User: beausoleilmo

gravatar for beausoleilmo
Reputation:
0
Status:
New User
Location:
Last seen:
7 months, 1 week ago
Joined:
11 months, 1 week ago
Email:
b***********@gmail.com

Posts by beausoleilmo

<prev • 6 results • page 1 of 1 • next >
0
votes
1
answers
288
views
1
answers
Comment: C: How to prevent readDNAStringSet() function from switching masked sequences (lowe
... I actually look at help pages. I haven't found anything related to that. I also found somebody else, on another forum, asking for the same question and they said to ask the question here. Now, it seems that there are no easy way to do want I'm trying to aim.  This is my solution: I used the raw ge ...
written 7 months ago by beausoleilmo0
0
votes
1
answers
288
views
1
answers
Comment: C: How to prevent readDNAStringSet() function from switching masked sequences (lowe
... The thing is that I want to read a big fasta file, not just individual sequences.  readDNAStringSet(filepath = "~/Desktop/UCSC/my.genome.fa.gz") But this one is not taking the masked sequences... is there a readDNAStringSet that can keep the masked sequences? ...
written 7 months ago by beausoleilmo0
0
votes
1
answer
288
views
1
answer
How to prevent readDNAStringSet() function from switching masked sequences (lowercase) to uppercase sequence?
... I'm using the package Biostrings   library("Biostrings") DNAString("TATCAAATACTCAAGCACtaaggaaacaggaaaatct") will return 37-letter "DNAString" instance seq: TATCAAATACTCAAGCACTAAGGAAACAGGAAAATCT Why is aaggaaacaggaaaatct not staying in lowercase? Is there a way to prevent the transformation t ...
biostrings dna mask repeatmasker written 7 months ago by beausoleilmo0 • updated 7 months ago by James W. MacDonald46k
0
votes
1
answers
552
views
1
answers
Comment: C: liftOver function in rtracklayer package is not working
... I think your right and it's only the names inside the chain and the .GFF that are not matching. I guess in the end, you just have a file with the matching information from the .chain file. For example, I want to get the matching chromosomes from the Zebra finch genome to Darwin's finch genome: geoFo ...
written 10 months ago by beausoleilmo0
0
votes
1
answer
552
views
1
answer
liftOver function in rtracklayer package is not working
... I'm trying to use rtracklayer to run a liftOver. I have the GFF file as well as the fasta file for my reference genome. I'm not able to make lifOver work. It runs, but no sequence match:  library(rtracklayer) ch = import.chain("~/Desktop/LiftOver test/geoFor1ToTaeGut1.over.chain")     Warning mess ...
rtracklayer liftover written 10 months ago by beausoleilmo0 • updated 10 months ago by Michael Lawrence10.0k
0
votes
1
answers
939
views
1
answers
Comment: C: Is there any package helps finding Tandem Repeats ?
... Is there a way to do this with only raw sequences (like "GCAGGGCTACAAGAAAGTTTGAACTGATTTCTTATGAAATAGCAGGCAACATCAATTTCCTAATCGCTTTAAGTCTAAATGACACACTTCTGCACTTTGCCTAAAGTACCACAATGCTTCTTTATAGCTTTCCCTCTATATAATGGCTGTTTCTACCTTATAAACTGCACACAACTCCCTGTTGAAGTTCTTCCCTGTCACAGTCTGCCTGAGTGCCCTATTTAGGTACCTTTGAAGGAGAC ...
written 11 months ago by beausoleilmo0

Latest awards to beausoleilmo

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 136 users visited in the last hour