User: bhanson1806

gravatar for bhanson1806
New User
Last seen:
4 months ago
1 year, 1 month ago

Posts by bhanson1806

<prev • 4 results • page 1 of 1 • next >
Answer: A: "NNG[A|G][A|G]N$" in CRISPRseek code
... Dear Julie Thank you so much for your response!  Kind regards Britt ...
written 4 months ago by bhanson18060
"NNG[A|G][A|G]N$" in CRISPRseek code
... Good day I would like to know what the $ and | signs stand for in the "NNG[A|G][A|G]N$" portion, pertaining to the SaCas9 PAM recognition motif, of the CRISPRseek code?   Many thanks Britt ...
crisprseek sacas9 pam written 4 months ago by bhanson18060
CRISPRseek Ouput File Name
... Hi there Julie When I run the following code: library(CRISPRseek) library(BSgenome.Hsapiens.UCSC.hg19) library(TxDb.Hsapiens.UCSC.hg19.knownGene)  outputDir <- getwd()  inputFilePath <- DNAStringSet("CCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGC") ...
crisprseek outputfilename written 13 months ago by bhanson18060 • updated 13 months ago by Julie Zhu3.8k
Help with CRISPRseek inputFilePath
... Hi there I am looking for paired sgRNA off target sites in the human genome (I already have my on target pair). I am using SaCas9 with two 21 nt sgRNAs. I have no coding background and this is a pretty simple problem!  I am unable to get the inputFilePath to save and be recognized in R. I have a D ...
crisprseek input files written 13 months ago by bhanson18060 • updated 13 months ago by Julie Zhu3.8k

Latest awards to bhanson1806

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 198 users visited in the last hour