User: pgreenbank

gravatar for pgreenbank
pgreenbank0
Reputation:
0
Status:
New User
Location:
Last seen:
5 days, 4 hours ago
Joined:
1 month, 1 week ago
Email:
p*********@gmail.com

Posts by pgreenbank

<prev • 3 results • page 1 of 1 • next >
0
votes
1
answers
43
views
1
answers
Comment: C: Irange _ Start and End
... Thanks Michael but that only works where there is one range otherwise I get this error message Error in as.vector(x, mode) :    coercing an AtomicList object to an atomic vector is supported only for   objects with top-level elements of length <= 1 ...
written 5 days ago by pgreenbank0
0
votes
1
answer
43
views
1
answer
Irange _ Start and End
... library("Biostrings") s1 <-   DNAString("TGCTCTCGGGAGCCGCCTCCCGACACCCGAGCCCCGCCGGCGCCTCCCGCTCCCGGCTCCCGGCTCCTGGCTCCCTCCGCCTCCCCCGCCCCTCGCCCCGCCGCCGAAGAGGCCCCGCTCCCGGGTCGGACGCCTGGGTCTGCCGGGAAGAGCGATGAGAGGTGTCTGAAGGTGGCTATTCACTGAGCGATGGGGTTGGACTTGAAGGAATGCCAAGAGATGCTGCCCCCACCCCCTTAGGCCCGAGGGATCAGG ...
iranges written 5 days ago by pgreenbank0 • updated 5 days ago by Michael Lawrence9.3k
0
votes
2
answers
77
views
2
answers
DNAString - Long String
... I get an error when storing a large string in DNAString. Is there a limit on the length of the string that can be stored.   library("Biostrings")     DNA_BASES DNA_ALPHABET d <- DNAString("CGTCTCGCGTCTGGGAACGGCCGGGCCCCCAGCGGGCTGTGGTCGCGGGGTGGGGGCCGGAGCGGCGAGGCCCCCCTTACCGGGCTGCGCGGGCCGCCCAGGGCCC ...
dnastring written 6 weeks ago by pgreenbank0 • updated 6 weeks ago by Hervé Pagès ♦♦ 12k

Latest awards to pgreenbank

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 355 users visited in the last hour