openPrimer check_constraints cannot compute Tm
0
0
Entering edit mode
wnussbau • 0
@42971998
Last seen 2 days ago
United States

Hi, I'm trying to get up and running to use openPrimer but am having some issues and would appreciate any guidance.

  1. I get an error if I tag any primers as reverse. These go away if all primers are forward.
  2. All melt temperature results using check_constraints are "NA".
  3. Additional constraints throw new errors, but maybe because of #2? ... so one thing at a time.

I believe I have dependencies installed, working and accessible from my R terminal:

> library('openPrimeR')
The number of cores for was set to '2' by 'parallel_setup()'.

----------

system("melting -V")
    NN_PATH = /usr/local/share/MELTING/Data
    CLASSPATH = /usr/local/bin/melting5.jar
    options = '-V'

    This MELTING program is the version 5.2.0.

----------

system("RNAfold -V")
    RNAfold 2.5.0

-----------

system("hybrid-min -V")
    hybrid-min (OligoArrayAux) 3.8
    By Nicholas R. Markham and Michael Zuker
    Copyright (C) 2006
    Rensselaer Polytechnic Institute
    Troy, NY 12810-3590 USA

------------

> system("mafft --help")
    ------------------------------------------------------------------------------
      MAFFT v7.490 (2021/Oct/30)
      https://mafft.cbrc.jp/alignment/software/
      MBE 30:772-780 (2013), NAR 30:3059-3066 (2002)
    ------------------------------------------------------------------------------

I am able to import primers and templates, and even run a limited set of check_constraints:

# load primers
primer_obj <- read_primers(fname="cdc_sars2.fas")

Identifier         ID                       Forward              Reverse                     primer_length_fw   primer_length_rev   Direction   Degeneracy_fw   Degeneracy_rev  Run
1fw                2019-nCoV_N1-F|N1_fw     gaccccaaaatcagcgaaat                              20                0                   fw           1                          1   cdc_sars2
2rev               2019-nCoV_N1-R|N1_rev                          tctggttactgccagttgaatctg    0                 24                  rev          1                          1   cdc_sars2

# load template
template_obj <- read_templates(fname="sars_cov_2_template.fasta")

# load settings file
   filename <- system.file("extdata", "settings",
                           "B_Taq_PCR_evaluate.xml", package = "openPrimeR")
    taq_settings <- read_settings(filename)

# Evaluate limited constraints found in 'settings'
    constraint.df <- check_constraints(primer.df=primer_obj, template.df=template_obj, 
                                       settings=taq_settings, active.constraints =  c("primer_length", "gc_clamp", "gc_ratio", "no_runs", "no_repeats"))

## SUCCESS ##

Additional constraints lead to errors

# Evaluate limited constraints found in 'settings'
    constraint.df <- check_constraints(primer.df=primer_obj, template.df=template_obj, 
                                       settings=taq_settings, active.constraints =  c("primer_length", "gc_clamp", "gc_ratio", "no_runs", "no_repeats", "melting_temp_range"))

## Error in read.table unless I code all primers as forward primers
    Error in read.table(file = file, header = header, sep = sep, quote = quote,  : 
      no lines available in input
    Error in read.table(file = file, header = header, sep = sep, quote = quote,  : 
      no lines available in input

# Rerun with 2019-nCoV_N1-R|N1_rev changed to 2019-nCoV_N1-R|N1_fw

Warning messages:
    1: In min(c(Tm.fw$Tm_C_fw[x], Tm.rev$Tm_C_rev[x]), na.rm = TRUE) :
        no non-missing arguments to min; returning Inf
    2: In min(c(Tm.fw$Tm_C_fw[x], Tm.rev$Tm_C_rev[x]), na.rm = TRUE) :
       no non-missing arguments to min; returning Inf

## FAIL - table is produced but all Tm values are empty (NA)

Including templates for reproducibility:

> NC_045512|Wuhan01
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCC

> EPI_ISL_7190366|Omicron
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACTCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACA

> EPI_ISL_1080064|B.1.243
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCGATTCAACTGGCAGTAACCAGCATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGTTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCG

sessionInfo( )
R version 4.2.0 (2022-04-22)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 20.04.4 LTS

Matrix products: default
BLAS:   /usr/lib/x86_64-linux-gnu/blas/libblas.so.3.9.0
LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.9.0

locale:
 [1] LC_CTYPE=C.UTF-8       LC_NUMERIC=C           LC_TIME=C.UTF-8        LC_COLLATE=C.UTF-8     LC_MONETARY=C.UTF-8    LC_MESSAGES=C.UTF-8    LC_PAPER=C.UTF-8       LC_NAME=C              LC_ADDRESS=C          
[10] LC_TELEPHONE=C         LC_MEASUREMENT=C.UTF-8 LC_IDENTIFICATION=C   

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
[1] openPrimeR_1.18.0

loaded via a namespace (and not attached):
 [1] Rcpp_1.0.8.3            plyr_1.8.7              RColorBrewer_1.1-3      pillar_1.7.0            compiler_4.2.0          GenomeInfoDb_1.32.1     XVector_0.36.0          iterators_1.0.14       
 [9] zlibbioc_1.42.0         bitops_1.0-7            tools_4.2.0             lifecycle_1.0.1         tibble_3.1.7            gtable_0.3.0            pkgconfig_2.0.3         rlang_1.0.2            
[17] foreach_1.5.2           rstudioapi_0.13         DBI_1.1.2               cli_3.3.0               parallel_4.2.0          GenomeInfoDbData_1.2.8  stringr_1.4.0           dplyr_1.0.9            
[25] generics_0.1.2          Biostrings_2.64.0       vctrs_0.4.1             S4Vectors_0.34.0        IRanges_2.30.0          stats4_4.2.0            grid_4.2.0              tidyselect_1.1.2       
[33] glue_1.6.2              R6_2.5.1                fansi_1.0.3             reshape2_1.4.4          ggplot2_3.3.6           purrr_0.3.4             magrittr_2.0.3          codetools_0.2-18       
[41] GenomicRanges_1.48.0    scales_1.2.0            ellipsis_0.3.2          BiocGenerics_0.42.0     assertthat_0.2.1        colorspace_2.0-3        utf8_1.2.2              stringi_1.7.6          
[49] lpSolveAPI_5.5.2.0-17.7 doParallel_1.0.17       RCurl_1.98-1.6          munsell_0.5.0           crayon_1.5.1
openPrimeR • 70 views
ADD COMMENT
0
Entering edit mode

Looks like melting-batch is not working as expected. Can you try to run melting-batch on its own to see whether that works? Maybe you don't have permission to create files in your environment?

If you can't get melting to work, an alternative would be to remove it. Then openPrimeR, should fall back to using an empiric Tm calculation.

ADD REPLY

Login before adding your answer.

Traffic: 142 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6