User: pgreenbank

gravatar for pgreenbank
New User
Last seen:
2 months, 1 week ago
3 months, 2 weeks ago

Posts by pgreenbank

<prev • 3 results • page 1 of 1 • next >
Comment: C: Irange _ Start and End
... Thanks Michael but that only works where there is one range otherwise I get this error message Error in as.vector(x, mode) :    coercing an AtomicList object to an atomic vector is supported only for   objects with top-level elements of length <= 1 ...
written 9 weeks ago by pgreenbank0
Irange _ Start and End
iranges written 9 weeks ago by pgreenbank0 • updated 9 weeks ago by Michael Lawrence9.5k
DNAString - Long String
... I get an error when storing a large string in DNAString. Is there a limit on the length of the string that can be stored.   library("Biostrings")     DNA_BASES DNA_ALPHABET d <- DNAString("CGTCTCGCGTCTGGGAACGGCCGGGCCCCCAGCGGGCTGTGGTCGCGGGGTGGGGGCCGGAGCGGCGAGGCCCCCCTTACCGGGCTGCGCGGGCCGCCCAGGGCCC ...
dnastring written 3 months ago by pgreenbank0 • updated 3 months ago by Hervé Pagès ♦♦ 12k

Latest awards to pgreenbank

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 337 users visited in the last hour