Assign taxonomy is not working
0
0
Entering edit mode
safiq713 • 0
@d764bdb7
Last seen 11 weeks ago
Germany

I want to assign taxonomy to my data. Ref data I have downloaded from SILVA data and it is fasta format. I dont get why this is not working any suggestion will be big help

Code

Assign taxonomy

taxa <- addSpecies(seqtab.nochim, refFasta = "arb-silva.de_2022-04-08_id1144657_tax_silva.fasta")

Refe data looks like this: ">ADJL01000005.3856.5362 Bacteria;Actinobacteriota;Actinobacteria;Propionibacteriales;Propionibacteriaceae;Cutibacterium;Propionibacterium acnes J165 UUUUCAUUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCGUGCUUAACACAUGCAAGUCGAACGGAAAGGCCC UGCUUUUGUGGGGUGCUCGAGUGGCGAACGGGUGAGUAACACGUGAGUAACCUGCCCUUGACUUUGGGAUAACUUCAGGA"

Error: "

" Error in .Call2("new_XStringSet_from_CHARACTER", class(x0), elementType(x0), : key 50 (char '2') not in lookup table"

Assigntaxonomy dada2 • 164 views
ADD COMMENT
1
Entering edit mode

What package is that function from?

ADD REPLY
0
Entering edit mode

dada2 pipeline

ADD REPLY
0
Entering edit mode

Next time, please tag with the package name. There is a mechanism in the support site to notify package maintainers but only if it is tagged with the package name. Cheers

ADD REPLY

Login before adding your answer.

Traffic: 446 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6