User: Amer Ghalawinji

New User
Last seen:
5 months, 4 weeks ago
1 year, 7 months ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Amer Ghalawinji

<prev • 5 results • page 1 of 1 • next >
Error in checkForRemoteErrors(val) : QuasR: can't pass alignment parameters
... Hey :) I am trying to do a bisulfite alignment with qAlign function. This is my command: align <- qAlign("/analysis/SampleFile.txt","/analysis/refgenome.fa",aligner="Rbowtie",bisulfite="dir",alignmentParameter=" -m 3 -v 5 --best --strata") I always get the following error whenever i try to pas ...
quasr quasr error alignmentparameters written 6 months ago by Amer Ghalawinji0
Comment: C: Error in gmapR: gsnap not functioning
... it's not the elegant way but let's try with it (or by email?) Fprimers.fasta: >1 ggtggaattttgtgttagttttgggt   =============== Rprimers.fasta: >1 aactttccacctaactactaccctta   =========== test.fa (RefGenome): >seqasdf AGACAAAACAGAAAACTTTATGGAAGATAAAATAAGAATAACAAAATCTTTCCCAAAGAGAAAGA ...
written 6 months ago by Amer Ghalawinji0
Comment: C: Error in gmapR: gsnap not functioning
... yes inside indices directory i have seq directory and it includes the following files: seq.maps (empty directory) seq.chromosome seq.chromosome.iit seq.chrsubset seq.contig seq.contig.iit seq.genomebits seq.genomecomp seq.ref153positions seq.ref12153bitpackcomp seq.ref12153bitpackptrs se ...
written 6 months ago by Amer Ghalawinji0
Error in gmapR: gsnap not functioning
... Hey, I'm trying to preform a bisulfite alignment using gmapR package. This is my code: ========================= library("gmapR") ggd<-GmapGenomeDirectory(file.path(getwd(),"indices"), create=T) gg<-GmapGenome(file.path(getwd(),"test.fa"), directory=ggd, name="seq", create=T) cmet_index ...
gmapr software error written 6 months ago by Amer Ghalawinji0 • updated 6 months ago by Michael Lawrence11k
Comment: C: cmetindex missing in gmapr? Not possible to do bisulfite alignments
... Hey! Well I'm working on my master thesis under supervision of Dr. Nordström, and I got your reply by email two days ago. Actually I tried calling gmapR:::cmetindex(genome) and the result was like this: Error in as.character.default(X[[i]], ...) :    no method for coercing this S4 class to a vect ...
written 19 months ago by Amer Ghalawinji0

Latest awards to Amer Ghalawinji

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 249 users visited in the last hour