Search
Question: offTargetAnalysis() Error in weights %*% mismatch.pos : non-conformable arguments (CRISPRSeek)
0
gravatar for robert_w_link
12 months ago by
robert_w_link0 wrote:

Hello,

I recently downloaded CRISPRSeek and I got the tests to work in the vignette (specifically Scenario 5: Target and off-target analysis for user specified gRNAs) and the output looks wonderful. When I tried to replicate the results with a test file on my own, however, I got the error as described in the post title. Here is the following code that I ran:

library(CRISPRseek)
library(BSgenome.Hsapiens.UCSC.hg19)
library(TxDb.Hsapiens.UCSC.hg19.knownGene)
library(org.Hs.eg.db)

input_path = 'Path_to_pwd/Input.fasta'
output_dir = 'Path_to_pwd/CRISPRSeek_Output'
REpatternFile = system.file('extdata','NEBenzymes.fa', package ='CRISPRseek')

offTargetAnalysis(inputFilePath = input_path,
                  findgRNAsWithREcutOnly = FALSE,
                  REpattenFile = REpattenFile,
                  findPairedgRNAOnly = FALSE,
                  findgRNAs = FALSE,
                  BSgenomeName = Hsapiens,
                  txd = TxDb.Hsapiens.UCSC.hg19.knownGene,
                  orgAnn = org.Hs.egSYMBOL,
                  max.mismatch = 0,
                  outputDir = output_dir,
                  overwrite = TRUE)

Validating input ...
>>> Finding all hits in sequence chr1 ...
>>> DONE searching
>>> Finding all hits in sequence chr2 ...
>>> DONE searching
>>> Finding all hits in sequence chr3 ...
>>> DONE searching
.
.
.
>>> DONE searching
>>> Finding all hits in sequence chrUn_gl000249 ...
>>> DONE searching
Building feature vectors for scoring ...
Calculating scores ...
Error in weights %*% mismatch.pos : non-conformable arguments
In addition: Warning message:
In dir.create(outputDir) :
  'path_to_pwd\CRISPRSeek_Output' already exists

Here is the output of the traceback() function:

> traceback()
2: getOfftargetScore(featureVectors, weights = weights)
1: offTargetAnalysis(inputFilePath = input_path, findgRNAsWithREcutOnly = FALSE, 
       REpatternFile = REpatternFile, findPairedgRNAOnly = FALSE, 
       findgRNAs = FALSE, BSgenomeName = Hsapiens, txd = TxDb.Hsapiens.UCSC.hg19.knownGene, 
       orgAnn = org.Hs.egSYMBOL, max.mismatch = 0, outputDir = output_dir, 
       overwrite = TRUE)

Here is a sample of input.fasta (Total number of gRNAs is 613 sequences):

>Ref.A1.RW.92.92RW008.AB253421_0
TGGAAGGGCTAATTTACTCC
>Ref.A1.RW.92.92RW008.AB253421_1
GGAAGGGCTAATTTACTCCA
>Ref.A1.RW.92.92RW008.AB253421_2
GAAGGGCTAATTTACTCCAA
>Ref.A1.RW.92.92RW008.AB253421_3
AAGGGCTAATTTACTCCAAG

Here is the output of the sessionInfo() command:

> sessionInfo(package = "CRISPRseek")
R version 3.3.1 (2016-06-21)
Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows >= 8 x64 (build 9200)

locale:
[1] LC_COLLATE=English_United States.1252  LC_CTYPE=English_United States.1252   
[3] LC_MONETARY=English_United States.1252 LC_NUMERIC=C                          
[5] LC_TIME=English_United States.1252    

attached base packages:
character(0)

other attached packages:
[1] CRISPRseek_1.12.0

loaded via a namespace (and not attached):
 [1] Rcpp_0.12.12                            GenomeInfoDb_1.8.7                     
 [3] XVector_0.12.1                          methods_3.3.1                          
 [5] GenomicFeatures_1.24.5                  bitops_1.0-6                           
 [7] utils_3.3.1                             tools_3.3.1                            
 [9] grDevices_3.3.1                         zlibbioc_1.18.0                        
[11] biomaRt_2.28.0                          digest_0.6.12                          
[13] bit_1.1-12                              RSQLite_2.0                            
[15] memoise_1.1.0                           tibble_1.3.3                           
[17] BSgenome_1.40.1                         TxDb.Hsapiens.UCSC.hg19.knownGene_3.2.2
[19] pkgconfig_2.0.1                         rlang_0.1.1                            
[21] DBI_0.7                                 parallel_3.3.1                         
[23] rtracklayer_1.32.2                      Biostrings_2.40.2                      
[25] S4Vectors_0.10.3                        graphics_3.3.1                         
[27] datasets_3.3.1                          stats_3.3.1                            
[29] IRanges_2.6.1                           stats4_3.3.1                           
[31] ade4_1.7-6                              bit64_0.9-7                            
[33] base_3.3.1                              data.table_1.10.4                      
[35] Biobase_2.32.0                          hash_2.2.6                             
[37] BSgenome.Hsapiens.UCSC.hg19_1.4.0       AnnotationDbi_1.34.4                   
[39] XML_3.98-1.9                            BiocParallel_1.6.6                     
[41] seqinr_3.4-5                            blob_1.1.0                             
[43] org.Hs.eg.db_3.3.0                      Rsamtools_1.24.0                       
[45] GenomicAlignments_1.8.4                 BiocGenerics_0.18.0                    
[47] GenomicRanges_1.24.3                    SummarizedExperiment_1.2.3             
[49] RCurl_1.95-4.8                        

I tried searching around on BioStars, Bioconductor forums, and Stack, but I could not find an answer.

Thank you very much!

ADD COMMENTlink modified 12 months ago by Julie Zhu3.8k • written 12 months ago by robert_w_link0
2
gravatar for Julie Zhu
12 months ago by
Julie Zhu3.8k
United States
Julie Zhu3.8k wrote:

Hi Robert,

I noticed that your installed version is CRISPRseek_1.12.0. Could you please install the most recent version and let me know if it works as expected? Thanks!

FYI, the old version requires that the gRNA input file contains a list of gRNAs with PAM sequence, i.e., 23 instead of 20 nt for SpCas9.

I tried the sequences you listed and it works although it seems that there is no perfect match found in the human genome. I am wondering whether the gRNAs you provided are human sequences.

Best regards,

Julie

 

ADD COMMENTlink written 12 months ago by Julie Zhu3.8k

Thank you, Julie! Updating CRISPRSeek fixed the issue. The gRNAs are not human sequences, so that would make sense.

ADD REPLYlink written 12 months ago by robert_w_link0
Robert, Great! Thanks for letting me know! Best, Julie From: "robert_w_link [bioc]" <noreply@bioconductor.org> Reply-To: "reply+a8155543+code@bioconductor.org" <reply+a8155543+code@bioconductor.org> Date: Tuesday, August 8, 2017 at 1:29 PM To: "Zhu, Lihua (Julie)" <julie.zhu@umassmed.edu> Subject: [bioc] C: offTargetAnalysis() Error in weights %*% mismatch.pos : non-conformable argument Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User robert_w_link<https: support.bioconductor.org="" u="" 13686=""/> wrote Comment: offTargetAnalysis() Error in weights %*% mismatch.pos : non-conformable arguments (CRISPRSeek)<https: support.bioconductor.org="" p="" 98982="" #98985="">: Thank you, Julie! Updating CRISPRSeek fixed the issue. The gRNAs are not human sequences, so that would make sense. ________________________________ Post tags: CRISPRseek You may reply via email or visit C: offTargetAnalysis() Error in weights %*% mismatch.pos : non-conformable argument
ADD REPLYlink written 12 months ago by Julie Zhu3.8k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 252 users visited in the last hour