User: bhanson1806

gravatar for bhanson1806
Reputation:
0
Status:
New User
Location:
Last seen:
1 week ago
Joined:
9 months, 4 weeks ago
Email:
b**********@gmail.com

Posts by bhanson1806

<prev • 4 results • page 1 of 1 • next >
0
votes
2
answers
179
views
2
answers
Answer: A: "NNG[A|G][A|G]N$" in CRISPRseek code
... Dear Julie Thank you so much for your response!  Kind regards Britt ...
written 7 days ago by bhanson18060
0
votes
2
answers
179
views
2
answers
"NNG[A|G][A|G]N$" in CRISPRseek code
... Good day I would like to know what the $ and | signs stand for in the "NNG[A|G][A|G]N$" portion, pertaining to the SaCas9 PAM recognition motif, of the CRISPRseek code?   Many thanks Britt ...
crisprseek sacas9 pam written 15 days ago by bhanson18060
0
votes
3
answers
171
views
3
answers
CRISPRseek Ouput File Name
... Hi there Julie When I run the following code: library(CRISPRseek) library(BSgenome.Hsapiens.UCSC.hg19) library(TxDb.Hsapiens.UCSC.hg19.knownGene)  outputDir <- getwd()  inputFilePath <- DNAStringSet("CCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGC") ...
crisprseek outputfilename written 9 months ago by bhanson18060 • updated 9 months ago by Julie Zhu3.7k
0
votes
1
answer
203
views
1
answer
Help with CRISPRseek inputFilePath
... Hi there I am looking for paired sgRNA off target sites in the human genome (I already have my on target pair). I am using SaCas9 with two 21 nt sgRNAs. I have no coding background and this is a pretty simple problem!  I am unable to get the inputFilePath to save and be recognized in R. I have a D ...
crisprseek input files written 9 months ago by bhanson18060 • updated 9 months ago by Julie Zhu3.7k

Latest awards to bhanson1806

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 225 users visited in the last hour