User: reubenmcgregor88

Reputation:
0
Status:
New User
Location:
Last seen:
1 month, 1 week ago
Joined:
10 months, 1 week ago
Email:
r***************@gmail.com

Posts by reubenmcgregor88

<prev • 35 results • page 2 of 4 • next >
0
votes
0
answers
133
views
0
answers
Is it possible to import many .tsr sequence file into R using bio strings for use in DECIPHER?
... There are a series of amino acid sequences I want to import into R for alignment ,using DECIPHER, with some sequences I imported as FASTA sequences.  The ftp site I want to get them from is : ftp://ftp.cdc.gov/pub/infectious_diseases/biotech/tstransl/. Within this folder there are two types of file ...
biostrings decipher R written 5 months ago by reubenmcgregor880
0
votes
1
answers
188
views
1
answers
Comment: C: Colour a phylogenetic tree, based on column in DECIPHER?
... Yes subsetting seems to be the easiest way to do it, Is there a way to save the image opened in the web browser when using: BrowseSeqs(), rather than doing each strain iteratively and browsing one by one? ...
written 5 months ago by reubenmcgregor880
0
votes
1
answers
188
views
1
answers
Comment: C: Colour a phylogenetic tree, based on column in DECIPHER?
...   Very useful,  The problem is my original data frame is something like this (with about 200 sequences:  id strain full_length_emm GAS131275 emm77.0 GGCTAGAAAAGATACGAATAAACAGTATTCGCTTAGAA GAS09190 emm87.0 ATGGCTAGAAAAGATACGAATAAACAGTATTCGCTTAG S ...
written 5 months ago by reubenmcgregor880
2
votes
1
answer
188
views
1
answer
Colour a phylogenetic tree, based on column in DECIPHER?
... Some background in case I have got the wrong idea here. I have 240 amino acid sequences and want to see how closely related these sequences are (as well as visualising it), and how similar they are between different strains of bacteria. I have a data frame with the sequences as well as a column indi ...
biostrings decipher R written 5 months ago by reubenmcgregor880 • updated 5 months ago by Erik Wright130
0
votes
1
answers
229
views
1
answers
Comment: C: Is it possible to import a multiple fasta alignemnt (.mfa) file into DECIPHER?
... Thanks Erik, I will look up all the functions individually. on (1) my probelm is there are 175 sequences in one .mfa file. What would be your advice on importing them all in one file? (2) Sorry if I was not clear. I go the steps in slighlty the wrong order, I would like to translate all 175 seque ...
written 6 months ago by reubenmcgregor880
2
votes
1
answer
229
views
1
answer
Is it possible to import a multiple fasta alignemnt (.mfa) file into DECIPHER?
... I know this may seem like and obvious question, but I have read the documentation and am finding it hard to destignguish all the different file types etc. I am new to using R for genomics purposes so even an answer potinting me in the right direction of which doumentation to read or tutorials in ter ...
biostrings decipher dna written 6 months ago by reubenmcgregor880 • updated 6 months ago by Erik Wright130
0
votes
1
answers
268
views
1
answers
Comment: C: Pathway analysis from list of differentially expressed genes with fold change, p
... I have a long list of about 20,000, from an array. Thanks ...
written 7 months ago by reubenmcgregor880
1
vote
1
answer
268
views
1
answer
Pathway analysis from list of differentially expressed genes with fold change, pvalues and normalised expression levels in R
... I have been handed a list of genes from an RNAseq experiment and I have no information about how it was generated as it was done a while ago by a company. I have the lis of genes in columns and pvalues/fold change for different comparisons. I also have the normalised expression values for each gene ...
rnaseq limma R pathway analysis written 7 months ago by reubenmcgregor880 • updated 7 months ago by Lluís R330
0
votes
2
answers
403
views
2
answers
Comment: C: MA plot DiffBind in ggplot2
... Thanks Rory, Related question, in the dba.report() output, what are the column headers named after the conditions (i.e. Conc_condition1, Conc_condition2). I assume these are what is used in the dba.plotMA the bXY=TRUE and are (as you explained above) log2 transformed values, but form where are thes ...
written 9 months ago by reubenmcgregor880
2
votes
2
answers
403
views
2
answers
MA plot DiffBind in ggplot2
... Hi again, sorry lots of questions at the moment, I would like to replicate the following function from diffBind > dba.plotMA(tamoxifen, bXY=TRUE) ​ However I don't know how to retrieve this data, in Deseq2 I believe it would be the baseMean column. Or is the "Conc" column output by "dab.repor ...
chipseq diffbind R ggplot2 written 9 months ago by reubenmcgregor880 • updated 9 months ago by Rory Stark2.5k

Latest awards to reubenmcgregor88

Scholar 10 months ago, created an answer that has been accepted. For A: Error in pcaplot3d from pcaExplorer, when running Deseq2 since update of package

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 172 users visited in the last hour