User: Steve Pederson

gravatar for Steve Pederson
Reputation:
170
Status:
Trusted
Location:
Australia
Website:
https://www.adelaide.e...
Scholar ID:
Google Scholar Page
Last seen:
2 months, 4 weeks ago
Joined:
10 years, 6 months ago
Email:
s***************@adelaide.edu.au

Posts by Steve Pederson

<prev • 15 results • page 2 of 2 • next >
3
votes
1
answer
3.0k
views
1
answers
Answer: A: Cannot load or update GO.db
... After a bit of playing around it's now installed & loading. Running biocValid(fix=TRUE) sorted it out. ...
written 4.6 years ago by Steve Pederson170
4
votes
1
answer
3.0k
views
1
answer
Cannot load or update GO.db
... Hi, I cannot load or update the package GO.db & can't quite figure a way out of it. I've tried as superuser & a regular user & the installation fails on both attempts. Below is the output after running "R --vanilla" as superuser Thanks, Steve > source("http://bioconductor.org/bio ...
bioclite go.db written 4.6 years ago by Steve Pederson170
0
votes
0
answers
482
views
0
answers
Question about 'updateCel' from package 'affxparser'
... Hi, I'm building an array analysis package using an MCMC process for each gene & am writing the key values (posterior quantiles, mean, sd etc) for each gene to disk using CEL files and the aroma.affymetrix architecture. However I've noticed that on rare occasion, the incorrect values are writ ...
cdf process written 8.4 years ago by Steve Pederson170
0
votes
0
answers
582
views
0
answers
Calculating probe affinities directly from sequence data - GCRMA
... Hi, I'm working on some alternative ideas for fitting exon arrays & was wondering if there is a way to calculate theoretical probe affinities directly from sequence data such as: > myseq<-paste(sample(rep(c("A","C","T","G"),10),25),collapse="") > myseq [1] "ACTCACTTCGCTAAAACATTGGCTA ...
probe written 10.2 years ago by Steve Pederson170
0
votes
1
answer
659
views
1
answers
Comment: C: R and Microarray Analysis in R courses from Imperial College
... Hi John, I had some similar trouble with RCurl_0.95-1, but everything worked fine again when I rolled back to RCurl_0.94-1. The command listMarts() would work, but getBM() gave me a similar error. Hope that's vaguely useful, Steve john seers (IFR) wrote: > > Hi James > > Thanks for ...
written 10.5 years ago by Steve Pederson170

Latest awards to Steve Pederson

Popular Question 14 months ago, created a question with more than 1,000 views. For Bioinformatics Research Associate, University of Adelaide
Appreciated 24 months ago, created a post with more than 5 votes. For BioCAsia, 29-30th November 2018, Melbourne, Australia
Popular Question 4.1 years ago, created a question with more than 1,000 views. For Cannot load or update GO.db
Teacher 4.4 years ago, created an answer with at least 3 up-votes. For A: Cannot load or update GO.db

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 271 users visited in the last hour