,
                         scoring.method="CFDscore",
                         txdb = TxDb.Mmusculus.UCSC.mm10.knownGene,
                         orgAnn = org.Mm.eg.db,
                         predictIndelFreq.onTargetOnly=FALSE,
                         calculategRNAefficacyForOfftargets=FALSE,
                         useScore=FALSE,
                         PAM.pattern = "NGG",
                         PAM="NGG",
                         PAM.size =3,
                         PAM.location = "3prime",
                         allowed.mismatch.PAM = 0,
                         annotateExon=TRUE)

When doing the same search in human genome using BSgenome.Hsapiens.UCSC.hg38, TxDb.Hsapiens.UCSC.hg38.knownGene and org.Hs.eg.db, I do not have an issue.

Any idea of what it can be?

Thank you in advance for your feedback.

> sessionInfo( )
R version 4.1.0 (2021-05-18)
Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19043)

Matrix products: default
CRISPRseek • 173 views
ADD COMMENT
1
Entering edit mode
nderian ▴ 10
@95b5814b
Last seen 5 weeks ago
Denmark

Dear Julie,

Thank you very much for your fast reply! I will try what you suggest.

Have a great day.

Best, Nicolas

ADD COMMENT
0
Entering edit mode
Julie Zhu ★ 4.3k
@julie-zhu-3596
Last seen 5 weeks ago
United States

Dear Nicolas,

Thanks for testing CRISPRseek and the feedback!

PAM.pattern should end with a $ sign to indicate that the NGG needs to be in the 3' end.

For your curiosity, the following sequence in Mouse caused the error that you encountered. The PAM.pattern without $ sign will identify the following sequence to be an offtarget. However, there is no activity defined for GN for the CFD scoring algorithm.

GCTTGGAGGA GGAGAGGAGG AGn

Once you set PAM.pattern = "NGG$", it should work. I suggest that you use a less stringent PAM.pattern for research purpose though.

For CRISPRseek Version >= 1.35.2, PAM.pattern will be automatically appended with $ sign if absent and when PAM.location is set to 3prime.

Best,

Julie

ADD COMMENT

Login before adding your answer.

Traffic: 214 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6