User: bhanson1806

gravatar for bhanson1806
New User
Last seen:
2 months, 1 week ago
11 months, 4 weeks ago

Posts by bhanson1806

<prev • 4 results • page 1 of 1 • next >
Answer: A: "NNG[A|G][A|G]N$" in CRISPRseek code
... Dear Julie Thank you so much for your response!  Kind regards Britt ...
written 9 weeks ago by bhanson18060
"NNG[A|G][A|G]N$" in CRISPRseek code
... Good day I would like to know what the $ and | signs stand for in the "NNG[A|G][A|G]N$" portion, pertaining to the SaCas9 PAM recognition motif, of the CRISPRseek code?   Many thanks Britt ...
crisprseek sacas9 pam written 10 weeks ago by bhanson18060
CRISPRseek Ouput File Name
... Hi there Julie When I run the following code: library(CRISPRseek) library(BSgenome.Hsapiens.UCSC.hg19) library(TxDb.Hsapiens.UCSC.hg19.knownGene)  outputDir <- getwd()  inputFilePath <- DNAStringSet("CCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGC") ...
crisprseek outputfilename written 11 months ago by bhanson18060 • updated 11 months ago by Julie Zhu3.7k
Help with CRISPRseek inputFilePath
... Hi there I am looking for paired sgRNA off target sites in the human genome (I already have my on target pair). I am using SaCas9 with two 21 nt sgRNAs. I have no coding background and this is a pretty simple problem!  I am unable to get the inputFilePath to save and be recognized in R. I have a D ...
crisprseek input files written 11 months ago by bhanson18060 • updated 11 months ago by Julie Zhu3.7k

Latest awards to bhanson1806

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 219 users visited in the last hour