User: Glubbdrubb

gravatar for Glubbdrubb
Glubbdrubb0
Reputation:
0
Status:
New User
Location:
Last seen:
2 months, 1 week ago
Joined:
2 months, 1 week ago
Email:
v***********@gmail.com

Posts by Glubbdrubb

<prev • 3 results • page 1 of 1 • next >
0
votes
1
answers
155
views
1
answers
Comment: C: Exporting a FASTA file from a getBM vs getSequence query
... I fixed it! In the line: names(z) <- apply(fasta[,-1], 2, paste, collapse = "; ") I changed 2 to 1: names(z) <- apply(fasta[,-1], 1, paste, collapse = "; ")     And it works now!   Thank you so much for your help!   ...
written 9 weeks ago by Glubbdrubb0
0
votes
1
answers
155
views
1
answers
Comment: C: Exporting a FASTA file from a getBM vs getSequence query
... Biostrings looks like a very useful package! Thanks for your answer :-) But something went wrong during the paste function. Here's the error I get: > writeXStringSet(z, 'Data/biomartEportTest.fasta') Error in .Call2("write_XStringSet_to_fasta", x, filexp_list, width, lkup,  :   'names(x)' cont ...
written 9 weeks ago by Glubbdrubb0
2
votes
1
answer
155
views
1
answer
Exporting a FASTA file from a getBM vs getSequence query
... A summary: I want to get sequences for a list of genes, with their stable gene IDs, transcript IDs, and gene symbols in the ID lines in the resultant fasta file, like so: >MGP_SPRETEiJ_G0015912|MGP_SPRETEiJ_T0023337|Tab2 ATGACTTCTCTCAACTTGGACTTGCAGTCACAGAATGTTTACCACCATGGAAGAGAAGGA AGTCGAGTGAAT ...
biomart fasta written 9 weeks ago by Glubbdrubb0 • updated 9 weeks ago by James W. MacDonald45k

Latest awards to Glubbdrubb

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 288 users visited in the last hour