Search
Question: CRISPRseek How to get a correct result of searchHits2 ?
0
gravatar for liuyue235
17 months ago by
liuyue2350
liuyue2350 wrote:

Hi,

I am using the latest version of CRISPRseek (CRISPRseek_1.16.0). I used the following example script that in the Reference Manual.

> all.gRNAs <- findgRNAs(inputFilePath =
+ system.file("extdata", "inputseq.fa", package = "CRISPRseek"),
+ pairOutputFile = "pairedgRNAs.xls",
+ findPairedgRNAOnly = TRUE)
> all.gRNAs[1]
 A DNAStringSet instance of length 1
    width seq                                              names               
[1]    23 TGTCCTCCACACCAGAATCAGGG                   Hsap_GATA1_ex2_gR40f
> library("BSgenome.Hsapiens.UCSC.hg19")
> hits <- searchHits2(all.gRNAs[1], BSgenomeName = Hsapiens,
+ max.mismatch = 0, chromToSearch = "chrX")
>>> Finding all hits in sequence chrX ...
>>> DONE searching
> hits
strand chrom chromStart chromEnd        name             gRNAPlusPAM       OffTargetSequence 
  +  chrX   48649587 48649609 Hsap_GATA1_ex2_gR40f  TGTCCTCCACACCAGAATCANGG    GTCCTCCACACCAGAATCAGGG 

 

In the column of gRNAplusPAM, the result is TGTCCTCCACACCAGAATCANGG, the PAM is NGG instead of GGG. And it produce same results when I use other gRNAs as a inputfile. the PAM in result always NGG.

But in the package file , the gRNAplusPAM is the correct PAM.

hitsFile <- system.file("extdata", "hits.txt", package="CRISPRseek")
read.table(hitFile)
strand chrom chromStart chromEnd          name         gRNAPlusPAM   OffTargetSequence 
- chr17 51150403 51150425 gRNAf1HsapGATA1ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTGCACACCAGAATGATAG 
+ chr19 51673303 51673325 gRNAf1HsapGATA1ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTCCTCCCCAGAATCAAAG 
+ chrX 48649587 48649609 gRNAf1_Hsap_GATA1_ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTCCACACCAGAATCAGGG
- chrX 83738197 83738219 gRNAf1_Hsap_GATA1_ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTCAACACCAGAATGATAG

What should I do?  Thank you very much for your help.

Best regards

YUE

 

ADD COMMENTlink modified 17 months ago by Julie Zhu3.9k • written 17 months ago by liuyue2350
0
gravatar for Julie Zhu
17 months ago by
Julie Zhu3.9k
United States
Julie Zhu3.9k wrote:
Yue, Yes, that is intended to accommodate allowed.mismatch.PAM, i.e., to make the # of mismatch.PAM determiniation easier. For offtarget analysis, I suggest use the workflow function offTargetAnalysis. If you run the following code snippet, you will find offtargets in the OfftargetAnalysis.xls and gRNA summary in Summary.xls in the directory CRISPRseekDemo useful. Please note that even though the gRNAplusPAM ends with NGG, the on target (mismatch = 0) will have the exact PAM sequence in the OffTargetSequence. library(CRISPRseek) library(BSgenome.Hsapiens.UCSC.hg19) library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(org.Hs.eg.db) outputDir <- file.path(getwd(),"CRISPRseekDemo") inputFilePath <- system.file('extdata', 'inputseq.fa', package = 'CRISPRseek') offTargetAnalysis (inputFilePath, BSgenomeName = Hsapiens, chromToSearch ="chrX", txdb = TxDb.Hsapiens.UCSC.hg19.knownGene, orgAnn = org.Hs.egSYMBOL, outputDir = outputDir, overwrite = TRUE) Best regards, Julie From: "liuyue235 [bioc]" <noreply@bioconductor.org> Reply-To: "reply+b6b54fe1+code@bioconductor.org" <reply+b6b54fe1+code@bioconductor.org> Date: Monday, July 17, 2017 at 11:08 PM To: "Zhu, Lihua (Julie)" <julie.zhu@umassmed.edu> Subject: [bioc] Question: why dose the result of searchHits2 ? Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User liuyue235<https: support.bioconductor.org="" u="" 13507=""/> wrote Question: Question: why dose the result of searchHits2 ?<https: support.bioconductor.org="" p="" 98192=""/>: Hi, I am using the latest version of CRISPRseek (CRISPRseek_1.16.0). I used the following example script that in the Reference Manual. > all.gRNAs <- findgRNAs(inputFilePath = + system.file("extdata", "inputseq.fa", package = "CRISPRseek"), + pairOutputFile = "pairedgRNAs.xls", + findPairedgRNAOnly = TRUE) > all.gRNAs[1] A DNAStringSet instance of length 1 width seq names [1] 23 TGTCCTCCACACCAGAATCAGGG Hsap_GATA1_ex2_gR40f > library("BSgenome.Hsapiens.UCSC.hg19") > hits <- searchHits2(all.gRNAs[1], BSgenomeName = Hsapiens, + max.mismatch = 0, chromToSearch = "chrX") >>> Finding all hits in sequence chrX ... >>> DONE searching > hits strand chrom chromStart chromEnd name gRNAPlusPAM OffTargetSequence + chrX 48649587 48649609 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG GTCCTCCACACCAGAATCAGGG In the column of gRNAplusPAM, the result is TGTCCTCCACACCAGAATCANGG, the PAM is NGG instead of GGG. And it produce same results when I use other gRNAs as a inputfile. the PAM in result always NGG. But in the package file , the gRNAplusPAM is the correct PAM. hitsFile <- system.file("extdata", "hits.txt", package="CRISPRseek") read.table(hitFile) strand chrom chromStart chromEnd name gRNAPlusPAM OffTargetSequence - chr17 51150403 51150425 gRNAf1HsapGATA1ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTGCACACCAGAATGATAG + chr19 51673303 51673325 gRNAf1HsapGATA1ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTCCTCCCCAGAATCAAAG + chrX 48649587 48649609 gRNAf1_Hsap_GATA1_ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTCCACACCAGAATCAGGG - chrX 83738197 83738219 gRNAf1_Hsap_GATA1_ex2Start24End46 TGTCCTCCACACCAGAATCAGGG TGTCCTCAACACCAGAATGATAG What should I do? Thank you very much for your help. Best regards YUE ________________________________ Post tags: crisprseek You may reply via email or visit CRISPRseek How to get a correct result of searchHits2 ?
ADD COMMENTlink written 17 months ago by Julie Zhu3.9k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 348 users visited in the last hour