User: A

gravatar for A
A40
Reputation:
40
Status:
New User
Location:
Last seen:
2 weeks, 4 days ago
Joined:
1 year, 8 months ago
Email:
a***********@gmail.com

Posts by A

<prev • 69 results • page 2 of 7 • next >
0
votes
0
answers
244
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... Hi Wei,  Resurrecting this post! I figured out the problem and it was simply the sequence of the FASTA file. It was incorrect and the sequence in the cloning vector was slightly different to the reporter gene on the embl website. I am trying to annotate this and generate counts using featurecounts ...
written 6 months ago by A40
0
votes
0
answers
244
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... Ok thank you! Yes I am trying to manually blast the sequence to see if its there! ...
written 7 months ago by A40
0
votes
1
answer
157
views
1
answers
Comment: C: Can DEXSeq ouput be used directly as an input for IsoformSwitchAnalyzeR
... Thank you!! ...
written 7 months ago by A40
0
votes
1
answer
157
views
1
answers
Comment: C: Can DEXSeq ouput be used directly as an input for IsoformSwitchAnalyzeR
... Thank you so much for the quick response! I guess one quick follow up question... As im not too familiar with the command line alignment tools, can a feature counts output (counts over exons) be passed to IsoformSwitchAnalyzeR. Would that suffice as a counts table?   Thanks again! ...
written 7 months ago by A40
1
vote
1
answer
157
views
1
answer
Can DEXSeq ouput be used directly as an input for IsoformSwitchAnalyzeR
... Hi all,    Quick question, I was wondering if it possible to use directly, the output of a DEXSeq analysis and pass it in to analysis for isoformswitchanalyzeR? I have looked but cant find any information on this....   If so, which step can it be picked up from in the vignette?   Many thanks! ...
differential isoform usage isoform isoformswitchanalyzer written 7 months ago by A40 • updated 7 months ago by k.vitting.seerup90
0
votes
0
answers
244
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... apologies, align() output pasted correctly but posted as above, hope thats ok to read? >ENA|AAF03373|AAF03373.1 Zoanthus sp. fluorescent protein FP538 ATGGCTCATTCAAAGCACGGTCTAAAAGAAGAAATGACAATGAAATACCACATGGAAGGG TGCGTCAACGGACATAAATTTGTGATCACGGGCGAAGGCATTGGATATCCGTTCAAAGGG AAACAGACTATTAATCTGTGTGT ...
written 7 months ago by A40
0
votes
0
answers
244
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... aligh() output: |Function : Read alignment (RNA-Seq) || || Input file 1 : lane1_020_Ki_GTCTTGGC_L001_4198STDY7571463_R1.fastq.gz || || Input file 2 : lane1_020_Ki_GTCTTGGC_L001_4198STDY7571463_R2.fastq.gz || || Output file : alignResultsPE_1.BAM (BA ...
written 7 months ago by A40
0
votes
0
answers
244
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... Submittign differenet replies because of word count: Build index output: BuildIndex output: Rsubread 1.32.1 //=========================== indexBuilder setting ===========================\ || || || Index name : reference_index || || Index space : base-space || || One block index : yes || || R ...
written 7 months ago by A40
0
votes
0
answers
244
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... Thank you!! please see below! Apologies this was not done initially: Please see information requested below including all outputs: Session Info: R version 3.5.1 (2018-07-02) Platform: x86_64-apple-darwin15.6.0 (64-bit) Running under: macOS High Sierra 10.13.4 Matrix products: default BLAS: /Syst ...
written 7 months ago by A40
0
votes
0
answers
244
views
0
answers
mapping FASTQ files to single gene (fluorescent reporter)
... Hi all,  I have recently posted an Rsubread featurecounts related question, but I have another one, based on a quality control analysis I would like to do:  I am attempting to identify a fluorescent reporter that is driven of a specific promoter in our cells of interest which we then sort (based o ...
alignment rsubread align written 7 months ago by A40

Latest awards to A

Teacher 6 months ago, created an answer with at least 3 up-votes. For C: RSubread in cygwin

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 192 users visited in the last hour