User: joyce

gravatar for joyce
joyce0
Reputation:
0
Status:
New User
Location:
Last seen:
1 day, 13 hours ago
Joined:
3 months ago
Email:
j*****************@gmail.com

Posts by joyce

<prev • 10 results • page 1 of 1 • next >
0
votes
1
answers
71
views
1
answers
Comment: C: CRISPRseek offTargetAnalysis errors
... Hi Julie, Thanks for looking into this issue for me. Before I received your response to my question, I edited the post and added another question (B) on a different error message. You might not have seen it. I copied it below: (B) *Building feature vectors for scoring ...* *Calculating scores ...
written 1 day ago by joyce0
0
votes
1
answers
71
views
1
answers
Comment: C: CRISPRseek offTargetAnalysis errors
... Hi Julie, Here are two DNA sequences that incur the error: seq1: ATGGCTTCACAGCTGCCTTTTCCTGCAGACGACTTCGGTATCTACTATGTCCT seq2: ATGGCGGATATGGAGGACCTTTTCGGGAGCGACGTCGACAGTGATGCTGAGCGTAAAG Thanks for your help! Joyce Joyce On Fri, Jan 12, 2018 at 11:07 AM, Julie Zhu [bioc] <noreply@bioconduct ...
written 3 days ago by joyce0
0
votes
1
answer
71
views
1
answer
CRISPRseek offTargetAnalysis errors
... Hi Julie, We have been running offTargetAnalysis on a large set of sequences.  For some of the sequences, we ran into the following 2 kinds of error messages: (A) Searching for gRNAs ... Error in .Call2("new_XStringSet_from_CHARACTER", ans_class, ans_elementType, : key 69 (char 'E') not in looku ...
crisprseek written 3 days ago by joyce0
0
votes
1
answer
75
views
1
answer
CRISPRseek offTargetAnalysis error
... Hi Julie, I am running offTargetAnalysis to find gRNAs and their off-targets in some sequences. For a couple of sequences, I got the following error message while the program was trying to find all hits in a particular sequence: "Error in .seqlengths_TwoBitFile(x) : UCSC library operation failed ...
crisprseek written 4 weeks ago by joyce0 • updated 4 weeks ago by Julie Zhu3.8k
0
votes
1
answer
112
views
1
answer
CRISPRseek gRNA efficacy
... Hi Julie, I noticed an option, "useEfficacyFromInputSeq", in offTargetAnalysis.  Could you please explain how the gRNA efficacy is calculated from off-target analysis, and how is it different from the one calculated from the input sequence?  Does either correspond to the Rule Set 2 scoring methods ...
crisprseek written 11 weeks ago by joyce0 • updated 11 weeks ago by Julie Zhu3.8k
0
votes
1
answers
119
views
1
answers
Comment: C: CRISPRseek CFD score
... Thank you, Julie.  I found out the source of our problem - in our GFF file, the chromosome names were not in the form of chr1, chr2, ... etc.  After making the proper modifications, I was able to get the exon annotations. Thanks again for your help! Joyce ...
written 11 weeks ago by joyce0
0
votes
1
answers
119
views
1
answers
Comment: C: CRISPRseek CFD score
... Hi Julie, I don't find the exon annotation in the OfftargetAnalysis.xls file.  I list the information you requested below: (1) > sessionInfo() R version 3.4.1 (2017-06-30) Platform: x86_64-pc-linux-gnu (64-bit) Running under: CentOS Linux 7 (Core)   Matrix products: default BLAS/LAPACK: / ...
written 12 weeks ago by joyce0
0
votes
1
answer
119
views
1
answer
CRISPRseek CFD score
... Hi Julie, I am using offTargetAnalysis function with CFD scoring method (CRISPRseek verison 1.16.0 from bioconductor) to select a few best-scoring gRNAs for each of a large set of sequences.  In the past, I have used the combination of gRNAefficacy and top10OfftargetTotalScore in the summary file a ...
crisprseek written 12 weeks ago by joyce0 • updated 12 weeks ago by Julie Zhu3.8k
0
votes
1
answer
94
views
1
answer
could not find function "hash"
... Hi Julie, I am using offTargetAnalysis to find gRNAs with CFDscores. I followed the manual and included the subPAM.activity option as follows: results=offTargetAnalysis("exon.fasta", findgRNAsWithREcutOnly = FALSE, annotateExon = TRUE,findPairedgRNAOnly = FALSE, txdb= txdb, max.mismatch = 3, BSgen ...
crisprseek written 12 weeks ago by joyce0 • updated 12 weeks ago by Julie Zhu3.8k
0
votes
1
answer
98
views
1
answer
CFD scores for searchHits?
... I would like to find off-targets of the gRNAs we designed in a 30kb sequence. I could get the Hsu-Zhang scores with the combination of searchHits, buildFeatureVectorForScoring, and getOfftargetScore.  Is it possible to get the CFD scores with some options?   Thank you! ...
crisprseek written 3 months ago by joyce0 • updated 3 months ago by Julie Zhu3.8k

Latest awards to joyce

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 403 users visited in the last hour